Relevant bibliographies by topics / Architecture – United States – Washington (D.C.)

Academic literature on the topic 'Architecture – United States – Washington (D.C.)'

Author: Grafiati
Published: 10 December 2022
Last updated: 28 January 2023

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Contents

Consult the lists of relevant articles, books, theses, conference reports, and other scholarly sources on the topic 'Architecture – United States – Washington (D.C.).'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Journal articles on the topic "Architecture – United States – Washington (D.C.)"

1

Longstreth, Richard. "The Neighborhood Shopping Center in Washington, D. C., 1930-1941." Journal of the Society of Architectural Historians 51, no. 1 (March 1, 1992): 5–34. http://dx.doi.org/10.2307/990638.

Full text
Abstract:
During the 1930s the neighborhood shopping center emerged as an important phenomenon in the development of retail facilities in the United States. Prior to that decade, the type was limited to a modest number of examples built as components of planned residential subdivisions for the well-to-do. By the eve of World War II, the neighborhood shopping center was seen as an advantageous means of meeting the routine needs of people in outlying urban areas generally. During the 1930s, the neighborhood center also became one of the first common building forms to experience a basic reconfiguration to accommodate patterns of widespread automobile usage. Washington, D. C., was the initial and by far the most intensive proving ground for this work at its formative stage. The results were influential nationwide in the shopping center's transformation from a novelty to a ubiquitous feature of the American landscape.
APA, Harvard, Vancouver, ISO, and other styles
2

Helbig, Thorsten, and Matthias Oppe. "Roofs and façades of United States Institute of Peace, Washington D. C." Steel Construction 5, no. 4 (November 2012): 232–37. http://dx.doi.org/10.1002/stco.201210028.

Full text
APA, Harvard, Vancouver, ISO, and other styles
3

Walters, Tom W., Mark Bolda, and Inga A. Zasada. "Alternatives to Current Fumigation Practices in Western States Raspberry." Plant Health Progress 18, no. 2 (January 1, 2017): 104–11. http://dx.doi.org/10.1094/php-rs-16-0068.

Full text
Abstract:
Red raspberry production in the western United States is heavily reliant on preplant soil fumigation to ensure the successful establishment and productivity of a planting. However, due to issues related to the regulation, availability, and economics of soil fumigation, alternatives are needed for current fumigation practices. Trials were conducted in commercial raspberry fields in California and Washington to evaluate alternatives to current fumigation practices in each region. In Washington, tarped bed fumigation with 1,3-dichlorpropene (1,3-D):chloropicrin (Telone C-35) performed as well as, and sometimes better than, the industry standard nontarped broadcast fumigation with Telone C-35 for the control of the soilborne pathogen Phytophthora rubi and the plant-parasitic nematode Pratylenchus penetrans. In one of the Washington trials, yield of raspberry grown in tarped bed-fumigated areas was 47% greater than the yield of plants grown in nontarped broadcast-fumigated areas. In California, a combination of chloropicrin:1,3-D (Pic-Clor 60) performed as well as the industry standard of methyl bromide:chloropicrin. Raspberry plants grown in soil fumigated with either of these fumigants were approximately 26% taller than plants grown in nonfumigated soil. Our results indicate that there are viable fumigation alternatives to the current fumigation systems used in Washington and California raspberry production systems.
APA, Harvard, Vancouver, ISO, and other styles
4

Pfisterer, Valentin. "The Second SWIFT Agreement Between the European Union and the United States of America — An Overview." German Law Journal 11, no. 10 (October 2010): 1173–90. http://dx.doi.org/10.1017/s2071832200020174.

Full text
Abstract:
The United States and other nations have taken numerous military, police and intelligence measures in order to counter terrorists’ threats in response to the September 11 attacks on the World Trade Center in New York City and the Pentagon in Virginia as well as the attempted attack on a target in Washington, D. C.
APA, Harvard, Vancouver, ISO, and other styles
5

Kravets, Danylo. "Functioning of Ukrainian Bureau in Washington D. C. (March 1939 – May 1940)." Proceedings of Vasyl Stefanyk National Scientific Library of Ukraine in Lviv, no. 11(27) (2019): 142–57. http://dx.doi.org/10.37222/2524-0315-2019-11(27)-8.

Full text
Abstract:
The aim of the Ukrainian Bureau in Washington was propaganda of Ukrainian question among US government and American publicity in general. Functioning of the Bureau is not represented non in Ukrainian neither in foreign historiographies, so that’s why the main goal of presented paper is to investigate its activity. The research is based on personal papers of Ukrainian diaspora representatives (O. Granovskyi, E. Skotzko, E. Onatskyi) and articles from American and Ukrainian newspapers. The second mass immigration of Ukrainians to the US (1914‒1930s) has often been called the «military» immigration and what it lacked in numbers, it made up in quality. Most immigrants were educated, some with college degrees. The founder of the Ukrainian Bureau Eugene Skotzko was born near Western Ukrainian town of Zoloczhiv and immigrated to the United States in late 1920s after graduating from Lviv Polytechnic University. In New York he began to collaborate with OUN member O. Senyk-Hrabivskyi who gave E. Skotzko task to create informational bureau for propaganda of Ukrainian case. On March 23 1939 the Bureau was founded in Washington D. C. E. Skotzko was an editor of its Informational Bulletins. The Bureau biggest problem was lack of financial support. It was the main reason why it stopped functioning in May 1940. During 14 months of functioning Ukrainian Bureau in Washington posted dozens of informational bulletins and send it to hundreds of addressees; E. Skotzko, as a director, personally wrote to American governmental institutions and foreign diplomats informing about Ukrainian problem in Europe. Ukrainian Bureau activity is an inspiring example for those who care for informational policy of modern Ukraine.Keywords: Ukrainian small encyclopedia, Yevhen Onatsky, journalism, worldview, Ukrainian state. Keywords: Ukrainian Bureau in Washington, Eugene Skotzko, public opinion, history of journalism, diaspora.
APA, Harvard, Vancouver, ISO, and other styles
6

Dung, J. K. S., L. M. Carris, and P. B. Hamm. "First Report of Ustilago cynodontis Causing Smut of Cynodon dactylon in Washington State, United States." Plant Disease 98, no. 2 (February 2014): 280. http://dx.doi.org/10.1094/pdis-05-13-0560-pdn.

Full text
Abstract:
Bermudagrass (Cynodon dactylon) is an important warm-season perennial turf and forage grass that is typically grown in warm, tropical and subtropical climates. Smutted inflorescences of bermudagrass were observed and collected in Benton County, Washington, United States, in October of 2012 in an unmanaged, naturalized area located near the banks of the Columbia River and adjacent to large expanses of managed turf containing bermudagrass. The climate in this area is favorable to bermudagrass due to the relatively mild winters and hot, dry summers that usually occur in this region. The infected plants occurred in patches alongside healthy plants and several disease foci were observed along a 100-m transect of non-contiguous bermudagrass. The disease was severe wherever it occurred. Diseased inflorescences were covered with black-brown teliospores, distorted, and frequently failed to fully emerge and develop. Teliospores (n = 80) were irregularly globose to subglobose, 5.3 to 7.0 × 4.5 to 6.2 μm (mean 6.4 × 5.9 μm) and 6.2 to 8.8 × 5.3 to 7.0 μm (mean 7.0 × 6.5 μm), with a smooth wall approximately 1 μm thick, and were consistent with previous descriptions of Ustilago cynodontis teliospores (1,3). Teliospores germinated within 24 h when plated on 0.2% malt agar at 16°C and produced 4-celled basidia in a 3+1 arrangement, also consistent with U. cynodontis (3). Basidia gave rise to lateral and terminal, ovoid to long ellipsoidal basidiospores. Basidiospores budded or germinated by hyphae from which lateral or terminal aerial sporidia developed as previously described (3,4). DNA was extracted from sporidia of three single-spored isolates grown in malt extract broth. Complete nucleotide sequences of the 5.8S ribosomal RNA coding region and partial sequences of the internal transcribed spacer (ITS) regions 1 and 2 were obtained from the three isolates using ITS1 and ITS4 primers. The corresponding regions of the three aligned sequences (GenBank Accession Nos. KC920742 to KC920744) were identical and exhibited 99 to 100% identity with U. cynodontis strains previously deposited in GenBank (HM143013, AY740168, AF038825, and AY345000). Representative specimens were deposited in the WSU Mycological Herbarium as WSP 72345 to WSP 72348. This is the first report of U. cynodontis causing smut on bermudagrass in Washington State and represents the northernmost record of this fungus in North America (2). The occurrence of U. cynodontis in Washington State suggests that the pathogen may exist in other hot and dry areas of northwestern North America where bermudagrass is found associated with turf in recreational, landscape, or natural settings. References: (1) S. D. Brook. Trans. R. Soc. N. Z. 84:643, 1957. (2) D. F. Farr and A. Y. Rossman. Fungal Databases, Systematic Mycology and Microbiology Laboratory, ARS, USDA. Online. Retrieved from http://nt.ars-grin.gov/fungaldatabases , April 18, 2013. (3) C. T. Ingold. Trans. Br. Mycol. Soc. 83:251, 1984. (4) C. T. Ingold. Trans. Br. Mycol. Soc. 89:471, 1987.
APA, Harvard, Vancouver, ISO, and other styles
7

Hameed, Shafqat, Ashraf Iqbal, and Kashaf Abdul Razaq. "A Study of Trump’s Narrative about Islam in US Press." Global Digital & Print Media Review IV, no. III (September 30, 2021): 33–43. http://dx.doi.org/10.31703/gdpmr.2021(iv-iii).04.

Full text
Abstract:
The study's goal is to investigate the coverage of Donald Trump's anti-Islam narrative in the United States press. The events of September 11, 2001, in New York City, and in San Bernardino,California, among others, impacted the socio-cultural, socio-economic, socio-political, and foreign policies of many countries throughout the world. The current research is essentially a content analysis of two editorials from two different newspapers in the United States (The NewYork Times and The Washington Post). The editorial contents were divided into four categories: A (US government relations with Muslim countries), B (coverage of Islam/Muslims in the war on terrorism), C(Donald Trump's stance on US-Muslim Countries bilateral relations),and D (US government's stance on US-Muslim Countries bilateral relations). To assess the association between different variables, the Chi-square statistical test was performed. The findings show that following the 2016 presidential elections in the United States, editorial overage of Trump's anti-Islam narrative was less favorable than previously.
APA, Harvard, Vancouver, ISO, and other styles
8

Patterson, David T. "Temperature Responses and Potential Range of the Grass Weed, Serrated Tussock (Nassella trichotoma), in the United States." Weed Technology 8, no. 4 (December 1994): 703–12. http://dx.doi.org/10.1017/s0890037x00028554.

Full text
Abstract:
In controlled-environment chambers, serrated tussock achieved maximum growth in temperature regimes of 18/11, 18/23, 24/23, or 24/17 C day/night. Growth was significantly reduced at 30/11 C, and no plants survived at 36/29 C. Serrated tussock seedlings grew slowly at first but eventually produced vigorous tussocks with as many as 2800 tillers after 140 d in the 24/17 C regime. Comparisons of climatic conditions in New South Wales, Victoria, New Zealand, South Africa, and the United States revealed that similar temperature conditions occur during the warmest eight mo of the year in areas as diverse as Oregon, Washington, the Sierran Nevada foothills of California, upper elevation rangelands in Arizona, and the southern Appalachian highlands. None of these areas has a precipitation pattern similar to those of the sites of serrated tussock weed infestation in the Southern Hemisphere. However, poorly managed pastures and unimproved rangelands in these diverse areas may be vulnerable to invasion by serrated tussock, should the weed become established in the United States.
APA, Harvard, Vancouver, ISO, and other styles
9

Chen, W., F. M. Dugan, and R. McGee. "First Report of Dodder (Cuscuta pentagona) on Chickpea (Cicer arietinum) in the United States." Plant Disease 98, no. 1 (January 2014): 165. http://dx.doi.org/10.1094/pdis-03-13-0334-pdn.

Full text
Abstract:
Chickpea (Cicer arietinum L.) is an important rotational and an emerging specialty crop in the Pacific Northwest of the United States, in California, and in the Northern Great Plains of the United States and Canada. Dodders (Cuscuta spp.) are widespread parasitic weeds on many crops worldwide. Several Cuscuta species (primarily C. campestris Yuncker) have been reported to parasitize chickpea, and dodder is important on chickpea in the Indian subcontinent, the Middle East, and recently in Australia (4), but has previously not been reported from North America. On 28 July 2012, a chickpea field near Walla Walla, WA, was found parasitized by dodder. The chickpea was at late flowering and early pod filling stages and there were no other visible green weedy plants as observed from the canopy. There were about 15 dodder colonies varying in size from 2 to 15 meters in diameter in the field of about 500 acres. Chickpea plants in the center of the dodder colonies were wilting or dead. The colonies consisted of orange leafless twining stems wrapped around chickpea stems and spreading between chickpea plants. Haustoria of the dodder penetrating chickpea stems were clearly visible to the naked eye. Flowers, formed abundantly in dense clusters, were white and five-angled, with capitate stigmas, and lobes on developing calyxes were clearly overlapping. The dodder keyed to C. pentagona Engelm. in Hitchcock and Cronquest (3) and in Costea (1; and www.wlu.ca/page.php?grp_id=2147&p=8968 ). Specimens of dodder plants wrapping around chickpea stems with visible penetrating haustoria were collected on 28 July 2013 and vouchers (WS386115, WS386116, and WS386117) were deposited at the Washington State University Ownbey Herbarium. All dodder colonies in the field were eradicated before seed formation to prevent establishment of dodder. Total genomic DNA was isolated from dodder stems, and PCR primers ITS1 (5′TCCGTAGGTGAACCTGCGG) and ITS4 (5′TCCTCCGCTTATTGATATGC) were used to amplify the internal transcribed spacer (ITS) region of the nuclear rDNA. The ITS region was sequenced. BLAST search of the NCBI nucleotide database using the ITS sequence as query found that the most similar sequence was from C. pentagona (GenBank Accession No. DQ211589.1), and our ITS sequence was deposited in GenBank (KC832885). Dodder (C. approximata Bab.) has been historically a regional problem on alfalfa (Washington State Noxious Weed Control Board 2011). Another species stated to be “mainly” associated with legumes is C. epithymum Murr., and C. pentagona is “especially” associated with legumes (3). The latter species has sometimes been considered a variety (var. calycina) of C. campestris Yuncker (1,3). Although chickpea has been cultivated in the Walla Walla region for over 20 years, to our knowledge, this is the first time dodder has been observed on chickpea in North America. The likely source is from nearby alfalfa or other crop fields, with transmission by farm machinery or wild animals. Some chickpea germplasm exhibits partial resistance to C. campestris (2). References: (1) M. Costea et al. SIDA 22:151, 2006. (2) Y. Goldwasser et al. Weed Res. 52:122, 2012. (3) C. L. Hitchcock and A. Cronquist. Flora of the Pacific Northwest: An Illustrated Manual. University of Washington Press, Seattle, 1973. (4) D. Rubiales et al. Dodder. Page 98 in: Compendium of Chickpea and Lentil Diseases and Pests. W. Chen et al., eds. APS Press, St. Paul, Minnesota, 2011.
APA, Harvard, Vancouver, ISO, and other styles
10

HEY, JEANNE A. K., and LYNN M. KUZMA. "Anti-U.S. Foreign Policy of Dependent States." Comparative Political Studies 26, no. 1 (April 1993): 30–62. http://dx.doi.org/10.1177/0010414093026001002.

Full text
Abstract:
Literature on the foreign policy behavior of economically dependent states holds that they will comply with the foreign policy preferences of the United States, particularly on cold war issues. Regional foreign policies of Mexico and Costa Rica defy this view. Despite significant economic dependence on U.S. aid and trade, both Miguel de la Madrid and Oscar Arias developed peace plans for Central America that directly countered the objectives of the Reagan policy for the area. Pressures resulting from (a) regional security threats, (b) the flow of refugees into Costa Rica and Mexico, (c) the foreign policy traditions of each country, and (d) the need to counteract the effects of dependence guided these presidents to accept the risks of a defiant foreign policy in order to satisfy local demands. Even though heavily dependent and under pressure from the U.S. government to comply with its regional foreign policy, Mexico and Costa Rica implemented policies that served their own national interests and defied Washington.
APA, Harvard, Vancouver, ISO, and other styles
More sources

Dissertations / Theses on the topic "Architecture – United States – Washington (D.C.)"

1

Gilli, Ludivine. "La ville de Washington dans l'après-Seconde Guerre mondiale (1945-1955) : une capitale instrumentalisée, enjeu et outil de politique nationale." Phd thesis, Université Panthéon-Sorbonne - Paris I, 2013. http://tel.archives-ouvertes.fr/tel-00904560.

Full text
Abstract:
Pendant la Seconde Guerre mondiale, la capitale étatsunienne connaît une croissance sans précédent et acquiert une position incontestée de quartier général des Alliés. La Washington de 1945 n'a plus rien à voir avec le paysage urbain peuplé mais somnolent de 1939. Suite à la guerre, que va-t-il advenir du District de Columbia ? Nombre d'acteurs de différents types et niveaux veulent avoir leur mot à dire dans le futur de la capitale. La plupart d'entre eux espèrent utiliser la ville pour promouvoir des intérêts particuliers.Au cours des années d'après-guerre, le District est le théâtre de nombreuses joutes symboliques, qui voient s'affronter l'ensemble des acteurs politiques, économiques et sociaux du pays. Les enjeux sont locaux, nationaux ou internationaux, ils concernent l'administration locale, le droit de vote, la ségrégation, les conditions de logement, etc., ils rejaillissent sur Washington à la fois en tant que ville-symbole et que ville habitée. Ces affrontements et leurs résultats incarnent la capitale et dessinent son futur tout à la fois. Nous étudions ici pourquoi et comment ces évolutions se produisent. Le combat pour l'égalité entre Noirs et Blancs dans le District, par exemple, ouvre la voie à des progrès sur le plan national. La lutte contre les taudis se déroule dans le cadre des programmes de redéveloppement urbain souvent associés au déclin des centres-villes. La lutte pour l'autodétermination et les efforts fournis pour développer les rôles national et international de Washington sont d'autres exemples des dynamiques à l'œuvre dans la capitale entre 1945 et 1955. Après une première partie consacrée à la situation dans le District à la fin de la guerre, afin d'exposer les enjeux qui se posent en 1945, nous examinons les spécificités et implications de son rôle de capitale, tant sur le plan national que sur le plan international. La troisième partie porte sur les évolutions urbaines et sociales dans la ville d'après-guerre.
APA, Harvard, Vancouver, ISO, and other styles

Books on the topic "Architecture – United States – Washington (D.C.)"

1

United States. Congress. Senate. Committee on Banking, Housing, and Urban Affairs. Nominations of N. Gregory Mankiw, Steven B. Nesmith, Jose F. Teran, James Broaddus, Paul D. Pate, Lane Carson, and C. Morgan Edwards: Hearing before the Committee on Banking, Housing, and Urban Affairs, United States Senate, One Hundred Eighth Congress, first session on nominations of N. Gregory Mankiw ... Steven B. Nesmith ... Jose F. Teran ... James Broaddus .. Paul D. Pate ... Lane Carson ... C. Morgan Edwards ... May 13, 2003. Washington: U.S. G.P.O., 2004.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
2

United States. Congress. Senate. Committee on Banking, Housing, and Urban Affairs. Nominations of Saul N. Ramirez, Jr., John D. Hawke, Jr., Harold Lucas, Cardell Cooper, and William C. Apgar: Hearing before the Committee on Banking, Housing, and Urban Affairs, United States Senate, One Hundred Fifth Congress, second session, on nominations of Saul N. Ramirez, Jr., of Texas, to be the Deputy Secretary of Housing and Urban Development, Vice Dwight P. Robinson, resigned; John D. Hawke, Jr., of Washington, DC, to be the Comptroller of the Currency, Vice Eugene Ludwig, resigned; Harold Lucas, of New Jersey, to be the Assistant Secretary of Housing and Urban Development for Public and Indian Housing, Vice Kevin Marchman, resigned; Cardell Cooper, of New Jersey, to be the Assistant Secretary of Housing and Urban Development for Community Planning and Development, Vice Saul N. Ramirez, resigned; William C. Apgar, of Massachusetts ... Vice Nicolas P. Retsinas, resigned, September 23, 1998. Washington: U.S. G.P.O., 1999.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
3

Santoyo, Elsa M. Creating an American masterpiece: Architectural drawings of the Old Executive Office Building, 1871-1888. Washington, DC: American Institute of Architects Press, 1988.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
4

Sorg, Suman. Modern in Context : the Architecture of Suman Sorg, FAIA: Solea Condominiums- Washington, D. C. ORO Editions, 2014.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
5

CLASSICAL ARCHITECTURE AND MONUMENTS OF WASHINGTON, D. C.: A HISTORY AND GUIDE. History Press Limited, The, 2018.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
6

Somma, Thomas P., Isabelle Gournay, and Cynthia R. Field. Paris on the Potomac: The French Influence on the Architecture and Art of Washington, D. C. Ohio University Press, 2013.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
7

O'Connor, Sandra Day. Evolution of Washington, D. C.: Historical Selections from the Albert H. Small Washingtoniana Collection at the George Washington University. Smithsonian Institution Press, 2015.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
8

Sexton, Colleen. Washington, D. C. Bellwether Media, 2021.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
9

Washington D. C.. Macmillan Publishing Co.,U.S., 1997.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
10

Grab A. Grab A Pencil Press. Washington, D. C. Puzzle Book. Applewood Books, 2012.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
More sources

Conference papers on the topic "Architecture – United States – Washington (D.C.)"

1

Honda, Hiroshi. "Overview of Planned ASME/VUPRE Conference Meeting on Vulnerability, Uncertainty and Probability Quantification in Regulatory Engineering, and IMECE2012 and FEOFS2013 RE Sessions." In ASME 2013 International Mechanical Engineering Congress and Exposition. American Society of Mechanical Engineers, 2013. http://dx.doi.org/10.1115/imece2013-62471.

Full text
Abstract:
Regulatory engineering came to be increasingly needed by extensive people of our society to maintain safety, security, and sustainability of the environment, economy, energy, mineral and other resources of our planet among others, as engineering is increasingly globalized to meet the needs and wants of a variety of people and society in the world. The ASME/VUPRE Conference on Vulnerability, Uncertainty and Probability Quantification in Regulatory Engineering was to be held in Washington, D. C. on August 16–18, 2012 or thereafter. The current paper provides an overview of the planned conference presentations and discussion, based on the topics planned, and abstracts submitted among others, as well as those for IMECE2012 Session 5-7-2 Globalization of Regulatory Engineering, and the author’s paper on fatigue and fracture issues of an offshore structure, etc., and role of regulatory engineering, prepared for the 9th International Conference on Fracture and Strength of Solids (FEOFS2013) on June 9–13, 2013 in Jeju, South Korea. Possible impacts of the outcome on the regulatory agencies, regulated communities, scientists and engineers, and general public in the United States, Europe and Japan among other nations and regions are also discussed.
APA, Harvard, Vancouver, ISO, and other styles
You might also be interested in the extended bibliographies on the topic 'Architecture – United States – Washington (D.C.)' for particular source types:
Journal articles Books
We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!

To the bibliography