Academic literature on the topic 'Architecture and state – United States – Washington (D.C.)'

During the 1930s the neighborhood shopping center emerged as an important phenomenon in the development of retail facilities in the United States. Prior to that decade, the type was limited to a modest number of examples built as components of planned residential subdivisions for the well-to-do. By the eve of World War II, the neighborhood shopping center was seen as an advantageous means of meeting the routine needs of people in outlying urban areas generally. During the 1930s, the neighborhood center also became one of the first common building forms to experience a basic reconfiguration to accommodate patterns of widespread automobile usage. Washington, D. C., was the initial and by far the most intensive proving ground for this work at its formative stage. The results were influential nationwide in the shopping center's transformation from a novelty to a ubiquitous feature of the American landscape.

Bermudagrass (Cynodon dactylon) is an important warm-season perennial turf and forage grass that is typically grown in warm, tropical and subtropical climates. Smutted inflorescences of bermudagrass were observed and collected in Benton County, Washington, United States, in October of 2012 in an unmanaged, naturalized area located near the banks of the Columbia River and adjacent to large expanses of managed turf containing bermudagrass. The climate in this area is favorable to bermudagrass due to the relatively mild winters and hot, dry summers that usually occur in this region. The infected plants occurred in patches alongside healthy plants and several disease foci were observed along a 100-m transect of non-contiguous bermudagrass. The disease was severe wherever it occurred. Diseased inflorescences were covered with black-brown teliospores, distorted, and frequently failed to fully emerge and develop. Teliospores (n = 80) were irregularly globose to subglobose, 5.3 to 7.0 × 4.5 to 6.2 μm (mean 6.4 × 5.9 μm) and 6.2 to 8.8 × 5.3 to 7.0 μm (mean 7.0 × 6.5 μm), with a smooth wall approximately 1 μm thick, and were consistent with previous descriptions of Ustilago cynodontis teliospores (1,3). Teliospores germinated within 24 h when plated on 0.2% malt agar at 16°C and produced 4-celled basidia in a 3+1 arrangement, also consistent with U. cynodontis (3). Basidia gave rise to lateral and terminal, ovoid to long ellipsoidal basidiospores. Basidiospores budded or germinated by hyphae from which lateral or terminal aerial sporidia developed as previously described (3,4). DNA was extracted from sporidia of three single-spored isolates grown in malt extract broth. Complete nucleotide sequences of the 5.8S ribosomal RNA coding region and partial sequences of the internal transcribed spacer (ITS) regions 1 and 2 were obtained from the three isolates using ITS1 and ITS4 primers. The corresponding regions of the three aligned sequences (GenBank Accession Nos. KC920742 to KC920744) were identical and exhibited 99 to 100% identity with U. cynodontis strains previously deposited in GenBank (HM143013, AY740168, AF038825, and AY345000). Representative specimens were deposited in the WSU Mycological Herbarium as WSP 72345 to WSP 72348. This is the first report of U. cynodontis causing smut on bermudagrass in Washington State and represents the northernmost record of this fungus in North America (2). The occurrence of U. cynodontis in Washington State suggests that the pathogen may exist in other hot and dry areas of northwestern North America where bermudagrass is found associated with turf in recreational, landscape, or natural settings. References: (1) S. D. Brook. Trans. R. Soc. N. Z. 84:643, 1957. (2) D. F. Farr and A. Y. Rossman. Fungal Databases, Systematic Mycology and Microbiology Laboratory, ARS, USDA. Online. Retrieved from http://nt.ars-grin.gov/fungaldatabases , April 18, 2013. (3) C. T. Ingold. Trans. Br. Mycol. Soc. 83:251, 1984. (4) C. T. Ingold. Trans. Br. Mycol. Soc. 89:471, 1987.

The aim of the Ukrainian Bureau in Washington was propaganda of Ukrainian question among US government and American publicity in general. Functioning of the Bureau is not represented non in Ukrainian neither in foreign historiographies, so that’s why the main goal of presented paper is to investigate its activity. The research is based on personal papers of Ukrainian diaspora representatives (O. Granovskyi, E. Skotzko, E. Onatskyi) and articles from American and Ukrainian newspapers. The second mass immigration of Ukrainians to the US (1914‒1930s) has often been called the «military» immigration and what it lacked in numbers, it made up in quality. Most immigrants were educated, some with college degrees. The founder of the Ukrainian Bureau Eugene Skotzko was born near Western Ukrainian town of Zoloczhiv and immigrated to the United States in late 1920s after graduating from Lviv Polytechnic University. In New York he began to collaborate with OUN member O. Senyk-Hrabivskyi who gave E. Skotzko task to create informational bureau for propaganda of Ukrainian case. On March 23 1939 the Bureau was founded in Washington D. C. E. Skotzko was an editor of its Informational Bulletins. The Bureau biggest problem was lack of financial support. It was the main reason why it stopped functioning in May 1940. During 14 months of functioning Ukrainian Bureau in Washington posted dozens of informational bulletins and send it to hundreds of addressees; E. Skotzko, as a director, personally wrote to American governmental institutions and foreign diplomats informing about Ukrainian problem in Europe. Ukrainian Bureau activity is an inspiring example for those who care for informational policy of modern Ukraine.Keywords: Ukrainian small encyclopedia, Yevhen Onatsky, journalism, worldview, Ukrainian state. Keywords: Ukrainian Bureau in Washington, Eugene Skotzko, public opinion, history of journalism, diaspora.

The Highway Development and Management System (HDM-4) developed by the World Bank is a powerful pavement management software tool capable of performing technical and economic appraisals of road projects, investigating road investment programs, and analyzing road network preservation strategies. Its effectiveness is dependent on the proper calibration of its predictive models to local conditions. Although significant work has been done in calibrating and applying HDM-4 worldwide (especially in developing nations), no substantial effort has been made within the United States. This paper describes the calibration and application of HDM-4 (Version 1.3) to the Washington State Department of Transportation's (WSDOT) road network. WSDOT hopes to use HDM-4 to supplement its existing Washington State Pavement Management System (WSPMS) in long-term pavement performance and financial needs. Significant findings are that ( a) HDM-4 can be used to analyze the WSDOT road network, ( b) HDM-4 was successfully calibrated for the network, ( c) the network requires calibration factors significantly different than HDM-4 default values, ( d) software issues seem to prevent use of HDM-4 portland cement concrete pavement analysis, and ( e) WSDOT can use HDM-4 to predict pavement preservation budgets quickly, select optimal preservation strategies under varying budget levels, and assist in determining the long-term effects of different funding scenarios on the road network.

Chickpea (Cicer arietinum L.) is an important rotational and an emerging specialty crop in the Pacific Northwest of the United States, in California, and in the Northern Great Plains of the United States and Canada. Dodders (Cuscuta spp.) are widespread parasitic weeds on many crops worldwide. Several Cuscuta species (primarily C. campestris Yuncker) have been reported to parasitize chickpea, and dodder is important on chickpea in the Indian subcontinent, the Middle East, and recently in Australia (4), but has previously not been reported from North America. On 28 July 2012, a chickpea field near Walla Walla, WA, was found parasitized by dodder. The chickpea was at late flowering and early pod filling stages and there were no other visible green weedy plants as observed from the canopy. There were about 15 dodder colonies varying in size from 2 to 15 meters in diameter in the field of about 500 acres. Chickpea plants in the center of the dodder colonies were wilting or dead. The colonies consisted of orange leafless twining stems wrapped around chickpea stems and spreading between chickpea plants. Haustoria of the dodder penetrating chickpea stems were clearly visible to the naked eye. Flowers, formed abundantly in dense clusters, were white and five-angled, with capitate stigmas, and lobes on developing calyxes were clearly overlapping. The dodder keyed to C. pentagona Engelm. in Hitchcock and Cronquest (3) and in Costea (1; and www.wlu.ca/page.php?grp_id=2147&p=8968 ). Specimens of dodder plants wrapping around chickpea stems with visible penetrating haustoria were collected on 28 July 2013 and vouchers (WS386115, WS386116, and WS386117) were deposited at the Washington State University Ownbey Herbarium. All dodder colonies in the field were eradicated before seed formation to prevent establishment of dodder. Total genomic DNA was isolated from dodder stems, and PCR primers ITS1 (5′TCCGTAGGTGAACCTGCGG) and ITS4 (5′TCCTCCGCTTATTGATATGC) were used to amplify the internal transcribed spacer (ITS) region of the nuclear rDNA. The ITS region was sequenced. BLAST search of the NCBI nucleotide database using the ITS sequence as query found that the most similar sequence was from C. pentagona (GenBank Accession No. DQ211589.1), and our ITS sequence was deposited in GenBank (KC832885). Dodder (C. approximata Bab.) has been historically a regional problem on alfalfa (Washington State Noxious Weed Control Board 2011). Another species stated to be “mainly” associated with legumes is C. epithymum Murr., and C. pentagona is “especially” associated with legumes (3). The latter species has sometimes been considered a variety (var. calycina) of C. campestris Yuncker (1,3). Although chickpea has been cultivated in the Walla Walla region for over 20 years, to our knowledge, this is the first time dodder has been observed on chickpea in North America. The likely source is from nearby alfalfa or other crop fields, with transmission by farm machinery or wild animals. Some chickpea germplasm exhibits partial resistance to C. campestris (2). References: (1) M. Costea et al. SIDA 22:151, 2006. (2) Y. Goldwasser et al. Weed Res. 52:122, 2012. (3) C. L. Hitchcock and A. Cronquist. Flora of the Pacific Northwest: An Illustrated Manual. University of Washington Press, Seattle, 1973. (4) D. Rubiales et al. Dodder. Page 98 in: Compendium of Chickpea and Lentil Diseases and Pests. W. Chen et al., eds. APS Press, St. Paul, Minnesota, 2011.

In early June 2002, yellow spots and bands with erumpent telia on previous year's needles of Colorado blue spruce (Picea pungens) were noted in landscape tree nurseries in both northern (Sawyer County) and southern (Dane County) Wisconsin. Many 1 to 2 m tall trees were symptomatic at each location. Based on the age of affected needles, time of year of telium development, and telial characteristics including the size and shape of teliospores, the pathogen was identified as Chrysomyxa weirii, the cause of Weir's cushion rust (1,2). Identification of the pathogen was confirmed by Dale Bergdahl, (School of Natural Resources, University of Vermont), who also observed basidiospores. C. weirii is an autoecious microcyclic rust pathogen known to affect P. englemanii, P. glauca, P. mariana, P. pungens, and P. sitchensis. Although this fungus has been reported in the western United States from the Black Hills of South Dakota to Washington State, in the eastern United States from the southern Appalachian Mountains (Tennessee and West Virginia) to Vermont, and in most Canadian provinces and territories (1,2), to our knowledge, this is the first report from the Great Lakes Region of the United States. The occurrence of Weir's cushion rust in Wisconsin has direct implications for the economically important nursery and Christmas tree industry in this region. References: (1) D. Bergdahl and D. Smeltzer. Plant Dis. 67:918, 1983. (2) W. Ziller. The Tree Rusts of Western Canada. Canadian Forestry Service, Victoria, BC, 1974.

ABSTRACT Most of the oil spills in marine, estuarine, or freshwater environments of the United States are small (less than 1,000 gallons) and result in minimal injury to natural resources or little to no loss of services. However, federal, state, and Indian tribe trustees for natural resources are entitled under a variety of laws, including the Oil Pollution Act of 1990, to collect damages (money) from responsible parties to compensate for the foregone services and restoration of the services provided by the natural resources. Alaska, Washington, and Florida have developed a formula-based approach to calculating natural resource damages resulting from most spills; the federal National Oceanic and Atmospheric Administration and several other states are considering developing a compensation formula. The ideal compensation formula is a simplified assessment process that (a) can be applied rapidly, (b) requires relatively small transaction or assessment costs, (c) requires minimal site- and spill-specific data as inputs, (d) is based on generally accepted scientific and economic principles and methods, and (e) results in damage values acceptable to both the trustees and the responsible party. In theory, a compensation formula could be applied to most small oil spills in United States waters.

The article analyzes the current state of the system of international relations in the context of the transformation of the modern world order. It is determined that cardinal changes in the system of international relations occur due to the destructive policy of the collective West led by the United States, aimed at maintaining a unipolar world and dominance in the world political process. Under these conditions, the new centers of world development, to which the authors include Russia, China and India, tend to pursue an independent and uncontrolled foreign policy, which is not supported by Washington. It is noted that the confrontation between the leading centers of regional and world development for global leadership is accompanied by the destruction of the architecture of international security and the unleashing of a new arms race. It is stated that during the presidency of D. Trump, the United States, trying to stop the economic development of China, unleashed world sanctions wars, which resumed with the greatest force after the arrival of the new US President D. Biden and the start of a special military operation in Ukraine. It is determined that the sanctions wars gave rise to global risks, to which the authors include the destruction of the institutions of international law, the support of the West for organized transnational criminal groups in the areas of drug traffi cking and the organization of illegal migration, the fi nancing and support of the United States and its allies of terrorist and extremist organizations, radicals and Nazis. Numerous examples of numerous sanctions imposed against the Russian Federation in the political, economic, military, social, legal and other spheres of public life are given, which required the states to coordinate their actions to ensure the national security of the Russian Federation, and the federal executive authorities to develop and apply numerous countermeasures against them. The modern activities of the military-political leadership of the Russian Federation are analyzed, which made it possible to neutralize the main challenges and threats to the Russian state, increase the level of the country's defense capability, and protect the main spheres of public life of Russian society from the destructive impact of foreign policy factors. The results are summed up and the authors make a forecast about the further development of the system of international relations, as well as the place and role of the Russian Federation in them.

A visual survey in 1998 of a commercial block of 594 sweet cherry trees (Prunus avium) in Yakima County, WA, revealed three trees of cv. Bing growing on Mazzard rootstock that exhibited a progressive decline characterized by a premature drop of yellowed leaves prior to fruit maturity and small, late ripening cherries that were unsuitable for the fresh market. Many young branches of these trees died during the winter, resulting in a sparse, open canopy depleted of fruiting shoots. The budded variety of a fourth tree had died, allowing the F12/1 rootstock to grow leaves that showed intense line patterns. Prunus necrotic ringspot virus or Prune dwarf virus are common ilarviruses of cherry trees but were only detected by ELISA (Agdia, Elkhart, IN) in two of the Bing trees. A virus was readily transmitted mechanically from young leaves of each of the two ilarvirus-negative trees to Chenopodium quinoa and Nicotiana occidentalis strain ‘37B’, which within 5 days, developed systemic mottle and necrotic flecking, respectively. Gel analysis of double-stranded RNA (dsRNA) isolated from C. quinoa revealed two abundant bands of approximately 6.5 and 8.0 kbp. The C. quinoa plants and the four symptomatic orchard trees were free of Arabis mosaic virus, Blueberry leaf mottle virus, Peach rosette mosaic virus, Raspberry ringspot virus, Strawberry latent ringspot virus, Tobacco ringspot virus, Tomato black ring virus, and Tomato ringspot virus when tested by ELISA. However, C. quinoa leaf extracts reacted positively in gel double diffusion assays with antiserum prepared to the cherry isolate of Cherry leafroll virus (CLRV) (2). A CLRV-specific primer (3) was used for first strand synthesis followed by self-primed second strand synthesis to generate cDNAs from the dsRNA. A consensus sequence of 1,094 bp generated from three clones of the 3′-untranslated region (3′-UTR) of CLRV (GenBank Accession No. GU362644) was 98% identical to the 3′-UTR of CLRV isolates from European white birch (GenBank Accession Nos. 87239819 and 87239633) and 96% identical to European CLRV isolates from sweet cherry (GenBank Accession Nos. 87239639 and 8729640) (1). Reverse transcription (RT)-PCR using primers specific for the 3′-UTR (CGACCGTGTAACGGCAACAG, modified from Werner et al. [3] and CACTGCTTGAGTCCGACACT, this study), amplified the expected 344-bp fragment from the original four symptomatic trees and two additional symptomatic trees in the same orchard. Seventy-two nonsymptomatic trees were negative by the RT-PCR for CLRV. In 1999, CLRV was detected by RT-PCR in six of eight samples and seven of eight samples from declining trees in two additional orchards located 2.5 km and 23.3 km from the original site, respectively. Sequences of the 344-bp amplicons from these sites were 99.7% identical to those obtained from the first site. To our knowledge, this is the first report of the natural occurrence of CLRV in sweet cherry in the United States. Unlike other nepoviruses, CLRV appears not to be nematode transmitted; however, since this virus can be seed and pollen borne in some natural and experimental systems, its presence in independent orchards of a major production region raises concern about its long term impact on sweet cherry production. References: (1) K. Rebenstorf et al. J. Virol. 80:2453, 2006. (2) D. G. A. Walkey et al. Phytopathology 63:566, 1973. (3) R. Werner et al. Eur. J. For. Pathol. 27:309, 1997.

Resumen: El presente artículo se encuentra dividido en cinco apartados que permiten que su lectura y comprensión sea mucho más amigable. Es interesante y entender que el tema del terrorismo es un tema de naturaleza dinámica y cambiante, en el artículo se estudiara los diferentes tipos de terrorismo que existe y el impacto que ha tenido en el establecimiento de los estados de seguridad pública, así como la afectación a los derechos humanos de las personas y los regímenes jurídicos en los cuales se tipifica esta figura. Abstract: This article is divides into five sections that allow its reading and understanding to be much more user-friendly. It is interesting to understand that the issue of terrorism is a dynamic and changing issue, the article will study the different types of terrorism that exist and the impact it has had on the establishment of states of publica security as well as the impact to the human rights of persons and the legal regimes in which this figure is typified. Fuentes de consulta: Arendt H. (2006) Sobre la revolución, Madrid: Alianza. Báez Corona, J. F. (2015). El realismo mágico jurídico (recreación legal de una ficción literaria con especial referencia a Latinoamérica). Justicia. (28), 15-31. doi:http://dx.doi.org/10.17081/just.20.28.1032 Báez, J. (2021). Tradición contra innovación en los modelos de formación jurídica universitaria en México. Revista de Derecho. (56). 137-153. https://dx.doi.org/10.14482/dere.56.340 Bakke E. (2015) Terrorism and Conterterrorism studies, comparing theory and practice, Netherlands, Leiden University Press. Bobbio N. (2004) Estado, Gobierno y Sociedad por una teoría general de la política, México, Fondo de Cultura Económica. Caillois R. (1973) La cuesta de la guerra (trad.) Rufina Bórquez, México, Fondo de Cultura Económica. Coteño Muñoz A. (2018) “Terrorismo individual los atentados perpetrados por actores solitarios” Eunomía. Revista en Cultura de la Legalidad, número 15 Madrid, Universidad Carlos III. Donner, F. (2007) “Fight for God- But Do So with Kindness: Reflections on War, Peace, and Communal Identity in Early Islam”. In War and Peace in the Ancient World, Oxford. Blackwell. Durham M. (2000) The Christian right, the far right and the Boundaries of American Conservatism. Manchester: Manchester University Press. Dworkin R, (2013) “Foreword”, in Extreme Speech and Democracy, Oxford, Oxford University Press. Essig, C. (2001). Terrorism: Criminal Act of Act of War? Implications for National Security in the 21st Century. Pennsylvania: US Army War College. Foucault, M. (2009) Historia de la sexualidad 1. La voluntad de saber, México, Siglo XXI. Friedman B, H., Harper J, Preble C. (2010) Terrorizing ourselves. Why U.S. Counterterrorism Policy is Failing and How to Fix It. Washington D.C. Instituto Cato. Gallego, C. (2012). El concepto de seguridad jurídica en el Estado social. Revistas jurídicas. Vol 2, Núm 9, Recuperado de http://juridicas.ucaldas.edu.co/downloads/Juridicas9(2)_6.pdf Griset, P. L., Mahan, S. (2003) Terrorism in perspective, United States of America. Sage Publications Inc. González Calleja, E. (2013). El Laboratorio del Miedo, Madrid, Crítica. Habermas J. (1998) Derechos humanos y soberanía popular. Las versiones liberal y republicana, en Rafael del Águila, Fernando Val, Madrid, Alianza Habermas J. (1994) La desobediencia civil, piedra de toque del Estado democrático de Derecho, en Ensayos políticos, Barcelona, Península. Heydar S. (2017) Islamic Peace Ethics. Legitimate and Illegitimate Violence in Contemporary Islamic Thought. United States of America, Baden-Baden: NomosAschendorff Verlag. Hoffman B., Howard R. (2011) Terrorism and counterterrorism: Understandin the new security environment readings and interpretations: 4a eth, United States of America, Mcgraw-Hill. Hoffman, B. (2006). Inside Terrorism. New York: Columbia University Press. Jackson, R, et al., (2011) Terrorism. A Critical Introduction, New York, Palgrave Macmillian Jassies N. (2009) Mrinus Van Der Lubbe y el incendio del Reichstag. Trad., García Velasco C., España, Editorial Alikornio. Jellinek G (1954) Teoría Geenral de los Estados. Trad. Fernando de los Ríos. Buenos Aires, ed. Albatroz. Jenkins, B.M. (1975), "International Terrorism: A New Mode of Conflict", in Garitón D, y Schaerf C. Internactional Terrorism and World Security, Londres, Cromm Helm. Johnston, T. D. (1981). Selective costs and benefits in the evolution of learning. En J. S. Rosenblatt, R .A. Hinde, C. Beer y M. C. Busnel (Eds.). Advances of the study of behavior. New York: Academic Press Kilpatrick J (2020) Quand un état d’urgence temporarire devient permanent, le cas de la France. París, Transnational Institute. Khadduri, M. (1955) War and Peace in the Law of Islam. Baltimore, The Johns Hopkins Press. Kyrou, A. (2012). L’imaginaire des Anonymous, des luddites à V pour Vendetta. París Folis esssays Lasoen, K. (2018). “War of Nerves: The Domestic Terror Threat and the Belgian Army”. In Studies in Conflict & Terrorism, vol. 42, no. 11. Le Goff J. (1984) La Civilisation d l’occident médiéval, París, Foils Essay. Lillich, B. R. (1985) Paris Minimum Standards of Human Rights Norms in a State of Emergency, The American Journal of International Law, Vol. 79, No. 4 Locke J. (1997), Segundo tratado sobre el gobierno civil, Madrid, Alianza. Loubet Del Bayle, J. L. (1992) La Police. Approche socio-politique. Paris, Montchrestien. Luhmann, N. (2005) El derecho de la sociedad, 2a ed., México, Herder, Universidad Iberoamericana. Majoran, A. (2015). The illusion of war: Is terrorism a criminal act or an act of war? International Politics Reviews, Vol.3 Issue 1 Martin J-C, (2006) Les règles internationales relatives à la lutte contre le terrorismo. París, edición Bruylant. Nateras González M, E. (2018) Colombia Las autodefensas en Michoacán, México: ¿rescate de la ciudadanía ante la violencia? Revista Opinión Jurídica, Universidad de Medellín, Vol. 17, Núm. 33 Placido A. P., y Perkins L K. (2010) Drug Trafficking violence in México implications for the United States. Washington D.C. U.S. Senate Caucus on International Narcotics Control Departmente of Justice Poczynok, I. (2019). Fuerzas armadas y contraterrorismo. Apuntes para renovar un “debate crónico” en la Argentina. Revista Relaciones Internacionales, Estrategia Y Seguridad, vol. 2, Núm. 14 Poland J. (2004) Understanding Terrorism: Groups, Strategies and responses. New York. Pretince Hall. Rawls J (1999) La justificación de la desobediencia civil, en Justicia como equidad. Materiales para una teoría de la justicia, Madrid, Tecnos. Reinares, F y García-Calvo, C. (2016) Estado Islámico en España. Madrid: Real Instituto Elcano. Rivas, P., y Rey, P. (2008) Las autodefensas y el paramilitarismo en Colombia (1964-2003), Bogotá, CON Fines. Rapoport, D. (2004). “The four waves of modern terrorism”. En Audrey, C. y James, L. Attacking Terrorism: Elements of a Grand Strategy. Washington D.C. George town University Press Rodley N. (1985) International Human Rights Law, dans Evans, M. D, International Law, Oxford, Oxford University Press. Reitberger M (2013) “License to kill: is legitimate authority a requirement for just war? in International Theory, Cambridge, Cambridge University Press, Vol. 5, Issue 1. Robespierre Maximilien (2005) Por la felicidad y por la libertad, discursos. España, El viejo topo. Rousseau J. J., (2013) Discurso sobre el origen y fundamento de la desigualdad entre los hombres, Madrid, Calpe. Tinnes J. (2020) Bibliography: Defining and Conceptualizing Terrorism Compiled PERSPECTIVES ON TERRORISM Volume 14, Issue 6, The Netherlands Universiteit Leiden. recuperado de https://www.universiteitleiden.nl/perspectives-on-terrorism/archives/2020#volume-xiv-issue-6 Toboso Buezo M. (2020) Colección Segmentos de Seguridad Terrorismo y antiterrorismo. España. Institut de Seguretat Pública de Catalunya.. Saint Thomas Aquinas (2003) On law, morality and Politics, translated by Regan Richard United States of America, Hackett publishing company. Sinai, J. (2008) “How to Define Terrorism”, Perspectives on Terrorism, Journal of the Terrorism Research Initiative and the Center for Terrorism and Security Studies, The Netherlands, Universiteit Leiden, Vol. 2, No.4, recuperado de http://www.terrorismanalysts.com/pt/index.php/pot/article/view/33/html Skinner, B. F. (1953) Science and human behavior. New York, The Macmillan Company. United States Department of State. (2004) Patterns of Global Terrorism 2003 Washington, DC: Office of the Secretary of State, Office of the Coordinator for Counterterrorism. Valadés D. (1974) La dictadura constitucional en América Latina, México, UNAM. Walther T C., Höhn A., (2020) El ejército alemán y sus graves problemas con la ultraderecha. DW noticiero recuperado de https://www.dw.com/es/el-ej%C3%A9rcito-alem%C3%A1n-y-sus-graves-problemas-con-la-ultraderecha/a-54044495 Wallace, D. (2008). Combatiendo el terrorismo bajo las leyes de la guerra. Military Review Hispan-American, Vol. 88, Issue 2 Weber M. (1986) El político y el científico. (trad) Francisco Rubio Llorente, Madrid, Alianza Editorial.