Journal articles on the topic 'Aptameri'
To see the other types of publications on this topic, follow the link: Aptameri.
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Aptameri.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Levy, Irit Carmi, Erez Lavi, Neta Zilony Hanin, Zohar Pode, Karin Mizrahi, Ronit Farhi, Anastasia Paz, et al. "788 A novel T- lymphocyte binding aptamer assembled into a bispecifc compound for the treatment of solid tumors." Journal for ImmunoTherapy of Cancer 9, Suppl 2 (November 2021): A823. http://dx.doi.org/10.1136/jitc-2021-sitc2021.788.
Full textAbstract:
BackgroundT-cell engagers are bispecific molecules directed against the CD3 complex on one end and a tumor specific antigen on the other end, allowing a physical link of T cell to a tumor cell, resulting in tumor killing and immune activation. Bispecific molecules harnessing and redirecting T-cells towards tumor cells are a promising therapeutic agents. Aptamers are single stranded oligonucleotides with binding and recognition propensities similar to those of antibodies. Aptamers have a number of advantages over bispecific antibodies including shorter generation time and low immunogenicity. Thus, aptamers capable of targeting T cells would have great potential for use as anti-cancer therapeuticsMethodsSystematic evolution of ligands by exponential enrichment (SELEX) methodology was employed in order to identify a novel CD3e binding aptamer. CD3 binding aptamer was subsequently linked into a bispecific T cell engager structure with a tumor-targeting aptameric arm. The tumor-targeting aptamer is developed by Aummune's proprietary tailored therapeutic platform.1 based on identifying functional aptamer sequences capable of specifically killing targeted tumor cells and sparing healthy tissue .Exemplary bispecific aptamers were tested for T cell stimulation by flow cytometry. In vivo antitumor activity was investigated in syngeneic and in xenograft tumor models.ResultsWe have successfully identified a novel CD3e –targeting aptamer with a Kd of 31nM. A bispecific T cell engager comprised of this aptamer and a tumor-targeting aptamer induced a potent stimulation of T cells in vitro, resulting in CD69 upregulation and IFNg secretion.Next, the CD3e targeting aptamer was hybridized to tumoricidal aptamers identified by Aummune's platform (VS12) to target either the human colon carcinoma HCT116 cells or (VS32) the murine triple negative breast cancer 4T1 cells. Both bispecific entities (CS6-VS12 and CS6-VS32) effectively lead to inhibition of tumor growth in vivo and increased survival in the corresponding models.ConclusionsOur data above provide a proof-of-concept for Aummune's Bispecific Aptamer efficacy and provide a framework for the clinical development of this novel tailored immune therapeutic agents. Indeed, we are currently in the process of developing a first-in-human clinical study in subjects with solid tumors.ReferenceMamet N, et al, Commun Biol 2020.
2
Norris, Vic, Sergey N. Krylov, Pratul K. Agarwal, and Glenn J. White. "Synthetic, Switchable Enzymes." Journal of Molecular Microbiology and Biotechnology 27, no. 2 (2017): 117–27. http://dx.doi.org/10.1159/000464443.
Full textAbstract:
The construction of switchable, radiation-controlled, aptameric enzymes - “<i>swenzymes” -</i> is, in principle, feasible. We propose a strategy to make such catalysts from 2 (or more) aptamers each selected to bind specifically to one of the substrates in, for example, a 2-substrate reaction. Construction of a combinatorial library of candidate swenzymes entails selecting a set of a million aptamers that bind one substrate and a second set of a million aptamers that bind the second substrate; the aptamers in these sets are then linked pairwise by a linker, thus bringing together the substrates. In the presence of the substrates, some linked aptamer pairs catalyze the reaction when exposed to external energy in the form of a specific frequency of low-intensity, nonionizing electromagnetic or acoustic radiation. Such swenzymes are detected via a separate<i> product-capturing</i> aptamer that changes conformation on capturing the product; this altered conformation allows it (1) to bind to every potential swenzyme in its vicinity (thereby giving a higher probability of capture to the swenzymes that generate the product) and (2) to bind to a sequence on a magnetic bead (thereby permitting purification of the swenzyme plus product-capturing aptamer by precipitation). Attempts to implement the swenzyme strategy may help elucidate fundamental problems in enzyme catalysis.
3
Hosseini, Seyed Mohammad Hasan, Mohammad Reza Bassami, Alireza Haghparast, Mojtaba Sankian, and Gholamreza Hashemi Tabar. "Identification of Aptamers that Specifically Bind to A1 Antigen by Performing Cell-on Human Erythrocytes." Galen Medical Journal 9 (June 27, 2020): 1657. http://dx.doi.org/10.31661/gmj.v9i0.1657.
Full textAbstract:
Background: The apply of aptamers as a new generation’s way to probe diagnostic for the detection of target molecules has gained ground. Aptamers can be used as alternatives to diagnostic antibodies for detection of blood groups due to their unique features. This study was aimed to produce DNA diagnostic aptamer detecting the antigen of A1 blood group using the Cell-Selex method. Materials and Methods: DNA aptamer was isolated against A1 RBC antigen after ten stages of Cell-Selex and amplification by an asymmetric polymerase chain reaction. The progress of the stages of selection was evaluated using flow cytometry analysis, which the DNA aptamer isolated from the tenth cycle with an affinity of 70% fluorescent intensity, was selected from four positive colonies followed by determination of the sequences and secondary structures. Results: The aptameric sequence obtained from C4 cloning was calculated with the highest binding affinity to A1 antigen having an apparent dissociation constant (Kd value) of at least 29.5 ± 4.3 Pmol, which was introduced as the selected aptamer-based on ΔG obtained from a colony of C4 equal to –13.13. Conclusion: The aptamer obtained from using Cell-Selex method could be used as an example for the development of diagnostic tools such as biosensors for detecting A1 blood group antigens. [GMJ.2020;9:e1657]
4
Lin, Jun Sheng, and Kenneth P. McNatty. "Aptamer-Based Regionally Protected PCR for Protein Detection." Clinical Chemistry 55, no. 9 (September 1, 2009): 1686–93. http://dx.doi.org/10.1373/clinchem.2009.127266.
Full textAbstract:
Abstract Background: DNA aptamers are single-stranded nucleotide sequences that bind specifically to target molecules. By combining the advantages of PCR for amplifying specific DNA sequences and aptamer technology, we have developed a new strategy to detect target molecules such as proteins. Methods: Ovine follicle-stimulating hormone α subunit (oFSHα) was used as the model protein to generate a specific DNA aptamer via an in vitro evolutionary process. A targeted regional-mapping approach and a target-capturing assay were used to identify the binding region on the aptamer molecule. In the detection assay, referred to as “aptamer-based regionally protected PCR” (ARP-PCR), the aptamer was allowed to bind to the target protein in solution before digestion with DNase I. The region of the aptamer bound to the target was protected from DNase I cleavage. The target-binding region of the aptamer protected from the enzymatic treatment was then amplified by the PCR. Results: Aptamers against oFSHα were generated. Six sequences of 20 selected aptamer clones were identical. This aptamer sequence was divided into 4 regions according to the aptamer’s secondary structure. From examination of the target-binding ability of each region, we determined the specific binding region, for which primers were designed. With the aptamer and primers to detect oFSHα by means of the ARP-PCR method, we were able to detect the target protein at concentrations as low as 10−14 mol/L. Conclusions: Combining the use of a DNA aptamer with the PCR is a potentially useful analytic tool for detection of proteins at low concentrations. .
5
Ponzo, Irene, Friederike M. Möller, Herwin Daub, and Nena Matscheko. "A DNA-Based Biosensor Assay for the Kinetic Characterization of Ion-Dependent Aptamer Folding and Protein Binding." Molecules 24, no. 16 (August 8, 2019): 2877. http://dx.doi.org/10.3390/molecules24162877.
Full textAbstract:
Therapeutic and diagnostic nucleic acid aptamers are designed to bind tightly and specifically to their target. The combination of structural and kinetic analyses of aptamer interactions has gained increasing importance. Here, we present a fluorescence-based switchSENSE aptasensor for the detailed kinetic characterization of aptamer–analyte interaction and aptamer folding, employing the thrombin-binding aptamer (TBA) as a model system. Thrombin-binding aptamer folding into a G-quadruplex and its binding to thrombin strongly depend on the type and concentration of ions present in solution. We observed conformational changes induced by cations in real-time and determined the folding and unfolding kinetics of the aptamer. The aptamer’s affinity for K+ was found to be more than one order of magnitude higher than for other cations (K+ > NH4+ >> Na+ > Li+). The aptamer’s affinity to its protein target thrombin in the presence of different cations followed the same trend but differed by more than three orders of magnitude (KD = 0.15 nM to 250 nM). While the stability (kOFF) of the thrombin–TBA complex was similar in all conditions, the cation type strongly influenced the association rate (kON). These results demonstrated that protein–aptamer binding is intrinsically related to the correct aptamer fold and, hence, to the presence of stabilizing ions. Because fast binding kinetics with on-rates exceeding 108 M−1s−1 can be quantified, and folding-related phenomena can be directly resolved, switchSENSE is a useful analytical tool for in-depth characterization of aptamer–ion and aptamer–protein interactions.
6
Schilling-Loeffler, Katja, Rachel Rodriguez, and Jacquelina Williams-Woods. "Target Affinity and Structural Analysis for a Selection of Norovirus Aptamers." International Journal of Molecular Sciences 22, no. 16 (August 18, 2021): 8868. http://dx.doi.org/10.3390/ijms22168868.
Full textAbstract:
Aptamers, single-stranded oligonucleotides that specifically bind a molecule with high affinity, are used as ligands in analytical and therapeutic applications. For the foodborne pathogen norovirus, multiple aptamers exist but have not been thoroughly characterized. Consequently, there is little research on aptamer-mediated assay development. This study characterized seven previously described norovirus aptamers for target affinity, structure, and potential use in extraction and detection assays. Norovirus-aptamer affinities were determined by filter retention assays using norovirus genotype (G) I.1, GI.7, GII.3, GII.4 New Orleans and GII.4 Sydney virus-like particles. Of the seven aptamers characterized, equilibrium dissociation constants for GI.7, GII.3, GII.4 New Orleans and GII.4 Sydney ranged from 71 ± 38 to 1777 ± 1021 nM. Four aptamers exhibited affinity to norovirus GII.4 strains; three aptamers additionally exhibited affinity toward GII.3 and GI.7. Aptamer affinity towards GI.1 was not observed. Aptamer structure analysis by circular dichroism (CD) spectroscopy showed that six aptamers exhibit B-DNA structure, and one aptamer displays parallel/antiparallel G-quadruplex hybrid structure. CD studies also showed that biotinylated aptamer structures were unchanged from non-biotinylated aptamers. Finally, norovirus aptamer assay feasibility was demonstrated in dot-blot and pull-down assays. This characterization of existing aptamers provides a knowledge base for future aptamer-based norovirus detection and extraction assay development and aptamer modification.
7
Samokhvalov, A. V., A. V. Zherdev, and B. B. Dzantiev. "Electrophoretic study of G-quadruplex aptamer interactions with different short single-strand complementary oligonucleotides." Journal of Physics: Conference Series 2212, no. 1 (February 1, 2022): 012001. http://dx.doi.org/10.1088/1742-6596/2212/1/012001.
Full textAbstract:
Abstract Aptamers are single-stranded nucleic acids, typically 20-80 nucleobases (nb) in length, which can bind different compounds with high affinity and selectively. Their ligand-binding properties can be attenuated by adding short complementary strands. These interactions open new opportunities for aptamer-based assays. Strong dependence between the length and electrophoretic mobility of short nucleic acids makes polyacrylamide gel electrophoresis a powerful tool for studying their complexes. The interactions between the 36 nb DNA G-quadruplex aptamer (5’-GAT-CGG-GTG-TGG-GTG-GCG-TAA-AGG-GAG-CAT-CGG-ACA-3’) specific to ochratoxin A and 9 complementary single-stranded DNA (ssDNA) were studied. The length of ssDNA varied from 5 to 9 nb. To maintain ligand-binding conformation of the aptamer, a high ionic strength buffer was used. The best resolution between the aptamer and its complex was provided for the gel with 15% monomer and a monomer/cross-linker ratio of 15:1. Bands of free aptamer and ssDNA were observed for all studied variants. If the ssDNA length was less than 9 nb, the position of the aptamer’s band remained unchanged, independent of the aptamer/ssDNA ratios, and additional bands did not appear. The longest ssDNA (5’-CGC-CAC-CCA-3’) did not lead to the appearance of a new band, but it slowed the aptamer’s migration depending on the ssDNA concentration. Under a 27-fold excess of the given ssDNA, the relative mobility of the aptamer band changed from 0.566 to 0.468. Thus, electrophoresis visualizes aptamer-ssDNA interactions and can be used in the development of aptamer-based analytical systems.
8
Amero, Paola, Soumen Khatua, Cristian Rodriguez-Aguayo, and Gabriel Lopez-Berestein. "Aptamers: Novel Therapeutics and Potential Role in Neuro-Oncology." Cancers 12, no. 10 (October 9, 2020): 2889. http://dx.doi.org/10.3390/cancers12102889.
Full textAbstract:
A relatively new paradigm in cancer therapeutics is the use of cancer cell–specific aptamers, both as therapeutic agents and for targeted delivery of anticancer drugs. After the first therapeutic aptamer was described nearly 25 years ago, and the subsequent first aptamer drug approved, many efforts have been made to translate preclinical research into clinical oncology settings. Studies of aptamer-based technology have unveiled the vast potential of aptamers in therapeutic and diagnostic applications. Among pediatric solid cancers, brain tumors are the leading cause of death. Although a few aptamer-related translational studies have been performed in adult glioblastoma, the use of aptamers in pediatric neuro-oncology remains unexplored. This review will discuss the biology of aptamers, including mechanisms of targeting cell surface proteins, various modifications of aptamer structure to enhance therapeutic efficacy, the current state and challenges of aptamer use in neuro-oncology, and the potential therapeutic role of aptamers in pediatric brain tumors.
9
Nakatsuka, Nako, Kyung-Ae Yang, John M. Abendroth, Kevin M. Cheung, Xiaobin Xu, Hongyan Yang, Chuanzhen Zhao, et al. "Aptamer–field-effect transistors overcome Debye length limitations for small-molecule sensing." Science 362, no. 6412 (September 6, 2018): 319–24. http://dx.doi.org/10.1126/science.aao6750.
Full textAbstract:
Detection of analytes by means of field-effect transistors bearing ligand-specific receptors is fundamentally limited by the shielding created by the electrical double layer (the “Debye length” limitation). We detected small molecules under physiological high–ionic strength conditions by modifying printed ultrathin metal-oxide field-effect transistor arrays with deoxyribonucleotide aptamers selected to bind their targets adaptively. Target-induced conformational changes of negatively charged aptamer phosphodiester backbones in close proximity to semiconductor channels gated conductance in physiological buffers, resulting in highly sensitive detection. Sensing of charged and electroneutral targets (serotonin, dopamine, glucose, and sphingosine-1-phosphate) was enabled by specifically isolated aptameric stem-loop receptors.
10
Wang, Zhong, Xiuying Yang, Nicholas Zhou Lee, and Xudong Cao. "Multivalent Aptamer Approach: Designs, Strategies, and Applications." Micromachines 13, no. 3 (March 12, 2022): 436. http://dx.doi.org/10.3390/mi13030436.
Full textAbstract:
Aptamers are short and single-stranded DNA or RNA molecules with highly programmable structures that give them the ability to interact specifically with a large variety of targets, including proteins, cells, and small molecules. Multivalent aptamers refer to molecular constructs that combine two or more identical or different types of aptamers. Multivalency increases the avidity of aptamers, a particularly advantageous feature that allows for significantly increased binding affinities in comparison with aptamer monomers. Another advantage of multivalency is increased aptamer stabilities that confer improved performances under physiological conditions for various applications in clinical settings. The current study aims to review the most recent developments in multivalent aptamer research. The review will first discuss structures of multivalent aptamers. This is followed by detailed discussions on design strategies of multivalent aptamer approaches. Finally, recent developments of the multivalent aptamer approach in biosensing and biomedical applications are highlighted.
11
Xia, Xuhan, Qiang He, Yi Dong, Ruijie Deng, and Jinghong Li. "Aptamer-based Homogeneous Analysis for Food Control." Current Analytical Chemistry 16, no. 1 (January 8, 2020): 4–13. http://dx.doi.org/10.2174/1573411014666180810125737.
Full textAbstract:
Background: Highly sensitive and rapid analysis of food contaminants is of great significance for food safety control. Aptamer is a new kind of recognition molecules which could be applied for constructing homogeneous analysis assays, potentially achieving highly sensitive, cheap and rapid profiling of food contaminants. Methods: An overview of the literature concerning the homogeneous analysis of food contaminations based on aptamers has been reviewed (focused on the most recent literature, 2000-2018). Results: Attributed to aptamer’s controllability, designability and feasibility for the adoption of nucleic acid amplification, rapid, highly sensitive homogeneous assay for various food contaminants could be constructed. The structure-switching aptamer probe would confer quick, efficient and specific response to target food contaminants. Besides, the capability of amplification of aptamer sequences or nucleic acid probes would lead to highly sensitive detection. Conclusion: Aptamer-based homogeneous analysis methods have already been applied to detect various food contaminations ranging from toxins, heavy metal and pesticide to allergen and pathogenic bacteria. However, it is still a challenge to achieve robust and accurate detection of food contaminants in complex food samples.
12
Ponce, Alex T., and Ka Lok Hong. "A Mini-Review: Clinical Development and Potential of Aptamers for Thrombotic Events Treatment and Monitoring." Biomedicines 7, no. 3 (July 26, 2019): 55. http://dx.doi.org/10.3390/biomedicines7030055.
Full textAbstract:
The unique opportunity for aptamer uses in thrombotic events has sparked a considerable amount of research in the area. The short half-lives of unmodified aptamers in vivo remain one of the major challenges in therapeutic aptamers. Much of the incremental successful therapeutic aptamer stories were due to modifications in the aptamer bases. This mini-review briefly summarizes the successes and challenges in the clinical development of aptamers for thrombotic events, and highlights some of the most recent developments in using aptamers for anticoagulation monitoring.
13
Adachi and Nakamura. "Aptamers: A Review of Their Chemical Properties and Modifications for Therapeutic Application." Molecules 24, no. 23 (November 21, 2019): 4229. http://dx.doi.org/10.3390/molecules24234229.
Full textAbstract:
Aptamers are short, single-stranded oligonucleotides that bind to specific target molecules. The shape-forming feature of single-stranded oligonucleotides provides high affinity and excellent specificity toward targets. Hence, aptamers can be used as analogs of antibodies. In December 2004, the US Food and Drug Administration approved the first aptamer-based therapeutic, pegaptanib (Macugen), targeting vascular endothelial growth factor, for the treatment of age-related macular degeneration. Since then, however, no aptamer medication for public health has appeared. During these relatively silent years, many trials and improvements of aptamer therapeutics have been performed, opening multiple novel directions for the therapeutic application of aptamers. This review summarizes the basic characteristics of aptamers and the chemical modifications available for aptamer therapeutics.
14
Almazar, Chembie A., Marjo V. Mendoza, and Windell L. Rivera. "In Silico Approaches for the Identification of Aptamer Binding Interactions to Leptospira spp. Cell Surface Proteins." Tropical Medicine and Infectious Disease 8, no. 2 (February 18, 2023): 125. http://dx.doi.org/10.3390/tropicalmed8020125.
Full textAbstract:
Aptamers are nucleic acids that can bind with high affinity and specificity to a range of target molecules. However, their functionality relies on their secondary and tertiary structures such that the combination of nucleotides determines their three-dimensional conformation. In this study, the binding mechanisms of candidate aptamers and their interactions with selected target proteins found in the cell surface of Leptospira were predicted to select high-affinity aptamers. Four aptamers were evaluated through molecular modeling and docking using available software and web-based tools, following the workflow previously designed for in silico evaluation of DNA aptamers. The most predominant and highly conserved surface-exposed proteins among pathogenic Leptospira species were used as aptamer targets. The highest number of interactions was seen in aptamers AP5 and AP1. Hydrogen bonds, along with a few hydrophobic interactions, occur in most aptamer–protein complexes. Further analysis revealed serine, threonine, glutamine, and lysine as main protein residues. H-bond interactions occur mostly with polar amino acids, as reflected in the predicted interaction profiles of aptamer–protein complexes. In silico strategies allowed the identification of key residues crucial in aptamer–target interaction during aptamer screening. Such information can be used in aptamer modification for improved binding affinity and accuracy for diagnostics application.
15
Kimoto, Michiko, Yun Wei Shermane Lim, and Ichiro Hirao. "Molecular affinity rulers: systematic evaluation of DNA aptamers for their applicabilities in ELISA." Nucleic Acids Research 47, no. 16 (August 8, 2019): 8362–74. http://dx.doi.org/10.1093/nar/gkz688.
Full textAbstract:
Abstract Many nucleic acid aptamers that bind to target molecules have been reported as antibody alternatives. However, while the affinities of aptamers vary widely, little is known about the relationship between the affinities and their applicabilities for practical use. Here, we developed molecular affinity rulers: a series of DNA aptamers with different affinities that bind to the same area of target molecules, to measure the aptamer and its device applicabilities. For the ruler preparation, we used high-affinity DNA aptamers containing a hydrophobic unnatural base (Ds) as the fifth base. By replacing Ds bases with A bases in Ds-DNA aptamers targeting VEGF165 and interferon-γ, we prepared two sets of DNA aptamers with dissociation constants (KD) ranging from 10−12 to 10−8 M. Using these molecular affinity rulers, we evaluated the sensitivity of DNA aptamers in ELISA (enzyme-linked immunosorbent assay), which showed the clear relationship between aptamer affinities and their detection sensitivities. In sandwich-type ELISA using combinations of aptamers and antibodies, aptamers with KD values lower than ∼10−9 M were required for sufficient sensitivities (limit of detection (LOD) < 10 pM) and signal intensities, but optimizations improved the lower-affinity aptamers’ applicabilities. These aptamer affinity rulers could be useful for evaluating and improving aptamer applicabilities.
16
Tsukakoshi, Kaori, Yasuko Yamagishi, Mana Kanazashi, Kenta Nakama, Daiki Oshikawa, Nasa Savory, Akimasa Matsugami, et al. "G-quadruplex-forming aptamer enhances the peroxidase activity of myoglobin against luminol." Nucleic Acids Research 49, no. 11 (June 7, 2021): 6069–81. http://dx.doi.org/10.1093/nar/gkab388.
Full textAbstract:
Abstract Aptamers can control the biological functions of enzymes, thereby facilitating the development of novel biosensors. While aptamers that inhibit catalytic reactions of enzymes were found and used as signal transducers to sense target molecules in biosensors, no aptamers that amplify enzymatic activity have been identified. In this study, we report G-quadruplex (G4)-forming DNA aptamers that upregulate the peroxidase activity in myoglobin specifically for luminol. Using in vitro selection, one G4-forming aptamer that enhanced chemiluminescence from luminol by myoglobin's peroxidase activity was discovered. Through our strategy—in silico maturation, which is a genetic algorithm-aided sequence manipulation method, the enhancing activity of the aptamer was improved by introducing mutations to the aptamer sequences. The best aptamer conserved the parallel G4 property with over 300-times higher luminol chemiluminescence from peroxidase activity more than myoglobin alone at an optimal pH of 5.0. Furthermore, using hemin and hemin-binding aptamers, we demonstrated that the binding property of the G4 aptamers to heme in myoglobin might be necessary to exert the enhancing effect. Structure determination for one of the aptamers revealed a parallel-type G4 structure with propeller-like loops, which might be useful for a rational design of aptasensors utilizing the G4 aptamer-myoglobin pair.
17
Komarova, Natalia, Olga Panova, Alexey Titov, and Alexander Kuznetsov. "Aptamers Targeting Cardiac Biomarkers as an Analytical Tool for the Diagnostics of Cardiovascular Diseases: A Review." Biomedicines 10, no. 5 (May 6, 2022): 1085. http://dx.doi.org/10.3390/biomedicines10051085.
Full textAbstract:
The detection of cardiac biomarkers is used for diagnostics, prognostics, and the risk assessment of cardiovascular diseases. The analysis of cardiac biomarkers is routinely performed with high-sensitivity immunological assays. Aptamers offer an attractive alternative to antibodies for analytical applications but, to date, are not widely practically implemented in diagnostics and medicinal research. This review summarizes the information on the most common cardiac biomarkers and the current state of aptamer research regarding these biomarkers. Aptamers as an analytical tool are well established for troponin I, troponin T, myoglobin, and C-reactive protein. For the rest of the considered cardiac biomarkers, the isolation of novel aptamers or more detailed characterization of the known aptamers are required. More attention should be addressed to the development of dual-aptamer sandwich detection assays and to the studies of aptamer sensing in alternative biological fluids. The universalization of aptamer-based biomarker detection platforms and the integration of aptamer-based sensing to clinical studies are demanded for the practical implementation of aptamers to routine diagnostics. Nevertheless, the wide usage of aptamers for the diagnostics of cardiovascular diseases is promising for the future, with respect to both point-of-care and laboratory testing.
18
Ruff, Patrick, Rekha B. Pai, and Francesca Storici. "Real-Time PCR-Coupled CE-SELEX for DNA Aptamer Selection." ISRN Molecular Biology 2012 (August 8, 2012): 1–9. http://dx.doi.org/10.5402/2012/939083.
Full textAbstract:
Aptamers are short nucleic acid or peptide sequences capable of binding to a target molecule with high specificity and affinity. Also known as “artificial antibodies,” aptamers provide many advantages over antibodies. One of the major hurdles to aptamer isolation is the initial time and effort needed for selection. The systematic evolution of ligands by exponential enrichment (SELEX) is the traditional procedure for generating aptamers, but this process is lengthy and requires a large quantity of target and starting aptamer library. A relatively new procedure for generating aptamers using capillary electrophoresis (CE), known as CE-SELEX, is faster and more efficient than SELEX but requires laser-induced fluorescence (LIF) to detect the aptamer-target complexes. Here, we implemented an alternative system without LIF using real-time- (RT-) PCR to indirectly measure aptamer-target complexes. In three rounds of selection, as opposed to ten or more rounds common in SELEX protocols, a specific aptamer for bovine serum albumin (BSA) was obtained. The specificity of the aptamer to BSA was confirmed by electrophoretic mobility shift assays (EMSAs), an unlabeled competitor assay, and by a supershift assay. The system used here provides a cost effective and a highly efficient means of generating aptamers.
19
Liao, Yongkang, Shijun Xiong, Zaid Ur Rehman, Xiaoli He, Hongling Peng, Jing Liu, and Shuming Sun. "The Research Advances of Aptamers in Hematologic Malignancies." Cancers 15, no. 1 (January 1, 2023): 300. http://dx.doi.org/10.3390/cancers15010300.
Full textAbstract:
Currently, research for hematological malignancies is very intensive, with many breakthroughs. Among them, aptamer-based targeted therapies could be counted. Aptamer is a targeting tool with many unique advantages (easy synthesis, low toxicity, easy modification, low immunogenicity, nano size, long stability, etc.), therefore many experts screened corresponding aptamers in various hematological malignancies for diagnosis and treatment. In this review, we try to summarize and provide the recent progress of aptamer research in the diagnosis and treatment of hematologic malignancies. Until now, 29 aptamer studies were reported in hematologic malignancies, of which 12 aptamers were tested in vivo and the remaining 17 aptamers were only tested in vitro. In this case, 11 aptamers were combined with chemotherapeutic drugs for the treatment of hematologic malignancies, 4 aptamers were used in combination with nanomaterials for the diagnosis and treatment of hematologic malignancies, and some studies used aptamers for the targeted transportation of siRNA and miRNA for targeted therapeutic effects. Their research provides multiple approaches to achieve more targeted goals. These findings show promising and encouraging future for both hematological malignancies basic and clinical trials research.
20
Buglak, Andrey A., Alexey V. Samokhvalov, Anatoly V. Zherdev, and Boris B. Dzantiev. "Methods and Applications of In Silico Aptamer Design and Modeling." International Journal of Molecular Sciences 21, no. 22 (November 10, 2020): 8420. http://dx.doi.org/10.3390/ijms21228420.
Full textAbstract:
Aptamers are nucleic acid analogues of antibodies with high affinity to different targets, such as cells, viruses, proteins, inorganic materials, and coenzymes. Empirical approaches allow the design of in vitro aptamers that bind particularly to a target molecule with high affinity and selectivity. Theoretical methods allow significant expansion of the possibilities of aptamer design. In this study, we review theoretical and joint theoretical-experimental studies dedicated to aptamer design and modeling. We consider aptamers with different targets, such as proteins, antibiotics, organophosphates, nucleobases, amino acids, and drugs. During nucleic acid modeling and in silico design, a full set of in silico methods can be applied, such as docking, molecular dynamics (MD), and statistical analysis. The typical modeling workflow starts with structure prediction. Then, docking of target and aptamer is performed. Next, MD simulations are performed, which allows for an evaluation of the stability of aptamer/ligand complexes and determination of the binding energies with higher accuracy. Then, aptamer/ligand interactions are analyzed, and mutations of studied aptamers made. Subsequently, the whole procedure of molecular modeling can be reiterated. Thus, the interactions between aptamers and their ligands are complex and difficult to understand using only experimental approaches. Docking and MD are irreplaceable when aptamers are studied in silico.
21
Vázquez-González, Margarita, and Itamar Willner. "Aptamer-Functionalized Hybrid Nanostructures for Sensing, Drug Delivery, Catalysis and Mechanical Applications." International Journal of Molecular Sciences 22, no. 4 (February 11, 2021): 1803. http://dx.doi.org/10.3390/ijms22041803.
Full textAbstract:
Sequence-specific nucleic acids exhibiting selective recognition properties towards low-molecular-weight substrates and macromolecules (aptamers) find growing interest as functional biopolymers for analysis, medical applications such as imaging, drug delivery and even therapeutic agents, nanotechnology, material science and more. The present perspective article introduces a glossary of examples for diverse applications of aptamers mainly originated from our laboratory. These include the introduction of aptamer-functionalized nanomaterials such as graphene oxide, Ag nanoclusters and semiconductor quantum dots as functional hybrid nanomaterials for optical sensing of target analytes. The use of aptamer-functionalized DNA tetrahedra nanostructures for multiplex analysis and aptamer-loaded metal-organic framework nanoparticles acting as sense-and-treat are introduced. Aptamer-functionalized nano and microcarriers are presented as stimuli-responsive hybrid drug carriers for controlled and targeted drug release, including aptamer-functionalized SiO2 nanoparticles, carbon dots, metal-organic frameworks and microcapsules. A further application of aptamers involves the conjugation of aptamers to catalytic units as a means to mimic enzyme functions “nucleoapzymes”. In addition, the formation and dissociation of aptamer-ligand complexes are applied to develop mechanical molecular devices and to switch nanostructures such as origami scaffolds. Finally, the article discusses future challenges in applying aptamers in material science, nanotechnology and catalysis.
22
Yang, Darong, Xianghe Meng, Qinqin Yu, Li Xu, Ying Long, Bin Liu, Xiaohong Fang, and Haizhen Zhu. "Inhibition of Hepatitis C Virus Infection by DNA Aptamer against Envelope Protein." Antimicrobial Agents and Chemotherapy 57, no. 10 (July 22, 2013): 4937–44. http://dx.doi.org/10.1128/aac.00897-13.
Full textAbstract:
ABSTRACTHepatitis C virus (HCV) envelope protein (E1E2) is essential for virus binding to host cells. Aptamers have been demonstrated to have strong promising applications in drug development. In the current study, a cDNA fragment encoding the entire E1E2 gene of HCV was cloned. E1E2 protein was expressed and purified. Aptamers for E1E2 were selected by the method of selective evolution of ligands by exponential enrichment (SELEX), and the antiviral actions of the aptamers were examined. The mechanism of their antiviral activity was investigated. The data show that selected aptamers for E1E2 specifically recognize the recombinant E1E2 protein and E1E2 protein from HCV-infected cells. CD81 protein blocks the binding of aptamer E1E2-6 to E1E2 protein. Aptamers against E1E2 inhibit HCV infection in an infectious cell culture system although they have no effect on HCV replication in a replicon cell line. Beta interferon (IFN-β) and IFN-stimulated genes (ISGs) are not induced in virus-infected hepatocytes with aptamer treatment, suggesting that E1E2-specific aptamers do not induce innate immunity. E2 protein is essential for the inhibition of HCV infection by aptamer E1E2-6, and the aptamer binding sites are located in E2. Q412R within E1E2 is the major resistance substitution identified. The data indicate that an aptamer against E1E2 exerts its antiviral effects through inhibition of virus binding to host cells. Aptamers against E1E2 can be used with envelope protein to understand the mechanisms of HCV entry and fusion. The aptamers may hold promise for development as therapeutic drugs for hepatitis C patients.
23
Ashrafuzzaman, Md, Hanouf A. M. AlMansour, Maha A. S. AlOtaibi, Zahid Khan, and Gouse M. Shaik. "Lipid Specific Membrane Interaction of Aptamers and Cytotoxicity." Membranes 12, no. 1 (December 27, 2021): 37. http://dx.doi.org/10.3390/membranes12010037.
Full textAbstract:
We aim to discover diagnostic tools to detect phosphatidylserine (PS) externalization on apoptotic cell surface using PS binding aptamers, AAAGAC and TAAAGA, and hence to understand chemotherapy drug efficacy when inducing apoptosis into cancer cells. The entropic fragment-based approach designed aptamers have been investigated to inspect three aspects: lipid specificity in aptamers’ membrane binding and bilayer physical properties-induced regulation of binding mechanisms, the apoptosis-induced cancer cell surface binding of aptamers, and the aptamer-induced cytotoxicity. The liposome binding assays show preferred membrane binding of aptamers due to presence of PS in predominantly phosphatidylcholine-contained liposomes. Two membrane stiffness reducing amphiphiles triton X-100 and capsaicin were found to enhance membrane’s aptamer adsorption suggesting that bilayer physical properties influence membrane’s adsorption of drugs. Microscopic images of fluorescence-tagged aptamer treated LoVo cells show strong fluorescence intensity only if apoptosis is induced. Aptamers find enhanced PS molecules to bind with on the surface of apoptotic over nonapoptotic cells. In cytotoxicity experiments, TAAAGA (over poor PS binding aptamer CAGAAAAAAAC) was found cytotoxic towards RBL cells due to perhaps binding with nonapoptotic externalized PS randomly and thus slowly breaching plasma membrane integrity. In these three experimental investigations, we found aptamers to act on membranes at comparable concentrations and specifically with PS binding manner. Earlier, we reported the origins of actions through molecular mechanism studies—aptamers interact with lipids using mainly charge-based interactions. Lipids and aptamers hold distinguishable charge properties, and hence, lipid–aptamer association follows distinguishable energetics due to electrostatic and van der Waals interactions. We discover that our PS binding aptamers, due to lipid-specific interactions, appear as diagnostic tools capable of detecting drug-induced apoptosis in cancer cells.
24
Byun, Jonghoe. "Recent Progress and Opportunities for Nucleic Acid Aptamers." Life 11, no. 3 (February 28, 2021): 193. http://dx.doi.org/10.3390/life11030193.
Full textAbstract:
Coined three decades ago, the term aptamer and directed evolution have now reached their maturity. The concept that nucleic acid could modulate the activity of target protein as ligand emerged from basic science studies of viruses. Aptamers are short nucleic acid sequences capable of specific, high-affinity molecular binding, which allow for therapeutic and diagnostic applications. Compared to traditional antibodies, aptamers have several advantages, including small size, flexible structure, good biocompatibility, and low immunogenicity. In vitro selection method is used to isolate aptamers that are specific for a desired target from a randomized oligonucleotide library. The first aptamer drug, Macugen, was approved by FDA in 2004, which was accompanied by many studies and clinical investigations on various targets and diseases. Despite much promise, most aptamers have failed to meet the requisite safety and efficacy standards in human clinical trials. Amid these setbacks, the emergence of novel technologies and recent advances in aptamer and systematic evolution of ligands by exponential enrichment (SELEX) design are fueling hope in this field. The unique properties of aptamer are gaining renewed interest in an era of COVID-19. The binding performance of an aptamer and reproducibility are still the key issues in tackling current hurdles in clinical translation. A thorough analysis of the aptamer binding under varying conditions and the conformational dynamics is warranted. Here, the challenges and opportunities of aptamers are reviewed with recent progress.
25
Hassanzadeh, Leila, Suxiang Chen, and Rakesh Veedu. "Radiolabeling of Nucleic Acid Aptamers for Highly Sensitive Disease-Specific Molecular Imaging." Pharmaceuticals 11, no. 4 (October 15, 2018): 106. http://dx.doi.org/10.3390/ph11040106.
Full textAbstract:
Aptamers are short single-stranded DNA or RNA oligonucleotide ligand molecules with a unique three-dimensional shape, capable of binding to a defined molecular target with high affinity and specificity. Since their discovery, aptamers have been developed for various applications, including molecular imaging, particularly nuclear imaging that holds the highest potential for the clinical translation of aptamer-based molecular imaging probes. Their easy laboratory production without any batch-to-batch variations, their high stability, their small size with no immunogenicity and toxicity, and their flexibility to incorporate various functionalities without compromising the target binding affinity and specificity make aptamers an attractive class of targeted-imaging agents. Aptamer technology has been utilized in nuclear medicine imaging techniques, such as single photon emission computed tomography (SPECT) and positron emission tomography (PET), as highly sensitive and accurate biomedical imaging modalities towards clinical diagnostic applications. However, for aptamer-targeted PET and SPECT imaging, conjugation of appropriate radionuclides to aptamers is crucial. This review summarizes various strategies to link the radionuclides to chemically modified aptamers to accomplish aptamer-targeted PET and SPECT imaging.
26
Ray, Partha, and Rebekah R. White. "Cell-SELEX Identifies a “Sticky” RNA Aptamer Sequence." Journal of Nucleic Acids 2017 (2017): 1–9. http://dx.doi.org/10.1155/2017/4943072.
Full textAbstract:
Cell-SELEX is performed to select for cell binding aptamers. We employed an additional selection pressure by using RNAse to remove surface-binding aptamers and select for cell-internalizing aptamers. A common RNA sequence was identified from independent cell-SELEX procedures against two different pancreatic cancer cell lines, indicating a strong selection pressure towards this sequence from the large pool of other available sequences present in the aptamer library. The aptamer is not specific for the pancreatic cancer cell lines, and a similar sequence motif is present in previously published internalizing aptamers. The identified sequence forms a structural motif that binds to a surface protein, which either is highly abundant or has strong affinity for the selected aptamer sequence. Deselecting (removing) this sequence during cell-SELEX may increase the probability of identifying aptamers against cell type-specific targets on the cell surface.
27
Zeninskaya, N. A., A. V. Kolesnikov, A. K. Ryabko, I. G. Shemyakin, I. A. Dyatlov, and A. V. Kozyr. "Aptamers in the Treatment of Bacterial Infections: Problems and Prospects." Annals of the Russian academy of medical sciences 71, no. 5 (October 5, 2016): 350–58. http://dx.doi.org/10.15690/vramn591.
Full textAbstract:
Aptamers are short single-stranded oligonucleotides which are selected via targeted chemical evolution in vitro to bind a molecular target of interest. The aptamer selection technology is designated as SELEX (Systematic evolution of ligands by exponential enrichment). SELEX enables isolation of oligonucleotide aptamers binding a wide range of targets of interest with little respect for their nature and molecular weight. A number of applications of aptamer selection were developed ranging from biosensor technologies to antitumor drug discovery. First aptamer-based pharmaceutical (Macugen) was approved by FDA for clinical use in 2004, and since then more than ten aptamer-based drugs undergo various phases of clinical trials. From the medicinal chemist’s point of view, aptamers represent a new class of molecules suitable for the development of new therapeutics. Due to the stability, relative synthesis simplicity, and development of advanced strategies of target specific molecular selection, aptamers attract increased attention of drug discovery community. Difficulties of the development of next-generation antibiotics basing on the conventional basis of combinatorial chemistry and high-throughput screening have also amplified the interest to aptamer-based therapeutic candidates. The present article reviews the investigations focused on the development of antibacterial aptamers and discusses the potential and current limitations of the use of this type of therapeutic molecules.
28
Asadzadeh, Homayoun, Ali Moosavi, Georgios Alexandrakis, and Mohammad R. K. Mofrad. "Atomic Scale Interactions between RNA and DNA Aptamers with the TNF-α Protein." BioMed Research International 2021 (July 16, 2021): 1–11. http://dx.doi.org/10.1155/2021/9926128.
Full textAbstract:
Interest in the design and manufacture of RNA and DNA aptamers as apta-biosensors for the early diagnosis of blood infections and other inflammatory conditions has increased considerably in recent years. The practical utility of these aptamers depends on the detailed knowledge about the putative interactions with their target proteins. Therefore, understanding the aptamer-protein interactions at the atomic scale can offer significant insights into the optimal apta-biosensor design. In this study, we consider one RNA and one DNA aptamer that were previously used as apta-biosensors for detecting the infection biomarker protein TNF-α, as an example of a novel computational workflow for selecting the aptamer candidate with the highest binding strength to a target. We combine information from the binding free energy calculations, molecular docking, and molecular dynamics simulations to investigate the interactions of both aptamers with TNF-α. The results reveal that the RNA aptamer has a more stable structure relative to the DNA aptamer. Interaction of aptamers with TNF-α does not have any negative effect on its structure. The results of molecular docking and molecular dynamics simulations suggest that the RNA aptamer has a stronger interaction with the protein. Also, these findings illustrate that basic residues of TNF-α establish more atomic contacts with the aptamers compared to acidic or pH-neutral ones. Furthermore, binding energy calculations show that the interaction of the RNA aptamer with TNF-α is thermodynamically more favorable. In total, the findings of this study indicate that the RNA aptamer is a more suitable candidate for using as an apta-biosensor of TNF-α and, therefore, of greater potential use for the diagnosis of blood infections. Also, this study provides more information about aptamer-protein interactions and increases our understanding of this phenomenon.
29
Radi, Abd-Elgawad. "Electrochemical Aptamer-Based Biosensors: Recent Advances and Perspectives." International Journal of Electrochemistry 2011 (2011): 1–17. http://dx.doi.org/10.4061/2011/863196.
Full textAbstract:
This paper reviews the advancements of a wide range of electrochemical aptamer-based biosensors, electrochemical aptasensors, for target analytes monitoring. Methods for immobilizing aptamers onto an electrode surface are discussed. Aptasensors are presented according to their detection strategies. Many of these are simply electrochemical, aptamer-based equivalents of traditional immunochemical approaches, sandwich and competition assays employing electroactive signaling moieties. Others, exploiting the unusual physical properties of aptamers, are signal-on (positive readout signal) and signal-off (negative readout signal) aptasensors based on target binding-induced conformational change of aptamers. Aptamer label-free devices are also discussed.
30
Nishimura, Jun-ichi, Shahid M. Nimjee, Haixiang Jiang, Thad A. Howard, George A. Pitoc, Christopher P. Rusconi, Mitsuhiro Omine, et al. "Blocking Complement-Mediated Hemolysis Using RNA Aptamers That Bind Complement Component C8." Blood 106, no. 11 (November 16, 2005): 186. http://dx.doi.org/10.1182/blood.v106.11.186.186.
Full textAbstract:
Abstract A recent pilot study in patients with paroxysmal nocturnal hemoglobinuria (PNH), using a humanized monoclonal antibody that binds human complement C5 and inhibits terminal complement protein activation, suggests that blocking complement is a potentially effective therapeutic option for PNH. However, since C5 is critical for proper regulation of inflammatory responses as well as complement activation, terminal complement proteins with more restricted function may represent better targets. The pore-forming C5-9 complex includes several protein targets, but persons with C9 deficiency have measurable evidence of in vitro complement activation, indicating that the C5b-8 complex can cause lysis in the absence of C9. Blocking complement at C9 may not, therefore, completely prevent complement-mediated hemolysis and adequately protect PNH erythrocytes. Accordingly, we used in vitro selection methodology to identify high affinity nuclease-resistant RNA aptamers that bind specifically to human complement C8. Aptamers bound C8 with a Kd of 1.4nM and 54.1% after round 7. C8 aptamers identified after rounds 4 to 7 of selection were cloned and sequenced, and aptamer clones were screened for in vitro binding and complement-inhibitory activity. Aptamers were first incubated with purified C8 at a concentration sufficient to induce 50–70% hemolysis, then antibody-sensitized erythrocytes and C8-depleted serum were added. One C8 aptamer clone (4–101) had strong inhibitory hemolytic activity with 91.9% inhibition at 250nM, compared to only 12.3% inhibition observed with random aptamers at 250nM. Aptamer clone 4–101 bound C8 with a Kd of 15nM and a Bmax of 74.2%. Inhibition of hemolysis by C8 aptamer clone 4–101 was enhanced by adding a previously published C5 aptamer clone f8/c11, (TCTCATGCGCCGAGTGTGAGTTTACCTTCGT, Immunopharmacology42:219, 1999) in a modified human serum hemolytic assay using total human serum: 54.4% inhibition was observed using C8 aptamer 4–101 at 500nM, versus 83.0% inhibition using C8 aptamer 4–101 with C5 aptamer f8/c11 in combination at 500nM. Thus, C8 aptamer clones can efficiently inhibit complement-mediated lysis, with enhanced activity in combination with a known C5 aptamer. These data indicate that combinatorial blocking aptamers that bind terminal human complement proteins can efficiently inhibit the complement pathway, and therefore represent a novel potential therapeutic option for patients with PNH. Based on these in vitro data, therapeutic C8 aptamers should be considered for the in vivo treatment of PNH patients with massive hemolysis. C5 inhibitors could still be useful, however, as an adjunct therapy if C8 aptamers insufficiently inhibit complement-mediated lysis.
31
Chen, Zihao, Long Hu, Bao-Ting Zhang, Aiping Lu, Yaofeng Wang, Yuanyuan Yu, and Ge Zhang. "Artificial Intelligence in Aptamer–Target Binding Prediction." International Journal of Molecular Sciences 22, no. 7 (March 30, 2021): 3605. http://dx.doi.org/10.3390/ijms22073605.
Full textAbstract:
Aptamers are short single-stranded DNA, RNA, or synthetic Xeno nucleic acids (XNA) molecules that can interact with corresponding targets with high affinity. Owing to their unique features, including low cost of production, easy chemical modification, high thermal stability, reproducibility, as well as low levels of immunogenicity and toxicity, aptamers can be used as an alternative to antibodies in diagnostics and therapeutics. Systematic evolution of ligands by exponential enrichment (SELEX), an experimental approach for aptamer screening, allows the selection and identification of in vitro aptamers with high affinity and specificity. However, the SELEX process is time consuming and characterization of the representative aptamer candidates from SELEX is rather laborious. Artificial intelligence (AI) could help to rapidly identify the potential aptamer candidates from a vast number of sequences. This review discusses the advancements of AI pipelines/methods, including structure-based and machine/deep learning-based methods, for predicting the binding ability of aptamers to targets. Structure-based methods are the most used in computer-aided drug design. For this part, we review the secondary and tertiary structure prediction methods for aptamers, molecular docking, as well as molecular dynamic simulation methods for aptamer–target binding. We also performed analysis to compare the accuracy of different secondary and tertiary structure prediction methods for aptamers. On the other hand, advanced machine-/deep-learning models have witnessed successes in predicting the binding abilities between targets and ligands in drug discovery and thus potentially offer a robust and accurate approach to predict the binding between aptamers and targets. The research utilizing machine-/deep-learning techniques for prediction of aptamer–target binding is limited currently. Therefore, perspectives for models, algorithms, and implementation strategies of machine/deep learning-based methods are discussed. This review could facilitate the development and application of high-throughput and less laborious in silico methods in aptamer selection and characterization.
32
Poturnayová, Alexandra, Maja Šnejdárková, and Tibor Hianik. "DNA aptamer configuration affects the sensitivity and binding kinetics of thrombin." Acta Chimica Slovaca 5, no. 1 (April 1, 2012): 53–58. http://dx.doi.org/10.2478/v10188-012-0009-z.
Full textAbstract:
DNA aptamer configuration affects the sensitivity and binding kinetics of thrombinThrombin is serine protease involved in the coagulation cascade, which converts soluble fibrinogen into insoluble strands of fibrin - a matrix of the blood clot formation. Development of the sensitive method of the thrombin detection in nanomolar level is important for clinical practice. In this work we applied acoustic thickness shear mode method (TSM) for study the binding of human thrombin depending on DNA aptamer configuration. We compared sensitivity of detection and binding kinetics of the thrombin to the conventional DNA aptamers and aptamer dimers immobilized at the surface of quartz crystal transducer. We have shown that aptasensors based on aptamer dimers more sensitively detect thrombin. The aptamer-thrombin complexes were also more stable as revealed from equilibrium dissociation constant,KD, that was 4 times lower for aptamer dimers in comparison with conventional aptamers. Determination of motional resistance,Rm, from acoustic impedance analysis allowed us to find important differences in physico-chemical properties of layers formed by conventional aptamers and aptamer dimers.
33
Kumar Kulabhusan, Prabir, Babar Hussain, and Meral Yüce. "Current Perspectives on Aptamers as Diagnostic Tools and Therapeutic Agents." Pharmaceutics 12, no. 7 (July 9, 2020): 646. http://dx.doi.org/10.3390/pharmaceutics12070646.
Full textAbstract:
Aptamers are synthetic single-stranded DNA or RNA sequences selected from combinatorial oligonucleotide libraries through the well-known in vitro selection and iteration process, SELEX. The last three decades have witnessed a sudden boom in aptamer research, owing to their unique characteristics, like high specificity and binding affinity, low immunogenicity and toxicity, and ease in synthesis with negligible batch-to-batch variation. Aptamers can specifically bind to the targets ranging from small molecules to complex structures, making them suitable for a myriad of diagnostic and therapeutic applications. In analytical scenarios, aptamers are used as molecular probes instead of antibodies. They have the potential in the detection of biomarkers, microorganisms, viral agents, environmental pollutants, or pathogens. For therapeutic purposes, aptamers can be further engineered with chemical stabilization and modification techniques, thus expanding their serum half-life and shelf life. A vast number of antagonistic aptamers or aptamer-based conjugates have been discovered so far through the in vitro selection procedure. However, the aptamers face several challenges for its successful clinical translation, and only particular aptamers have reached the marketplace so far. Aptamer research is still in a growing stage, and a deeper understanding of nucleic acid chemistry, target interaction, tissue distribution, and pharmacokinetics is required. In this review, we discussed aptamers in the current diagnostics and theranostics applications, while addressing the challenges associated with them. The report also sheds light on the implementation of aptamer conjugates for diagnostic purposes and, finally, the therapeutic aptamers under clinical investigation, challenges therein, and their future directions.
34
Shanaa, Ousama Al, Andrei M. Rumyantsev, Elena V. Sambuk, and Marina V. Padkina. "The synthesis of Broccoli RNA fluorescent aptamer in <i>Saccharomyces cerevisiae</i> yeast cells." Ecological genetics 20, no. 4 (December 24, 2022): 339–48. http://dx.doi.org/10.17816/ecogen111012.
Full textAbstract:
BACKGROUND: RNA aptamers are short, single-stranded oligonucleotides, with remarkable binding ability to target molecules characterized by high specificity and affinity. Such targets are vastly diverse and range from specific ions to entire cells. RNA aptamers are widely used in biology and medicine for basic research, as well as for practical purposes as in therapy and diagnostics. At present, chemical or in vitro methods of synthesis are mainly used to obtain RNA aptamers. However, such methods are expensive and time-consuming with low productivity. Therefore, in vivo methods are becoming more attractive to researchers working on optimizing high-scale production of RNA aptamers.
AIM: The aim of this work is to develop a reporter system for optimizing the synthesis of small RNA molecules in Saccharomyces cerevisiae yeast cells.
MATERIALS AND METHODS: We used the Broccoli fluorescent RNA aptamer to develop a reporter system allowing us to optimize the conditions for in vivo short RNA synthesis in yeast cells. This aptamer is about 112 bp in size and binds to the fluorogenic dye DFHBI-1T. Only upon binding, the aptamer-dye complex exhibits fluorescence properties. After excitation using light with a wavelength of 482 nm, the aptamer-dye complex emission is observed with a peak at 505 nm.
RESULTS: We have designed a reporter system providing the synthesis of the fluorescent Broccoli RNA aptamer in S. cerevisiae yeast cells. Transcription of RNA molecules containing the aptamer is carried out by the regulated promoter of the GAL1 gene. The synthesized transcripts contain the HH and HDV ribozymes to ensure precise cleavage of the RNA aptamer sequences.
CONCLUSIONS: This reporter system is based on the Broccoli RNA aptamer, and it can be used to optimize the in vivo synthesis of RNA aptamers in S. cerevisiae yeast cells. This work serves an urgent task in connection with the active use of such aptamers in scientific research, biotechnology and medicine.
35
Ji, Danyang, Kaixin Lyu, Haizhou Zhao, and Chun Kit Kwok. "Circular L-RNA aptamer promotes target recognition and controls gene activity." Nucleic Acids Research 49, no. 13 (July 7, 2021): 7280–91. http://dx.doi.org/10.1093/nar/gkab593.
Full textAbstract:
Abstract Rational design of aptamers to incorporate unnatural nucleotides and special chemical moieties can expand their functional complexity and diversity. Spiegelmer (L-RNA aptamer) is a unique class of aptamer that is composed of unnatural L-RNA nucleotides, and so far there are limited L-RNA aptamer candidates and applications being reported. Moreover, the target binding properties of current L-RNA aptamers require significant improvement. Here, using L-Apt.4-1c as an example, we develop a simple and robust strategy to generate the first circular L-RNA aptamer, cycL-Apt.4-1c, quantitatively, demonstrate substantial enhancement in binding affinity and selectivity toward its target, and notably report novel applications of circular L-RNA aptamer in controlling RNA–protein interaction, and gene activity including telomerase activity and gene expression. Our approach and findings will be applicable to any L-RNA aptamers and open up a new avenue for diverse applications.
36
Veeramani, Suresh, Sue E. Blackwell, William H. Thiel, Paloma H. Giangrande, and George J. Weiner. "Novel IL-2Ralpha (CD25)-Binding RNA Aptamer to Target T Regulatory Cells." Blood 128, no. 22 (December 2, 2016): 3697. http://dx.doi.org/10.1182/blood.v128.22.3697.3697.
Full textAbstract:
Abstract Background: RNA aptamers are short RNA molecules that bind to antigens and ligands in a manner analogous to antibodies. RNA aptamers are being evaluated as clinical therapeutic agents based on their advantages and flexibility as cell targeting agents. Here, we report development and evaluation of a novel human IL-2Ralpha (CD25)-binding RNA aptamer that can be used to target T regulatory (Treg) cells. Methods: A. RNA aptamers: A whole cell SELEX strategy was designed to enrich for RNA aptamers that specifically bind to CD4+CD25high Tregs cells, but not to lineage-related CD4+CD25-T effector (Teff) cells. Selection began with a library of random RNA aptamers (SEL2-N20) with an expected structural diversity of ~1012. The aptamer pool was pre-cleared of aptamers that bound to common T cell antigens using Teff cells before aptamers were positively selected that bound to Tregs from the same donor. This process was repeated for eight successive enrichment rounds, each round using T cells from different donor. Enriched aptamers were sequenced and the top enriched aptamer (Tr-1) was characterized for its antigen specificity. B. Target antigen identification: The specificity of Tr-1 aptamer and its structural mutants was evaluated by testing its binding to recombinant CD25 by RT-qPCR. C. Targeting Tregs with chimeric Tr-1: Chimeric Treg-targeting reagents were created by linking Tr-1 aptamers with cytotoxic Saporin (Tr-1-Sap) or with Treg-inhibiting Foxp3 silencing RNA (Tr-1-Foxp3 siRNA). Unfractionated CD4+ T cells or Tregs were treated with Tr-1-Sap or Tr-1-Foxp3 siRNA. Reduction in Treg percentage (for Tr-1-Sap treatment) or Foxp3 mRNA levels (for Tr-1-siRNA treatment) was determined by flow cytometry or RT-qPCR, respectively. Results: A. Treg-binding RNA aptamers: A large panel of Treg-binding RNA aptamers was identified using whole cell SELEX and were synthesized. Most of the selected aptamers, particularly Tr-1, bound to CD25high Treg cells to a greater degree than to CD25low Teff cells (Figure 1). B. Target antigen identification: Tr-1 bound to human CD25 (IL-2Ralpha) protein while a control aptamer (C-248) did not. Structural mutants of Tr-1 that had lost Treg binding ability showed significantly reduced binding to CD25 protein (Figure 2). C. Treg targeting with chimeric Tr-1: Treg-targeting agents created with Tr-1 aptamers successfully delivered toxic Saporin and Foxp3 siRNA into Tregs. a. CD4+ T cells treated with Tr-1-Sap had a decrease in the percentage of CD25+ Treg population as determined by flow cytometry. b. Enriched human Tregs treated with Tr-1-Foxp3 siRNA chimera showed reduction in their Foxp3 mRNA levels. Conclusion and significance: RNA aptamers that target human Tregs were identified. The most predominant Treg-binding aptamer, Tr-1, binds to human IL-2Ralpha/CD25, a clinically-targeted molecule expressed by Tregs. Chimeric reagents based on Tr-1 aptamer effectively targeted Tregs signifying their potential use as novel immunomodulators. Ongoing studies are further exploring the significance of Tr-1 aptamer as a diagnostic agent and as a therapeutic modulator of Treg activity. Disclosures No relevant conflicts of interest to declare.
37
Padlan, Camille, Vladimir Malashkevich, Steve Almo, Matthew Levy, Michael Brenowitz, and Mark Girvin. "A Novel Monovalent Cation-Stabilized Fold Mediates an Aptamer-Protein Complex." Acta Crystallographica Section A Foundations and Advances 70, a1 (August 5, 2014): C1164. http://dx.doi.org/10.1107/s2053273314088354.
Full textAbstract:
RNA aptamers are structured single-stranded oligonucleotides selected to bind tightly and specifically to a broad spectrum of biomolecular targets. The structural stability and diverse functionality of aptamers have enabled their use as diagnostic tools, inhibitors and potential therapeutic agents. However, since very few attempts at solving atomic structures of protein-aptamer complexes have succeeded, surprisingly little is known about how aptamers specifically bind to selected regions on the surface of proteins and cells. We show that aptamers can be effectively minimized for structural analysis using chemical mapping to experimentally define the secondary structure and identify tertiary contacts within the RNA and with the target protein. Ribonuclease and SHAPE mapping were used to determine the correct predicted secondary structure of a high affinity aptamer (Lys1) selected against lysozyme (KD ~ 30 nM). A deletion variant, minE (KD ~ 20 nM), was engineered to delete a long, apparently unstructured region. The lysozyme-minE complex was determined by x-ray crystallography at a 2.0 Å resolution, yielding a seventh RNA aptamer-protein structure. Solution hydroxyl-radical footprinting confirms the binding interface observed in the crystal. Although the minE aptamer interacts with a positively charged face of lysozyme, the electrostatic contribution to the binding free energy is minimal. The minE aptamer was found to inhibit the function of lysozyme in the standard cell-wall hydrolysis assay – a surprising result since the aptamer binding site is quite far from the catalytic site, and no structural differences between free lysozyme and that in complex with the aptamer could be detected. The long term goal of this study is to develop a systematic approach to aptamer minimization and use solved structures to probe the mechanisms by which RNA aptamers bind their targets and regulate catalytic activity and/or cellular function.
38
Sepehri Zarandi, Hamideh, Mandana Behbahani, and Hassan Mohabatkar. "In Silico Selection of Gp120 ssDNA Aptamer to HIV-1." SLAS DISCOVERY: Advancing the Science of Drug Discovery 25, no. 9 (May 26, 2020): 1087–93. http://dx.doi.org/10.1177/2472555220923331.
Full textAbstract:
Nucleic acid aptamers that specifically bind to other molecules are mostly obtained through the systematic evolution of ligands by exponential enrichment (SELEX). Because SELEX is a time-consuming procedure, the in silico design of specific aptamers has recently become a progressive approach. HIV-1 surface glycoprotein gp120, which is involved in the early stages of HIV-1 infection, is an attractive target for RNA and DNA aptamer selection. In this study, four single-stranded DNA aptamers, referred to as HD2, HD3, HD4, and HD5, that had the ability of HIV-1 inhibition were designed in silico. In a proposed non-SELEX approach, some parts of the B40 aptamer sequence, which interacted with gp120, were isolated and considered as a separate aptamer sequence. Then, to obtain the best docking scores of the HDOCK server and Hex software, some modifications, insertions, and deletions were applied to each selected sequence. Finally, the cytotoxicity and HIV inhibition of the selected aptamers were evaluated experimentally. Results demonstrated that the selected aptamers could inhibit HIV-1 infection by up to 80%, without any cytotoxicity. Therefore, this new non-SELEX approach could be considered a simple, fast, and efficient method for aptamer selection.
39
Trunzo, Nevina E., and Ka Lok Hong. "Recent Progress in the Identification of Aptamers Against Bacterial Origins and Their Diagnostic Applications." International Journal of Molecular Sciences 21, no. 14 (July 18, 2020): 5074. http://dx.doi.org/10.3390/ijms21145074.
Full textAbstract:
Aptamers have gained an increasing role as the molecular recognition element (MRE) in diagnostic assay development, since their first conception thirty years ago. The process to screen for nucleic acid-based binding elements (aptamers) was first described in 1990 by the Gold Laboratory. In the last three decades, many aptamers have been identified for a wide array of targets. In particular, the number of reports on investigating single-stranded DNA (ssDNA) aptamer applications in biosensing and diagnostic platforms have increased significantly in recent years. This review article summarizes the recent (2015 to 2020) progress of ssDNA aptamer research on bacteria, proteins, and lipids of bacterial origins that have implications for human infections. The basic process of aptamer selection, the principles of aptamer-based biosensors, and future perspectives will also be discussed.
40
Alkhamis, Obtin, Weijuan Yang, Rifat Farhana, Haixiang Yu, and Yi Xiao. "Label-free profiling of DNA aptamer-small molecule binding using T5 exonuclease." Nucleic Acids Research 48, no. 20 (October 14, 2020): e120-e120. http://dx.doi.org/10.1093/nar/gkaa849.
Full textAbstract:
Abstract In vitro aptamer isolation methods can yield hundreds of potential candidates, but selecting the optimal aptamer for a given application is challenging and laborious. Existing aptamer characterization methods either entail low-throughput analysis with sophisticated instrumentation, or offer the potential for higher throughput at the cost of providing a relatively increased risk of false-positive or -negative results. Here, we describe a novel method for accurately and sensitively evaluating the binding between DNA aptamers and small-molecule ligands in a high-throughput format without any aptamer engineering or labeling requirements. This approach is based on our new finding that ligand binding inhibits aptamer digestion by T5 exonuclease, where the extent of this inhibition correlates closely with the strength of aptamer-ligand binding. Our assay enables accurate and efficient screening of the ligand-binding profiles of individual aptamers, as well as the identification of the best target binders from a batch of aptamer candidates, independent of the ligands in question or the aptamer sequence and structure. We demonstrate the general applicability of this assay with a total of 106 aptamer-ligand pairs and validate these results with a gold-standard method. We expect that our assay can be readily expanded to characterize small-molecule-binding aptamers in an automated, high-throughput fashion.
41
Yang, Weijuan, Haixiang Yu, Obtin Alkhamis, Yingzhu Liu, Juan Canoura, Fengfu Fu, and Yi Xiao. "In vitro isolation of class-specific oligonucleotide-based small-molecule receptors." Nucleic Acids Research 47, no. 12 (March 30, 2019): e71-e71. http://dx.doi.org/10.1093/nar/gkz224.
Full textAbstract:
Abstract Class-specific bioreceptors are highly desirable for recognizing structurally similar small molecules, but the generation of such affinity elements has proven challenging. We here develop a novel ‘parallel-and-serial’ selection strategy for isolating class-specific oligonucleotide-based receptors (aptamers) in vitro. This strategy first entails parallel selection to selectively enrich cross-reactive binding sequences, followed by serial selection that enriches aptamers binding to a designated target family. As a demonstration, we isolate a class-specific DNA aptamer against a family of designer drugs known as synthetic cathinones. The aptamer binds to 12 diverse synthetic cathinones with nanomolar affinity and does not respond to 11 structurally similar non-target compounds, some of which differ from the cathinone targets by a single atom. This is the first account of an aptamer exhibiting a combination of broad target cross-reactivity, high affinity and remarkable specificity. Leveraging the qualities of this aptamer, instantaneous colorimetric detection of synthetic cathinones at nanomolar concentrations in biological samples is achieved. Our findings significantly expand the binding capabilities of aptamers as class-specific bioreceptors and further demonstrate the power of rationally designed selection strategies for isolating customized aptamers with desired binding profiles. We believe that our aptamer isolation approach can be broadly applied to isolate class-specific aptamers for various small molecule families.
42
Gan, Zixuen, Muhamad Aidilfitri Mohamad Roslan, Mohd Yunus Abd Shukor, Murni Halim, Nur Adeela Yasid, Jaafar Abdullah, Ina Salwany Md Yasin, and Helmi Wasoh. "Advances in Aptamer-Based Biosensors and Cell-Internalizing SELEX Technology for Diagnostic and Therapeutic Application." Biosensors 12, no. 11 (October 25, 2022): 922. http://dx.doi.org/10.3390/bios12110922.
Full textAbstract:
Aptamers are a group of synthetic single-stranded nucleic acids. They are generated from a random library of single-stranded DNA or RNA by a technology named systematic evolution of ligands by exponential enrichment (SELEX). SELEX is a repetitive process to select and identify suitable aptamers that show high affinity and specificity towards target cells. Great strides have been achieved in the design, construction, and use of aptamers up to this point. However, only a small number of aptamer-based applications have achieved widespread commercial and clinical acceptance. Additionally, finding more effective ways to acquire aptamers with high affinity remains a challenge. Therefore, it is crucial to thoroughly examine the existing dearth and advancement in aptamer-related technologies. This review focuses on aptamers that are generated by SELEX to detect pathogenic microorganisms and mammalian cells, as well as in cell-internalizing SELEX for diagnostic and therapeutic purposes. The development of novel aptamer-based biosensors using optical and electrical methods for microbial detection is reported. The applications and limitations of aptamers are also discussed.
43
Wei, Zongyi, Yuxin Zhou, Rongjie Wang, Jin Wang, and Zhenhua Chen. "Aptamers as Smart Ligands for Targeted Drug Delivery in Cancer Therapy." Pharmaceutics 14, no. 12 (November 22, 2022): 2561. http://dx.doi.org/10.3390/pharmaceutics14122561.
Full textAbstract:
Undesirable side effects and multidrug tolerance are the main holdbacks to the treatment of cancer in conventional chemotherapy. Fortunately, targeted drug delivery can improve the enrichment of drugs at the target site and reduce toxicity to normal tissues and cells. A targeted drug delivery system is usually composed of a nanocarrier and a targeting component. The targeting component is called a “ligand”. Aptamers have high target affinity and specificity, which are identified as attractive and promising ligands. Therefore, aptamers have potential application in the development of smart targeting systems. For instance, aptamers are able to efficiently recognize tumor markers such as nucleolin, mucin, and epidermal growth factor receptor (EGFR). Besides, aptamers can also identify glycoproteins on the surface of tumor cells. Thus, the aptamer-mediated targeted drug delivery system has received extensive attention in the application of cancer therapy. This article reviews the application of aptamers as smart ligands for targeted drug delivery in cancer therapy. Special interest is focused on aptamers as smart ligands, aptamer-conjugated nanocarriers, aptamer targeting strategy for tumor microenvironment (TME), and aptamers that are specified to crucial cancer biomarkers for targeted drug delivery.
44
Zhdanov, Gleb, Alexander Arutyunyuan, Alexey Kopylov, and Elena Zavyalova. "Energy Dissipation Hypothesis Applied to Enhance the Affinity of Thrombin Binding Aptamer." Biophysica 1, no. 2 (May 14, 2021): 179–93. http://dx.doi.org/10.3390/biophysica1020014.
Full textAbstract:
Nucleic acid aptamers are artificial recognizing molecules that are capable of specific binding to a wide variety of targets. Aptamers are commonly selected from a huge library of oligonucleotides and improved by introducing several mutations or modular constructions. Although aptamers hold great promise as therapeutic and diagnostic tools, no simple approach to improve their affinity has been suggested yet. Our recent analysis of aptamer–protein complexes revealed that aptamer affinity correlates with the size of an amino acid sidechain in the protein interface that was explained by efficient dissipation of the energy released during complex formation. G-quadruplex-based thrombin aptamers are not involved in the described dependence. Moreover, aptamers to the same thrombin site have 100-fold differences in affinity. Here we focused on a detailed analysis of the nucleic acid interface of thrombin–aptamer complexes. High affinity of the aptamers was shown to correlate with the solvent accessibility of the apolar part of recognizing loops. To prove the concept experimentally, these loops were modified to enhance contact with the solvent. Dissociation rates of the aptamer–thrombin complexes were drastically slowed due to these modifications. In full correspondence with the energy dissipation hypothesis, the modifications improved both the stability of the G-quadruplexes and affinity to thrombin. The most evident effect was shown for unstable Na+-coordinated G-quadruplexes. These data are of high interest for a directed improvement of aptamers introducing unnatural modifications into the ‘hot spot’ residues.
45
Pang, Xuehui, Cheng Cui, Shuo Wan, Ying Jiang, Liangliang Zhang, Lian Xia, Long Li, Xiaowei Li, and Weihong Tan. "Bioapplications of Cell-SELEX-Generated Aptamers in Cancer Diagnostics, Therapeutics, Theranostics and Biomarker Discovery: A Comprehensive Review." Cancers 10, no. 2 (February 9, 2018): 47. http://dx.doi.org/10.3390/cancers10020047.
Full textAbstract:
Currently, functional single-stranded oligonucleotide probes, termed aptamers, generated by an iterative technology, Systematic Evolution of Ligands by Exponential Enrichment (SELEX), are utilized to selectively target molecules or cells with high affinity. Aptamers hold considerable promise as multifunctional molecules or conjugates for challenging nanotechnologies or bioapplications now and in the future. In this review, we first describe recent endeavors to select aptamers towards live cancer cells via cell-SELEX. We then introduce several characteristic applications of selected aptamers, especially in imaging, drug delivery and therapy. In part, these advances have been made possible via synthesis of aptamer-based nanomaterials, which, by their sizes, shapes, and physicochemical properties, allow such aptamer-nanomaterial complexes to function as signal reporters or drug carriers. We also describe how these aptamer-based molecular tools contribute to cancer biomarker discovery through high-affinity recognition of membrane protein receptors.
46
Kovalenko, A. A., V. V. Sharoyko, and I. A. Kazartsev*. "Prospects for the application of aptamers in plant protection and crop production." PLANT PROTECTION NEWS 105, no. 1 (April 25, 2022): 6–27. http://dx.doi.org/10.31993/2308-6459-2022-105-1-15186.
Full textAbstract:
In modern agriculture, there is a demand for alternative approaches to increase yields, to upgrade methods for detecting chemical contaminants, and to improve quality of phytosanitary diagnostics and the effectiveness of plant protection. One promising approach to addressing these issues is aptamer technology. Aptamers are oligonucleotide and peptide molecules capable of molecular recognition of both small inorganic and organic compounds, as well as proteins. Development of aptamers specific to the target molecule is performed in vitro using SELEX technology. Aptamer binding to the target follows principles common to antigen-antibody interaction. Due to this property, aptamers have found applications as targeted biological agents, «smart» materials, and new generation bioanalytical sensors. This review contains a brief analysis of the successes and prospects of applying aptamer technology in analytical monitoring and phytosanitary control. In particular, approaches and examples of aptamer-based test systems and sensors for detection of various compounds in natural objects, and related commercial products are discussed. Examples of aptamers application in development of “smart” fertilizers, innovative pesticides, and for engineering of plants resistant to viral diseases are also given.
47
Gholikhani, Tooba, Shalen Kumar, Hadi Valizadeh, Somayeh Mahdinloo, Khosro Adibkia, Parvin Zakeri-Milani, Mohammad Barzegar-Jalali, and Balam Jimenez. "Advances in Aptamers-Based Applications in Breast Cancer: Drug Delivery, Therapeutics, and Diagnostics." International Journal of Molecular Sciences 23, no. 22 (November 21, 2022): 14475. http://dx.doi.org/10.3390/ijms232214475.
Full textAbstract:
Aptamers are synthetic single-stranded oligonucleotides (such as RNA and DNA) evolved in vitro using Systematic Evolution of Ligands through Exponential enrichment (SELEX) techniques. Aptamers are evolved to have high affinity and specificity to targets; hence, they have a great potential for use in therapeutics as delivery agents and/or in treatment strategies. Aptamers can be chemically synthesized and modified in a cost-effective manner and are easy to hybridize to a variety of nano-particles and other agents which has paved a way for targeted therapy and diagnostics applications such as in breast tumors. In this review, we systematically explain different aptamer adoption approaches to therapeutic or diagnostic uses when addressing breast tumors. We summarize the current therapeutic techniques to address breast tumors including aptamer-base approaches. We discuss the next aptamer-based therapeutic and diagnostic approaches targeting breast tumors. Finally, we provide a perspective on the future of aptamer-based sensors for breast therapeutics and diagnostics. In this section, the therapeutic applications of aptamers will be discussed for the targeting therapy of breast cancer.
48
Mallikaratchy, Prabodhika, Alessandro Ruggiero, William Maguire, Kelly Piersanti, Jeffrey Gardner, Carlos Villa, Freddy Escorcia, et al. "Multivalent DNA Aptamer-Based Therapeutic Agents for Lymphoma and Leukemia." Blood 114, no. 22 (November 20, 2009): 2711. http://dx.doi.org/10.1182/blood.v114.22.2711.2711.
Full textAbstract:
Abstract Abstract 2711 Poster Board II-687 Non-Hodgkins lymphomas affect 450,000 patients in the United States and even with recent advances in antibody-based therapies; more than 20,000 people will die of their disease annually. The goal of this work was to develop a high affinity, stable aptamer selective for B-cell leukemias and lymphomas. Aptamers are small DNA molecules that have the ability to bind to proteins with high affinity and specificity. They are also ideal candidates as therapeutic carriers. Aptamer binding is based on the ability of small oligonucleotide polymers (typically 20–80mers) to fold into unique three-dimensional structures that can interact with a specific target. Based on nature of this interaction, aptamers could be considered to be antibody analogs. Compared to antibodies however, one of the inherent properties of aptamers is that their small size (typically 10–20,000 daltons for aptamers vs 150,000 daltons for antibodies,) might address some difficult pharmacologic issues of antibodies, which penetrate slowly into tumors and clear the blood slowly. Recently, the TDO5 aptamer was identified and it was found to bind to membrane bound human IgM, a component of the BCR complex in B-Cell neoplasms. In contrast to currently available monoclonal antibodies, TD05 binds to membrane bound human IgM only and not with soluble IgM, eliminating the possibility of competitive inhibition by soluble IgM in the serum. The specificity of the aptamer was confirmed by screening with 24 cell lines and fresh clinical leukemia samples. Out of 24 cell lines, the IgM-negative cells, including T-cell leukemias and solid tumor lines such as breast, kidney, and colon and ovarian, showed no binding with TD05 indicating there is no non-specific adhesion with cell lines. One of the challenges of using the current form of TD05 as a drug carrier is that it is not yet suitable for use in vivo because of low avidity (>10uM) and stability (t ½= 1min) at physiological conditions. In order to increase the affinity of this aptamer, a new truncated multivalent and nuclease stable aptamer was designed. First, truncation of the original version of TD05 was considered because reduced size may lead to more efficient chemical syntheses and better pharmacologic properties. The resulting TD05.1 has a 5-fold increased affinity compared to original version of TD05. Second, bivalent (BV) aptamers utilizing TD05.1 with various polyethylene glycol (PEG) linker lengths were designed. Linker length is critical in designing multivalent aptamers to avoid loss of binding due to steric hindrance and to optimize the binding geometry, both of which would affect binding affinity. An optimal linker length of ∼16nm was chosen after empiric binding studies. Nuclease stability was also addressed by the introduction of chemical functionalities into TD05.1. The introduction of non-natural bases such as LNA bases (Locked Nucleic Acids), have been demonstrated to be effective in this regard. The stability of LNA stems from the bicyclic furanose unit locked in a sugar conformation. In order to retain the specific recognition and 3-dimensional nature of the aptamer's folding, LNA analogues were only introduced at the regions that are not involved in binding. Additionally, to further improve nuclease resistance, increase circulation time in vivo and to prevent non-specific adhesion to serum proteins and cells, the LNA modified BV aptamer TD05.1 was modified with polyethylene glycol at the 3' and 5' ends. The introduction of LNA and polyethylene glycol further stabilized the secondary structure, increasing the affinity and nuclease resistance in serum from one minute to seven hours(t ½> 420 min). We then constructed a trivalent analog of the aptamer with multiple functionalities, including chelators and fluorophores, which showed ∼25-fold higher affinity compared to monomeric aptamer at physiological conditions. In conclusion, this study demonstrates the development of a trivalent, high affinity aptamer selective for the membrane bound human IgM found in B-cell leukemias and lymphoma. Studies to assess the biological activity and the use of this construct as a drug carrier to treat B-NHL and B-CLL are in progress. Disclosures: No relevant conflicts of interest to declare.
49
Lin, Yu-Chao, Wen-Yih Chen, En-Te Hwu, and Wen-Pin Hu. "In-Silico Selection of Aptamer Targeting SARS-CoV-2 Spike Protein." International Journal of Molecular Sciences 23, no. 10 (May 22, 2022): 5810. http://dx.doi.org/10.3390/ijms23105810.
Full textAbstract:
Aptamers are single-stranded, short DNA or RNA oligonucleotides that can specifically bind to various target molecules. To diagnose the infected cases of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) in time, numerous conventional methods are applied for viral detection via the amplification and quantification of DNA or antibodies specific to antigens on the virus. Herein, we generated a large number of mutated aptamer sequences, derived from a known sequence of receptor-binding domain (RBD)-1C aptamer, specific to the RBD of SARS-CoV-2 spike protein (S protein). Structural similarity, molecular docking, and molecular dynamics (MD) were utilized to screen aptamers and characterize the detailed interactions between the selected aptamers and the S protein. We identified two mutated aptamers, namely, RBD-1CM1 and RBD-1CM2, which presented better docking results against the S protein compared with the RBD-1C aptamer. Through the MD simulation, we further confirmed that the RBD-1CM1 aptamer can form the most stable complex with the S protein based on the number of hydrogen bonds formed between the two biomolecules. Based on the experimental data of quartz crystal microbalance (QCM), the RBD-1CM1 aptamer could produce larger signals in mass change and exhibit an improved binding affinity to the S protein. Therefore, the RBD-1CM1 aptamer, which was selected from 1431 mutants, was the best potential candidate for the detection of SARS-CoV-2. The RBD-1CM1 aptamer can be an alternative biological element for the development of SARS-CoV-2 diagnostic testing.
50
Challa, Sreerupa, Saul Tzipori, and Abhineet Sheoran. "Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins." Journal of Nucleic Acids 2014 (2014): 1–8. http://dx.doi.org/10.1155/2014/214929.
Full textAbstract:
Infection with Shiga toxin- (Stx-) producingE. colicauses life threatening hemolytic uremic syndrome (HUS), a leading cause of acute renal failure in children. Of the two antigenically distinct toxins, Stx1 and Stx2, Stx2 is more firmly linked with the development of HUS. In the present study, selective evolution of ligands by exponential enrichment (SELEX) was used in an attempt to identify RNA aptamers against Stx1 and Stx2. After 5 rounds of selection, significant enrichment of aptamer pool was obtained against Stx2, but not against Stx1, using a RNA aptamer library containing 56 random nucleotides (N56). Characterization of individual aptamer sequences revealed that six unique RNA aptamers (mA/pC, mB/pA, mC, mD, pB, and pD) recognized Stx2 in a filter binding assay. None of these aptamers bound Stx1. Aptamers mA/pC, mB/pA, mC, and mD, but not pB and pD, partially blocked binding of Alexa 488-labeled Stx2 with HeLa cells in a flow cytometry assay. However, none of the aptamers neutralized Stx2-mediated cytotoxicity and death of HeLa cells.