Journal articles on the topic 'Agricultural surveys Victoria'

Levels of paspalum leaf blight (Ascochyta paspali) severity (%LAD), diseased dry matter (%DDM) and incidence on tillers and leaves on dairy pastures in northern Victoria assessed during the summer months (November-March) of 1983-84, 1984-85, 1985-86 and 1986-87 fluctuated between samplings and farms. Infected tissues accounted for 19-22% of the total dry matter in 1983-84 and 1984-85. Disease severity (%LAD) was significantly (P<0.001) linearly related to incidence of infected tillers (IT) or leaves (IL) and highest correlations were obtained following natural logarithmic transformations of severity and incidence data. Incidence of infected tillers on a 1 ha site in Northern Victoria ranged over 7- 19% in 1985-86 when samples were taken along a M-transect and 1.75-30% in 1986-87 when stratified random samples were taken using a microcomputer-based program 'Field Runner'. The latter reduced sampling bias, indicated that the distribution of disease was aggregated and a minimum sample size of 450 tillers was required. The fluctuating incidence levels with time were correlated with sampling intervals following grazing. Incidence of infected tillers on 11 farms in northern Victoria and Finley, N.S.W., in January 1987, ranged from 11.8 to 56.4%. The significance of the severity-incidence relationships, the aggregated distribution of paspalum leaf blight, variation in levels between farms, the effects of grazing on epidemics of paspalum leaf blight and crop loss and the use of 'Field Runner' in disease surveys is discussed.

Many of the world’s agricultural areas have greatly reduced levels of natural vegetation. This results in highly fragmented mosaic landscapes with multiple land-use types. We examined the importance of vegetation and landscape pattern by comparing the bird assemblages of riparian zones, non-riparian forest patches, and pasture in a fragmented agricultural landscape in south-eastern Australia. Bird surveys were conducted every four weeks at 27 sites in the Goldfields region of central Victoria for one year. The landscape context (position and shape of patches) and vegetation attributes were measured for each site. We found that bird assemblages strongly differed among these landscape elements. Mean abundance was significantly greater at forested patches, and there was a three-fold reduction in species richness at pasture sites. Bird assemblage structure was influenced substantially more by vegetation than by the landscape context of sites. Our results indicate that riparian vegetation is a key element for avian diversity, even in massively altered landscapes. The restoration of riparian vegetation and its connectivity with adjacent forest types would greatly benefit bird assemblages in agricultural areas.

Archaeological surveys conducted in Sabina, about 50 km away from Rome, intended to reconstruct the ancient agricultural and pastoral landscape. They identified interesting remains of roman small family farms at Montenero Sabino and Mompeo (province of Rieti), villages located near Via Salaria (the “salt way”) and the Farfa stream, a tributary of the Tiber River, which in ancient times, both were the main trade routes of central Italy, linking Rome to the Apennines and to the Adriatic coast. There a network of underground channels and tanks, fictile water pipes and pools, at times connected to one another, was found. Many of them are still used today, given the low population growth and the lack of modern industrial development of this area and to its isolation, in spite of its proximity to Rome. Moreover the study area holds a votive stone dedicated to the Sabine-Roman goddess of water Vacuna, a multiform Sabine and Central-Italic goddess with many characteristics and functions, known also as Minerva-Bellona-Victoria, Feronia, Caerere, or as Angerona-Angitia. It was related to an agricultural-pastoral shrine for the cult of water whose anthropological relevance still survives in yearly livestock fairs and in the local worship of the Holy Mary of parturients.

Surveys for juvenile Mythimna convecta throughout the agricultural and arid regions of eastern Australia were conducted from 1986 to 1989. Armyworm populations north of 33 degrees S were generally dominated by M. convecta, and further south by Persectania ewingii. M. convecta was most widely distributed in spring. Incidence during autumn and winter ranged from very low in Victoria to high in northern New South Wales and southern Queensland. Summer infestations were found mostly on the south-east coast where favourable habitats were abundant. Colonised habitats included extremely arid regions, where small numbers of larvae were associated with grasses in temporary watercourses, and the higher-rainfall, eastern regions. The largest infestations occurred in south-east Queensland and north central and north-east New South Wales, particularly after heavy autumn rains. There appeared to be two generations of M. convecta over the autumn/winter period: the first a synchronised event starting on the autumn rains and the second commencing in June/July and comprising a wide spread in age distribution. The progeny of the winter generation are probably the source of most economic outbreaks. Mythimna convecta larvae were collected from subtropical and temperate grasses. In the former, most larvae were found in tussocks, particularly of Dichanthium sericeum and Chloris truncata, which provided a dense, fine-leaf crown and canopy. After good autumn rainfall and vegetative growth, the wiry-stemmed tussocks, including Astrebla spp. and C. ciliaris, were also common hosts. The temperate grasses, particularly Avena fatua and Hordeum leporinum, were the main winter hosts although the greatest densities were found only in thick swards of growth, particularly those that contained dried grass. Two of the largest surveys, in autumn 1987 and 1988, followed periods of heavy rain and provided strongly contrasting results. The 1987 survey of central and south-west Queensland located no M. convecta larvae, indicating that densities were below detection thresholds. The paucity of larvae was attributed to lack of suitable atmospheric conditions to assist moth immigrations and absence of adequate populations in potential source areas. The 1988 survey revealed a major outbreak of M. convecta larvae in south-east Queensland and northern New South Wales. The area received record rains during early April of that year, and the outbreak probably arose from moth migrations from the east and south-east coast. An outbreak of similar scale occurred after further heavy autumn rains in 1989.

One of the possible consequences of biological invasions is the decrease of native species abundances or their replacement by non-native species. In Andean Patagonia, southern Argentina and Chile, many non-native animals have been introduced and are currently spreading. On Isla Victoria, Nahuel Huapi National Park, many non-native vertebrates were introduced ca. 1937. Records indicate that several native vertebrates were present before these species were introduced. We hypothesize that seven decades after the introduction of non-native species and without appropriate management to maintain native diversity, non-native vertebrates have displaced native species (given the known invasiveness and impacts of some of the introduced species). We conducted direct censuses in linear transects 500 m long (n= 10) in parallel with camera-trapping (1,253 camera-days) surveys in two regions of the island with different levels of disturbance: high (n= 4) and low (n= 6) to study the community of terrestrial mammals and birds and the relative abundances of native and non-native species. Results show that currently non-native species are dominant across all environments; 60.4% of census records and 99.7% of camera trapping records are of non-native animals. We detected no native large mammals; the assemblage of large vertebrates consisted of five non-native mammals and one non-native bird. Native species detected were one small mammal and one small bird. Species with the highest trapping rate were red and fallow deer, wild boar, silver pheasant (all four species are non-native) and chucao (a native bird). These results suggest that native species are being displaced by non-natives and are currently in very low numbers.

Tetranychus gloveri Banks was first recorded as Tetranychus okinawanus Ehara in India on an ornamental plant, Adenium obesum from Thrissur district, Kerala state, during 2016 (Zeity et al. 2016). Recently, Sharkey et al. (2022) synonymized T. okinawanus with T. gloveri based on morphological and molecular data. In Kerala, T. gloveri has emerged as a predominant species of mite infesting major agricultural and horticultural crops in the district (Arunima et al. 2018). In order to investigate the distribution and host range of the mite species in Kerala, periodical surveys were conducted in different agricultural ecosystems across the state during March 2020 to June 2022. Spider mite infested samples were collected from fruit crops, vegetables, ornamental plants, medicinal plants and other non-crop plants from different localities, kept in polythene bags. The GPS data of the locality and host plants were recorded. In the laboratory, a single gravid female from each sample was used to establish isoline culture providing unique accession number. Male and female specimens from each isoline culture were slide mounted on Hoyer’s medium and morphological characterization of the slide mounted mite specimens were carried to establish the species identity. Characters such as chaetotaxy of hysterosoma and legs, structure of empodium and pattern of dorsal striae between e1 and f1 of female were used for genus level identification, while the shape of male genitalia, aedeagus, was used for species level identification. In this study, T. gloveri was recorded from a wide host range of 35 host plants in 24 plant families viz., Malvaceae, Cucurbitaceae, Fabaceae, Amaranthaceae, Rutaceae, Solanaceae, Musaceae, Moraceae, Anacardiaceae, Caricaceae, Adoxaceae, Rosaceae, Compositae, Gentianaceae, Convolvulaceae, Balsaminaceae, Orchidaceae, Asparagaceae, Goodeniaceae, Apocyanaceae, Euphorbiaceae, Oxalidaceae, Lamiaceae and Pontederiaceae. The mite species was distributed in seven districts covering northern, central and southern regions viz., Wayanad, Malappuram, Thrissur, Palakkad, Ernakulam, Alappuzha and Thiruvananthapuram districts of Kerala. Curry leaf, country kreat (Exacum bicolor), sunflower, Victoria corn plant (Dracaena sp.), Calotropis gigantea, little tree plant (Biophytum sensitivum), holy basil (Ocimum sanctum) and the aquatic pickerel weed (Monochoria vaginalis) are new host records for T. gloveri. The study confirms that the mite species has established and spread across Kerala by widening its host range and expanding its geographical area of distribution, within a short span after its introduction into the state.

The composition and ecology of the millipede fauna of Victoria remain poorly understood. We collected millipedes as part of a series of ecological arthropod surveys across south-eastern Australia, focusing mainly on Victoria. These samples almost exclusively contained millipedes from the introduced order Julida. We pursued species identification of the julids when it became apparent there were species other than the well-recorded Ommatoiulus moreleti (Lucas, 1860) (Portuguese millipede) in the samples. The majority of specimens were O. moreleti, but we also detected at least one species of Cylindroiulus Verhoeff, 1894, as well as an Ophyiulus Berlese, 1884, species, specimens of which have been identified as Ophyiulus cf. targionii. These are the first Ophyiulus records for Victoria to our knowledge. We present preliminary data on the abundance through the year of Ophyiulus. This is the first study to examine this species in Victoria and little is currently known about its likely impact on agriculture or on native species. Monitoring and research of the species in the future is therefore warranted.

Background Fish and fisheries are important for the livelihoods, food, and income of the rural population in Bangladesh. Increased rice production and changing agricultural patterns have resulted in a large decline in inland fisheries. Implementation of carp pond polyculture has been very successful, whereas little focus has been given to the commonly consumed small indigenous fish species, some of which are rich in vitamin A and minerals, such as calcium, iron, and zinc, and are an integral part of the rural diet. Objective The overall objective of the research and capacity-building activities described in this paper is to increase the production, accessibility, and intake of nutrient-dense small indigenous fish species, in particular mola ( Amblypharyngodon mola), in order to combat micronutrient deficiencies. The large contribution from small indigenous fish species to recommended intakes of vitamin A and calcium and the perception that mola is good for or protects the eyes have been well documented. Methods An integrated approach was conducted jointly by Bangladeshi and Danish institutions, linking human nutrition and fisheries. Activities included food-consumption surveys, laboratory analyses of commonly consumed fish species, production trials of carp–mola pond polyculture, teaching, training, and dissemination of the results. Results No decline in carp production and thus in income was found with the inclusion of mola, and increased intake of mola has the potential to combat micronutrient deficiencies. Teaching and training of graduates and field staff have led to increased awareness of the role of small indigenous fish species for good nutrition and resulted in the promotion of carp–mola pond polyculture and research in small indigenous fish species. The decline in accessibility, increase in price, and decrease in intake of small indigenous fish species by the rural poor, as well as the increased intake of silver carp ( Hypophthalmichthys molitrix), the most commonly cultured fish species, which is poor in micronutrients and not preferred for consumption, are being addressed, and some measures taken by inland fisheries management have been discussed. Conclusions The successful linking of human nutrition and fisheries to address micronutrient deficiencies has relevance for other countries with rich fisheries resources, such as Cambodia and countries in the Lake Victoria region of Africa.

A sequential batch testing procedure was used in conjunction with ELISA to estimate levels of virus incidence in Victorian cut-flower 'Sim' carnations. The industry was surveyed for five viruses, namely; carnation mottle virus (CarMV), carnation etched ring virus (CERV), carnation vein mottle virus (CarVMV), carnation latent virus (CarLV) and carnation ringspot virus (CarRSV). CarMV was the most prevalent virus (9.9%), and lower levels of CERV (0 2%), CarVMV (0.1%) and CarLV (0.1%) were detected. CarRSV was not detected in any of the samples tested. Levels of CarMV were lower than in a previous survey in 1985, suggesting that the Plant Improvement Program which has been in operation in Victoria has been instrumental in reducing the incidence of this virus. Growers who purchased cuttings from specialist propagators had lower levels of virus than propagators who implemented little or no quality control. Growers who introduced pathogen-tested cuttings at regular intervals also had lower levels of virus infection.

Rice yellow mottle virus (RYMV), genus Sobemovirus, is a widespread rice pathogen reported in nearly all rice-growing countries of Africa. Although the virus was detected in Cameroon, Chad, Tanzania, Rwanda, Burundi, and Uganda (2,3), RYMV has never been described in the Democratic Republic of Congo (DRC). In July 2012, plants with leaf yellowing and mottling symptoms were observed in large irrigated rice production schemes 30 km south of Bukavu, in eastern DRC, and in lowland subsistence fields in the surroundings of Bukavu. Several dozen hectares affected by the disease were abandoned by the farmers. Symptomatic leaf samples were collected in different farmer fields. Back-inoculations to susceptible rice variety IR64 resulted in the same yellowing and mottling symptoms 7 to 9 days post-inoculation. Infected leaves gave positive results using double antibody sandwich (DAS)-ELISA tests with polyclonal antisera (as described in [1]), indicating for the first time the presence of RYMV in DRC. Triple antibody sandwich (TAS)-ELISA tests with discriminant monoclonal antibodies (1) revealed that they all belong to serotype 4 found in the neighboring region in Rwanda. Total RNA of three samples from South Kivu was extracted with the RNeasy Plant Mini kit (Qiagen, Germany). The 720 nucleotide coat protein (CP) gene was amplified by reverse transcription (RT)-PCR with primers 5′CTCCCCCACCCATCCCGAGAATT3′ and 5′CAAAGATGGCCAGGAA3′ (1). The sequences were deposited in GenBank (Accessions KC788208, KC788209, and KC788210). A set of CP sequences of 45 isolates representative of the RYMV diversity in Africa, including the sequences of the DRC samples, were used for phylogenetic reconstruction by maximum-likelihood method. The isolates from South Kivu belonged to strain S4-lv, mainly found around Lake Victoria. Specifically, within the S4-lv strain, the South Kivu isolates clustered with isolates from eastern and southern provinces of Rwanda and Burundi, respectively (2), suggesting a recent spread from these countries. Recently, efforts have been directed to shift from the traditional upland system to lowland and irrigated systems in which water availability allows sequential planting and maintenance of higher crop intensity. This agricultural change may increase insect vectors and alternate host plant populations which may result in higher RYMV incidence in DRC (3). Similar yellowing and mottling symptoms have been observed in Bas-Congo and Equateur provinces of the country, which would justify further surveys and characterisation of RYMV in the DRC. References: (1) D. Fargette et al. Arch. Virol. 147:583, 2002. (2) I. Ndikumana et al. Plant Dis. 96:1230, 2012. (3) O. Traoré et al. Mol. Ecol. 14:2097, 2005.

Dissolved organic carbon (DOC) is important to microbial activity and nutrient cycling, and its concentration is sensitive to pH. Despite the importance of alkaline soils to agricultural production in southern Australia, few studies have documented the concentrations of soil organic carbon (C) and DOC or described the effects of soil properties and management practices on DOC in these soils. A survey of 33 paddocks from the Eyre Peninsula and mid-North regions of South Australia and north-western Victoria demonstrated significant variation in pH, soil organic C and DOC. Carbon stocks in the surface 30cm were 40–55tC/ha and were lowest in paddocks from Victoria. Soils from South Australia had higher DOC concentrations in the top 20cm than soils from Victoria. Principal component analysis suggested variation in DOC was increased by high pH, electric conductivity and the concentration of exchangeable Na, and was reduced by the concentration of exchangeable Ca and clay content. Mid-infrared Fourier transform infrared spectroscopy identified regional differences in the composition of soil organic C, with high amounts of charcoal in Eyre Peninsula soils. Farm management practices had little effect on soil organic C but influenced DOC. Grain yield and DOC concentration were inversely related across and within regions which appeared to be related to the intensity of cropping having opposite influences on yield and DOC. Compared with international data, DOC concentrations were high relative to the amount of soil organic C and, in contrast to many previous studies, DOC in all regions increased with depth.

The north-east region of Victoria is an important water-harvesting catchment for gravity-fed irrigators downstream of Lake Mulwala. Dairy farmers are significant users of irrigation water in north-east Victoria but little was known about their irrigation practices and attitudes. A survey undertaken in 2000 collected data on irrigation practices and attitudes from 92% of the irrigating dairy farmers in the region. It found diversity in many aspects of irrigation amongst the region’s irrigated dairy farms, ranging from the proportion of the farm irrigated to the irrigation system used, and identified areas where improvements to irrigation practices could be made. More than 8 different irrigation systems were used in the region, and flood irrigation was the most commonly used. However, a large proportion (37%) of flood irrigators were contemplating changing to spray irrigation, mostly to long lateral hand move sprinkler irrigation, in an effort to improve water use efficiency. More than 50% of respondents did not meter irrigation water use, and 83% pumped water directly from rivers or creeks, with dams and dragline holes the next most common sources. Irrigation scheduling (when to start irrigating and the frequency of irrigation thereafter) and the amount of water to apply were generally based on knowledge and experience rather than on soil moisture monitoring equipment or use of evaporation rates. Most survey respondents recognised that their irrigation practices could improve and said that they would be interested in information to help them make more informed decisions about irrigation practices.

Water use efficiency (WUE) in irrigated dairy systems has been defined, in this paper, as the amount of milk (kg milk fat plus protein) produced from pasture per megalitre of water (irrigation plus effective rainfall). A�farm survey was conducted for the 1997–98 and 1998–99 seasons in the Goulburn Irrigation System (GIS) and Murray Irrigation System (MIS) when the irrigation water allocated to irrigators in the GIS was low (100–120% of water right compared with the MIS which was 130 and 200% of water right). These data were analysed in conjunction with information collected on the same farms in the 1994–95 and 1995–96 seasons when the irrigation water allocated to irrigators in both systems was above 150% of water right (Armstrong et al. 1998, 2000). The aim of the survey was to determine if the management decisions made by dairy farmers in seasons of low irrigation water allocations had an impact on WUE.Milk production averaged across the 2 irrigation systems increased significantly over the 5-year period (57 540–75 040 kg milk fat + protein per farm). Over the same period the amount of irrigation water applied (GIS�7.6 ML/ha, MIS 9.2 ML/ha) and the milking area (GIS 72 ha, MIS 73 ha) remained constant. The amount of concentrates fed per cow (GIS 650–1100 kg DM, MIS 480–860 kg DM) and per farm (GIS 119–228 t DM, MIS�72–157 t DM) increased, but pasture consumption (GIS 8.9–9.5 t DM/ha, MIS 9.1–9.7 t DM/ha) did not increase significantly over the survey period. Therefore, the increase in milk production appeared to come primarily from an increase in supplementary feeding rather than an increase in pasture consumption, resulting in no significant change in WUE in either system (GIS 66 kg milk fat + protein/ML, MIS 61 kg milk fat + protein/ML).The survey results indicate that despite varying water allocations in the 2 major irrigation systems in northern Victoria, milk production on farms in both systems increased while changes in WUE could not be detected by the methods used. This suggests tactical options to increase WUE in response to short-term changes in water allocation were either difficult to implement or not a priority in a business sense.

Conyza bonariensis (L.) Cronq. (syn. of Erigeron bonariensis L.) is a difficult-to-control summer weed species in the cropping belt of south-eastern Australia. Herbicide resistance may be affecting the ability to control C. bonariensis in the agricultural region of north-eastern Victoria; therefore, a survey was conducted to evaluate resistance to herbicides from several mode-of-action groups. Of the populations collected, 40% were resistant to glyphosate at 1080 g ha–1. Chlorsulfuron failed to control any of the populations collected. Further research identified multiple herbicide resistance to glyphosate, chlorsulfuron, metsulfuron-methyl and sulfometuron-methyl in five of nine populations fully characterised. Resistance was not found to 2,4-D, clopyralid or paraquat. There was no correlation between prevailing land use and the frequency of glyphosate-resistant populations, suggesting that resistance had been selected in multiple production systems. The high frequency of resistance could explain the difficulty experienced in controlling C. bonariensis across north-eastern Victoria and demonstrates the importance of integrated weed management to manage this weed.

Field experiments were conducted to determine the crop losses caused by ascochyta blight in different pea varieties grown in Victoria. For each variety, the reduction in yield associated with disease was determined by comparing grain yields in plots not sprayed with fungicide (disease present) and plots where the disease was controlled with fungicide sprays (no disease). There was considerable variation between pea varieties and lines in disease severity and crop losses. Individual varieties had different levels of tolerance to disease, and there were large differences between varieties in the percentage yield loss caused by the same level of disease. Disease severity was closely correlated with reductions in grain yield, and for most varieties there was a 5-6% reduction in grain yield for every 10% of stem area affected by disease (first 10 internodes on the main branch). Ascochyta blight caused substantial reductions in grain yield of all commercial pea varieties grown in Victoria but was usually most severe on the early-maturing varieties. For 15 varieties, empirical crop loss models to predict the relationship between disease severity and reduction in yield were developed. A disease survey of commercial crops was then conducted and estimates made of yield losses caused by ascochyta blight using the previously developed crop loss models. The estimated yield losses caused by ascochyta blight in commercial crops in Victoria in 1986 ranged from 3.1 to 26.4% and exceeded 15% in over three-quarters of crops surveyed. The results suggest that field pea production in Victoria is seriously retarded by ascochyta blight and that the development of effective strategies to control the disease should be given a high priority.

Samples of h e r , kidney and muscle were collected between 1975 and 1983 from 2797 sheep or cattle at 39 meatworks located in all Australian States and the Northern Territory on behalf of the Australian Bureau of Animal Health. The samples were analysed for copper (Cu) and zinc (Zn) at government analytical laboratories. Mean values and proportions falling into various class intervals are presented. Hepatic Cu concentrations tended to be positively skewed with a long tail of observations with high concentrations. About 3% of ovine livers and 9% of bovine livers contained <2 mg Cu/kg freshweight when calculated on a national basis. This concentration was arbitrarily taken as the criterion of a low Cu status, and the proportion within States falling into this class ranged from about 1% in sheep from Queensland, Western Australia and Tasmania to about 11% in Victoria. Proportions in cattle were highest in Victoria, Queensland and New South Wales, and were 13.6, 10.5 and 8.9% respectively. Correlations between Cu and Zn concentrations in the different tissues were low. Possible sources of bias in applying the results to predicting the number of Cu-deficient animals in the various States are discussed.

Equipment for large scale enzyme-linked immunosorbent assay (ELISA) was developed for a 3 year nationwide survey of the incidence of four viruses in pastures of Trifolium subterraneum (subterranean clover) in New South Wales, Victoria, South Australia, Western Australia and Tasmania. Instruments were designed to (a) automate quantitatively the addition of buffer to plant samples passing through a sap extractor, (b) standardize the washing of plates in the various stages of the ELISA protocol, and (c) replace hand pipetting with a pneumatic foot-operated pipette.

In 1986 and 1987 wheat was sown in an experiment at the Mallee Research Station, Walpeup, at 2 times of sowing and with 3 rates of applied nitrogen. Soil cores were taken and trenches excavated to 1.5 m to measure wheat root growth and depth of rooting. Wheat roots penetrated to a maximum depth of 104 cm in crops sown in May, the optimum time of sowing for maximum yield, while delayed sowing reduced total root biomass and limited rooting depth to 73-83 cm. The application of nitrogen fertiliser did not affect either the rooting depth or growth and yield. Significant changes in total soil water content between sowing and harvest only occurred in 1987 with the early and late sown crops reducing the total soil water content by 47 and 99 mm respectively. In 1986, above average rainfall during the growing season caused the early sown crop to accumulate more water below 50 cm than the late sown crop. While total water use was increased only in 1986 with early sowing, crop water use efficiency and yield was greater in both years. The addition of nitrogen had no effect on crop water use or water use efficiency. A survey of wheat crops carried out in 1988 on 10 Mallee farms also found that shallow rooting is widespead. The field experiment and survey data show that, irrespective of sowing time, roots did not penetrate as far down the profile as might be expected, given reported rooting depths commonly in excess of 200 cm on similarly textured soils. This was shown to be associated with high soil pH and salt content. Poor rooting depth of wheat in this environment will restrict the use of stored water and accordingly, calls the practice of fallowing into question.

All known vineyards in the North Central and Geelonq Vine Disease Districts of Victoria were systematically surveyed for grape phylloxera, Daktulosphaira vztlfoliz (Fitch) (Hemiptera, Phylloxeridae). Forty-one of the 28 1 vineyards surveyed were found to be infested. The infested vineyards were located near Nagambie, Ardmona, Glenrowan, Milawa and Rutherglen. There were significant relationships ( �2 , Plt; 0.001) between the infestation of vineyards and the age of the grapevines, the source of planting material, and the use of rootstocks. There was no apparent relationship between phylloxera infestation and soil type. Comparison with a previous survey reported in 1902 indicates a reduction in the number (from 69 to 41), but an increase in the area (from 275 to 653 ha) of infested vineyards. Differences in the distribution of phylloxera were small. There was evidence of spread of phylloxera within districts already infested, but only the Glenrowan- Milawa district contained infestations not previously recorded. Some previously infested areas were found to be free of phylloxera, owing to changing land use. The survey provided a basis for redefining quarantine areas according to the current distribution of grape phylloxera.

Social research was conducted to explore factors influencing weed management on grazing properties in southern Australia. Face-to-face interviews were held with 122 livestock producers, 94 written questionnaires were returned and 90 grazing properties were visited and rated for weed incidence and management effort. Segmentation techniques revealed three groups, on the basis of farmer demographics and farm characteristics. These groups varied significantly in the range of control methods used, weed management effort, difficulties encountered with weed control and attitudes towards weed control. Respondents were also grouped into four categories with respect to weed control methods: minimal control, mechanical control, grazing control and maximal control. Control groups differed significantly in terms of the number and complexity of methods used, difficulties encountered with weed control, levels of weed awareness and the value placed on various sources of information about weed control. Characteristics of effective weed managers were considered and three factors were identified as underpinning success with weed control. These are referred to as the three ‘Ds’: diligence, diversity and deliberation. These factors have been used to define a three dimensional framework, within which the diversity of approaches towards weed control can be understood.

The occurrence of races among 65 Australian isolates of Pseudornonas syringae pv. pisi, the causal organism of bacterial blight of field peas, was investigated. Race 3 was most common in Victoria and New South Wales, while race 6 was most common in South Australia. Field pea cultivars were screened for their resistance or susceptibility toward the 7 races of P. syringae pv. pisi. The most common cultivars were susceptible to races 3 and 6, explaining the high incidence of these races in this survey. All cultivars tested were susceptible to race 6, which was identified in all 3 States.

A survey ofclover at 44 sites in permanent dryland pastures in North-Central Victoria, highlighted poor nodulation of subterranean clover.In 1982 and 1983 respectively only 40 and 62% of plants were effectively nodulated 8-10 weeks after germination of the clover. Clover root rot was also present in both years, 64% of plants being affected in 1982 and 14% in 1983. Nodulation was negatively correlated with the incidence of root rot and with the percentage of exchangeable aluminium in the soil and positively correlated with the percentage of exchangeable calcium in the soil. The number of Rhizobium trifolii in the soil was not correlated with any of the soil factors measured.

A survey of 71 sites was conducted in the dairying districts of south-western Victoria in October 1994 to determine factors associated with nitrogen (N) fixation in white clover based pastures. Twenty-eight factors (environmental, microbiological, management, soil, and pasture) were considered in relation to 2 indicators of N fixation by white clover, %Ndfa (percentage of total plant N derived from the atmosphere, as determined by the 15N natural abundance method) and kg of N fixed per tonne herbage dry matter (legume and non-legume). On light-textured soils (sandy loams), soil potassium, rhizobia numbers, total soil N, and density of the nematode Pratylenchus sp. accounted for 72% of variation in %Ndfa. On medium-textured soils (clay loams), crude protein of perennial ryegrass and plant-available phosphorus in the soil accounted for 30% of variation in %Ndfa. The amount of N fixed was influenced by different factors, again depending on soil texture. Soil chemical properties accounted for 31% variation on the medium-textured soils with nematode density, pasture quality, and soil chemical properties accounting for 77% of variation on light-textured soils. Amounts of N fixed per tonne herbage dry matter produced averaged 8.2 kg on the light-textured soils and 7.3 kg on the medium-textured soils. Average %Ndfa values were 67% and 60% on light- and medium-textured soils, respectively. Effects of soil texture on N fixation were attributed to the different cation exchange and water-holding capacities of the soils and highlight the importance of considering soil type in N fixation studies.

AbstractThe study provides comparative risk analyses of Australia’s three Victorian dairy regions. Historical data were used to identify business risk and financial viability. Multivariate distributions were fitted to the historical price, production, and input costs using copula models, capturing non-linear dependence among the variables. Monte Carlo simulation methods were then used to generate cash flows for a decade. Factors that influenced profitability the most were identified using sensitivity analysis. The dairies in the Northern region have faced water reductions, whereas those of Gippsland and South West have more positive indicators. Our analysis summarizes long-term risks and net farm profits by utilizing survey data in a probabilistic manner.

The results from a survey of 269 test wells in an area with shallow watertables were used to derive a relationship between soil salinity to 60 cm depth (Y) and watertable depth (X1) and watertable salinity (X2). The survey area (730 km2) was in the Goulburn Valley of Victoria and included irrigated and non-irrigated pastures. The relationship was described by the multiple Regression ln Y = a + b ln X1 + c ln X2 The equations were: Perennial pastures ln Y = 7.3859 - 0.607l.ln X1 + 0.2925.ln X2 (r = 0.50, P= 0.0000002, n = 109) Annual pastures ln Y = 7.2690 - 0.7252.ln X1 + 0.3743.ln X2 (r=0.54, P=0.00349, n=36) Dryland pastures ln Y = 10.8417 - 1.3779.ln X1 + 0.4024.ln X2 (r= 0.73, P= 0.0003, n = 24) It was concluded that both depth and salinity of the watertable determine its hazard to soil salinity; watertable depth alone can be misleading. The effect of watertable salinity was greater than that of watertable depth. Similar models could be developed for other regions if data for the regions were available.

A survey of electrophoretic variation in 89 isolates of Rhynchosporium secalis collected from cultivated and wild barley grass in Victoria, New South Wales and Tasmania detected an average of 2.5 alleles at each of 11 loci in 5 enzyme systems. At five loci, two alleles each occurred at frequencies exceeding 0.2. Comparison of the frequency of alleles at these loci showed little association with host or geographic origin, pathogenicity of the isolates or with the allelic state at other loci. Given that this pathogen reproduces asexually only, this lack of association confirms previous suggestions that some means of asexual recombination is important in this pathogen. Furthermore, the results suggest that the most effective means whereby long-term control over R. secalis will be achieved is through the use of both pathotype-specific and field resistance complemented by other strategies like the use of fungicides and possibly varietal mixtures.

On all of 120 farms in south-west Victoria that were selected at random and sampled during autumn and winter over 2 years, perennial ryegrass was present in the pasture and tested positive for the presence of the naturally occurring ryegrass endophyte, Neotyphodium lolii (mean frequency 78%). Ryegrass staggers were reported on 33% (1999) and 43% (2000) of the surveyed farms. Clinically significant concentrations of lolitrem B were detected in perennial ryegrass samples with concentrations in the range 0–4.44 mg/kg. Concentration exceeded 1.8 mg/kg in 37% of pastures indicating an inherent, widespread problem for livestock farmers. Concentration was independent of endophyte frequency, pasture age, pasture height, annual rainfall and origin of sown cultivar. Ergovaline was detected in most of the perennial ryegrass samples with concentrations up to 3.90 mg/kg. In 1999, the mean concentration of ergovaline was 0.76 (± 0.70) mg/kg with 33% of pastures having a level >0.4 mg/kg, the level associated with heat stress in cattle. In 2000, sampling was carried out later in the year than for the 1999 survey and the mean concentration of ergovaline was 0.12 (± 0.10) mg/kg; 3% of samples exceeded 0.4 mg/kg. The mean concentration of peramine was 13.7 (± 6.6) mg/kg in the 1999 survey and 4.2 (± 5.1) mg/kg in the 2000 survey. Mineral analysis indicated that perennial ryegrass nutrition was inadequate with regard to phosphorous on 17% of the dairy pastures and on 37% of the sheep/beef pastures. Potassium was deficient in perennial ryegrass on 5 and 37% of dairy and sheep/beef pastures respectively. For perennial ryegrass in sheep/beef pastures, 25% were deficient in sulphur. For lactating cattle having only perennial ryegrass as a food source, phosphorous and copper concentrations in the grass were inadequate on 80% of the pastures. Calcium, zinc, magnesium, potassium and sulphur concentrations in perennial ryegrass were also inadequate on some pastures. However, with 1 exception, the ratio [K/(Ca+Mg) expressed as equivalents] was less than 2.2, the level associated with the development of hypomagnesemia. Hypomagnesemia (grass tetany) was therefore unlikely to be a major cause of the staggers syndrome. Lolitrem B was negatively correlated with grass potassium concentration (P<0.001). Ergovaline was negatively correlated with date of sampling (P<0.001). Peramine concentration was positively correlated with endophyte frequency, the potassium and sodium concentrations in perennial ryegrass and negatively correlated with date of sampling. The need for research on the economic impact and management of pasture contaminated with ryegrass endophyte toxins is discussed.

An electromagnetic induction (EM31) survey was carried out on a 700-ha property in the western basalt plains of Victoria. The apparent electrical conductivity (ECa) was interpreted in terms of the inferred salt content and, hence, the degree of leaching or recharge through the upper 5 m of the regolith. The focus of the survey was to determine the spatial variability of ECa across a landscape of low relief which included salt lakes. The area mapped is subject to regional groundwater discharge. All parts of the property exhibited hydrological ‘sinks’ and ‘trenches’ of relatively low ECa values, interpreted as areas of preferential recharge or leaching through the regolith. They ranged in size from 200 to 500 m in diameter and/or length and were not related to relief. This apparent hydrological ‘holeyness’ of the upper regolith suggests local recharge into the regional groundwater system. This finding has important implications for Whole Farm Planning and Environmental Management Strategies as local recharge can be reduced by manipulating ground cover and land-use practices. Both the mean and standard deviation of ECa values across the property provide a rational basis for planning land management practices. The location of hydrological ‘holes’ can be built in as significant layers in Whole Farm Plans to minimise water entering the water table and/or salt lakes.

Summary. Factors associated with silage quality were investigated on 140 dairy farms in western Victoria. The management factors measured were date of lock up, date cut, length of lock up, duration of wilting, raking and tedding during wilting period, rainfall during wilting period and the type of silage made. Pasture variables measured at harvesting included percentage composition (ryegrass, legume, other grasses and weeds), dry matter of pasture, metabolisable energy, crude protein, neutral detergent fibre and water-soluble carbohydrate of the pasture, and dry matter yield of the pasture. The average lock up time of pasture for silage was mid September, although the range was from late July to early November. The length of lock up varied from 16 to 91 days with a mean value of 49 days and pastures were on average harvested in early November. Ryegrass on average accounted for 61%, legumes and other grasses accounting for a further 15% each and weeds about 5%. The range in quality of pasture at harvesting was highlighted by the range in metabolisable energy (8.9–11.3 MJ/kg DM) and crude protein (10.2–20.4%) values. Wilting times varied from 0.5 to 15 days with the biggest range being observed in pastures used for baled silage. All factors were regressed against final silage metabolisable energy and crude protein. Factors which had the greatest effect on final silage metabolisable energy were date of cutting, length of lock up, type of silage, the interaction between type of silage and length of lock up, length of wilting and mechanical treatment during the wilting period. Final silage crude protein was most strongly associated with date of cutting, crude protein content of the pasture and mechanical treatment during the wilting period. Mechanical treatment during the wilting period had the greatest influence on silage quality. Other options to improve silage quality such as cutting earlier or reducing wilting periods may not be possible or economically viable.

The measurement of soil pH using a field portable test kit represents a fast and inexpensive method to assess pH. Field based pH methods have been used extensively for agricultural advisory services and soil survey and now for citizen soil science projects. In the absence of laboratory measurements, there is a practical need to model the laboratory pH as a function of the field pH to increase the density of data for soil research studies and Digital Soil Mapping. The accuracy and uncertainty in pH field measurements were investigated for soil samples from regional Victoria in Australia using both linear and sigmoidal models. For samples in water and CaCl2 at 1 : 5 dilutions, sigmoidal models provided improved accuracy over the full range of field pH values in comparison to linear models (i.e., pH < 5 or pH > 9). The uncertainty in the field results was quantified by the 95% confidence interval (CI) and 95% prediction interval (PI) for the models, with 95% CI < 0.25 pH units and 95% PI = ±1.3 pH units, respectively. It was found that the Pearson criterion for robust regression analysis can be considered as an alternative to the orthodox least-squares modelling approach because it is more effective in addressing outliers in legacy data.

Documentation of biodiversity is crucial for examining the health of ecosystems. Many species act as an ecological indicator due to their susceptibility to changes in a particular environment. Butterflies, providing vital ecosystem services, respond uniquely to urbanization and can be a good tool for the assessment of the well-being of the habitat. The present study, one of its first kind in the particular habitat, provides a comprehensive outlook on the species diversity and abundance of butterflies at Victoria Park Reserve Forest, an urban forest area in Bhavnagar, Gujarat, India. The survey was conducted from March 2018 to February 2019 across all seasons. A total of 69 species belonging to 45 genera and five different families were recorded. The most diverse family was Lycaenidae (33.33%), followed by Nymphalidae (31.88%), Pieridae (21.74%), Papilionidae (7.25%), and Hesperiidae (5.80%). Junonia , was the dominant genus with six species. Out of the total recorded species,12 species are listed under the Least Concern category of the IUCN red list and 57 species are Not Evaluated. Seasonal variation in the number of species was observed, which shows the highest number of species in September (n=63) and the lowest in May (n=22). The abundance of the butterfly community was found to be highest during August (26.37%) and the lowest during February (1.85%). This study provided an understanding of the butterfly community in the habitat and would encourage further research for habitat restoration in the reserve forest.

Land use and land cover change as a result of human-induced transitions is a major environmental challenge in Lake Victoria Basin. The study adopted a mixed-method consisting of remote sensing and GIS-based analysis, key informant interviews, and household survey consisting of 384 households to asses Land Use and Land Cover Dynamics and associated human-induced transformations in Ombeyi wetland. The study aimed at generating a characterized area estimate of Ombeyi wetlands land use and land cover change schema for the study period (1990-2017), and examining the spatial and temporal characteristics of anthropogenic impacts and their relationship with land use and land cover change in Ombeyi wetland. The gis-based analysis revealed that built-up area/settlements and agricultural lands extensively increased in area at the expense of wetland vegetation. Key informants attributed the changes to population increase (29.2%) and an associated demand for land and natural resources as the major driving forces for the changes. Analysis of household-survey results validated the observed patterns during the remotely sensed data analysis phase of the research, as 90.1% (n=384) of the respondents reported to own land within the wetland through inheritance. 92.2% of the respondents are farmers practicing farming in the wetland with 72.4% of the same respondents attaining primary level education and below. Poverty and education levels were significant factors in influencing unsustainable land use and land cover changes observed in this study. The present state of land cover and its dynamics have had negative impacts on the riparian rural livelihoods and natural resource management.

AbstractField studies of Mythimna convecta (Walker), Persectania ewingii (Westwood) and P. dyscrita Common, and their associated parasitoids, were conducted in cereals and pastures in Victoria, Australia, in 1980–83. The study included a survey of the armyworm fauna in the major agricultural districts, detailed phenological studies within five oat crops, and ultraviolet-light trapping of adults. M. convecta was the most abundant species in cereals and was found more commonly in the warmer months of spring and summer in all districts. Larval development in oat crops during spring was preceded by little moth activity in light traps. P. ewingii was common in the southern districts and in the cooler months from May to September. It was the most prevalent armyworm species in pastures and rarely occurred in barley. P. dyscrita was the least abundant species and occurred mostly in the drier inland areas, particularly in the west. Light-trap catches of P. ewingii and P. dyscrita suggested there were two generations, one in spring and one in the autumn. Regular sampling in oat crops showed that M. convecta developed faster and was usually more abundant than P. ewingii during seed development and ripening, and hence had the potential to inflict more crop damage. Of the 17 species of parasitoids reared from field-collected larvae, the wasp Campoletis sp. was the most abundant. In 1980–82, average parasitism ranged from 13 to 16% but fell to 2% after the drought of 1982.

A survey of 108 alpaca producers registered with the Australian Alpaca Association examined the occurrence and severity of ‘staggers’ (a colloquial term embracing various diseases of the nervous system in animals, characterised by neck tremors and head nodding in the milder alpaca cases and a lack of coordination in moving, a staggering gait and frequent falling in severe cases) in Australian alpaca and the presence of four pasture grasses, during three production seasons in 2004–2006. There have been few studies on the susceptibility of alpaca to staggers and its effect on productivity and animal welfare. The survey found that 23% of alpaca producers had observed staggering animals, with Victoria and South Australia being the most severely affected states. Clinical signs of staggers were most frequent in January–March, with a mean duration of 3 months. Some animals showed clinical signs lasting up to 12 months. A strong correlation was found between the presence of perennial ryegrass (P < 0.001) and phalaris (P < 0.003) and the occurrence of staggers. Based on grass presence and the timing when staggers was observed, it was concluded that perennial ryegrass toxicosis was the main cause of staggers in alpaca. About 12% and 9% of alpaca grazing pasture containing perennial ryegrass exhibited staggers in the two full seasons for which data were collected. Herds with staggering animals were correlated with those exhibiting possible subclinical effects – heat sensitivity and ill-thrift (P < 0.01) and reduced fertility (P < 0.05) – of perennial ryegrass endophyte toxins. Results indicate that weanlings and cria are more likely to stagger than adults. Thirteen of the 15 mixed farms with staggering alpaca did not observe staggers in other livestock, suggesting that alpaca may be more sensitive to the causal toxins than sheep and cattle.

A nationwide survey was made of the time-course incidence of alfalfa mosaic virus (AMV), clover yellow vein virus (CYVV), subterranean clover mottle virus (SCMoV) and subterranean clover red leaf virus (SCRLV) in improved pastures in southern regions of Australia over a 3-year period. Up to 2 500 samples (cvv. Mt Barker or Woogenellup) were collected in winter and spring of 1984, 1985 and 1986 in each of New South Wales, Victoria, South Australia. Western Australia and Tasmania, and assayed by ELISA. Usually, each sample consisted of one or two plants or parts thereof. However, a small number of samples in winter contained parts of up to 10 seedlings. For this reason, incidences are expressed as percentage of infected samples rather than percentages of infected plants. All four viruses occurred in all five states. Averaged over all states, the incidence of infected samples increased progressively from 15.3 to 19.9 to 22.5% from 1984 to 1985 to 1986, respectively, in spring, and from 6.8 to 13.8 to 18.8% respectively in winter. The incidence of samples infected with multiple infections (2-4 viruses) increased from 1.9 to 3.2 to 5.0% from 1984 to 1985 to 1986, respectively, in spring, and from 0.5 to 1.6 to 4.0%, respectively, in winter. Since 1-4 viruses were detected in each infected sample, more individual infections than infected samples were recorded. For example, the incidence of virus infections per paddock increased progressively from 17.5 to 24.1 to 28.6% from 1984 to 1985 to 1986, respectively, in spring. On a state basis, the incidence of infected samples was greatest in W.A., reaching 38.9 and 34.9% in spring of 1985 and 1986, respectively, and in S.A. reaching 30.3% in spring of 1986; these high levels were due largely to SCMoV which reached 97% in one paddock in each of the two states. In N.S.W., Vic. and Tas., the highest incidences of infected samples in either winter or spring were 21.4, 16.2 and 23.1%, respectively. Averaged over all states, the highest mean incidence recorded for samples infected with individual viruses in either winter or spring was 9.4% for AMV, 5.7% for CYW, 10.9% for SCMoV and 7.5% for SCRLV. For AMV and SCRLV, there was an increasing trend from spring 1984 to spring 1986. A similar increasing trend for SCMoV was more evident in winter than in spring. For CYVV, no time-course pattern was evident. These results support the proposition that viruses contribute significantly to 'clover-decline', a well-known problem in pastures of subterranean clover.

Many species of reptiles are sedentary and depend on ground-layer habitats, suggesting that they may be particularly vulnerable to landscape changes that result in isolation or degradation of native vegetation. We investigated patterns of reptile distribution and abundance in remnant woodland across the Victorian Riverina, south-eastern Australia, a bioregion highly modified (>90%) by clearing for agriculture. Reptiles were intensively surveyed by pitfall trapping and censuses at 60 sites, stratified to sample small (<30 ha) and large (>30 ha) remnants, and linear strips of roadside and streamside vegetation, across the regional environmental gradient. The recorded assemblage of 21 species was characterised by low abundance and patchy distribution of species. Reptiles were not recorded by either survey technique at 22% of sites and at a further 10% only a single individual was detected. More than half (53%) of all records were of two widespread, generalist skink species. Multivariate models showed that the distribution of reptiles is influenced by factors operating at several levels. The environmental gradient exerts a strong influence, with increasing species richness and numbers of individuals from east (moister, higher elevation) to west (drier, lower elevation). Differences existed between types of remnants, with roadside vegetation standing out as important; this probably reflects greater structural heterogeneity of ground and shrub strata than in remnants subject to grazing by stock. Although comparative historical data are lacking, we argue that there has been a region-wide decline in the status of reptiles in the Victorian Riverina involving: (1) overall population decline commensurate with loss of >90% of native vegetation; (2) disproportionate decline of grassy dry woodlands and their fauna (cf. floodplains); and (3) changes to populations and assemblages in surviving remnants due to effects of land-use on reptile habitats. Many species now occur as disjunct populations, vulnerable to changing land-use. The status of reptiles in rural Australia warrants greater attention than has been given to date. Effective conservation of this component of the biota requires better understanding of the population dynamics, habitat use and dispersal capacity of species; and a commitment to landscape restoration coupled with effective ecological monitoring.

During the nineteenth century mountain guides could be hired at almost all the inns and hotels of Snowdonia; they were local men self-educated in subjects like botany and geology. In 1838 Edwin Lees while staying at The Dolbadara, Llanberis, an inn with a long tradition with the Snowdon guides, hired the services of such a man. Names of local guides are sparsely found among the pages of visitors-books kept in the huts on Snowdon's summit, inscribed for posterity by the Victorians, also in rare guide-books and on slate tombstones. Tom Jones of Beddgelert was guide to Sir Henry De la Beche during his geological survey of Snowdon. William Williams the botanical guide, known locally as „Will boots”, an expert on Arctic-alpine plant localities, met his end when his rope broke while he was gathering a rare fern for a client on Snowdon. Slate-quarryman Hugh Lewis, who showed Charles Babington the locality of another rare fern, was also guide to a mysterious lady fern-collector who published an account of her mountain adventures under the pseudonym „Filix-foemina” in a gardening periodical. John Hughes, whose pocket-book is still kept in the family, bears testimony of clients who benefited from his extensive local knowledge on geology and botany.

The native riparian vegetation communities on the Chowilla floodplain in the lower River Murray in South Australia are suffering severe declines in health, particularly the Eucalyptus camaldulensis Dehnh. (red gum) and Eucalyptus largiflorens F.Muell. (black box) communities. The primary cause of the decline is salinisation of the floodplain soils caused by increased rates of groundwater discharge and hence increased movement of salt up into the plant root zone. The salinity is driven by a lack of flooding and rising saline groundwater tables. Rises in the naturally saline groundwater levels are due to the effects of river regulation from Lock 6 and high inflows from regional groundwater levels increased by Lake Victoria to the east. River regulation has also led to reduced frequency and duration of the floods that leach salt from the plant root zone and supply fresh water for transpiration. The frequency of medium-sized floods occurring on Chowilla has been reduced by a factor of three since locking and water extractions were commenced in the 1920s to provide reliable water for urban and agricultural use. The soil salinisation on the floodplain was modelled by using a spatial and temporal model of salt accumulation from groundwater depth, groundwater salinity, soil type and flooding frequency. The derived soil water availability index (WINDS) is used to infer vegetation health and was calibrated against current extent of vegetation health as assessed from fieldwork and satellite image analysis. The modelling work has shown that there is a severe risk to the floodplain vegetation from current flow regimes. This paper estimates that 65% (5658 ha) of the 8600 ha of floodplain trees are affected by soil salinisation matching a field survey of vegetation health in 2003 (Department of Environment and Heritage 2005a), compared with 40% in 1993 (Taylor et al. 1996). Model results show that the best management option for Chowilla is lowering the groundwater down to 2 m below current levels, which predicts an improvement in the health of the floodplain tree species from 35 to 42%.

This study consisted of a survey of dairy farmers and their milking sheds at 198 Victorian dairy farms to examine the relationships between physical features in the milking shed and a number of job-related characteristics of the farmer, such as attitudes to handling cows and job satisfaction. Furthermore, farmers’ opinions of the effects of specific design features of the milking shed on cow behaviour were sought. A further objective of this survey was to use the relationships between shed characteristics and job-related characteristics of the farmer to identify, for future research, possible features of the milking shed that may affect cow behaviour. There was substantial variation in both the behavioural beliefs of farmers about cow behaviour in the milking shed and reports by farmers on comfort and working conditions in the dairy, indicating that considerable opportunities exist to improve these key job-related characteristics. A principal component analysis (PCA) of the responses to the questions on job-related characteristics of the farmer identified 6 factors: 2 of the factors identified were related to behavioural beliefs by farmers about cow behaviour (labelled ‘Cow Movement’ and ‘Cow Behaviour’); one of the factors related to comfort of the farmer in the shed (labelled ‘Operator Comfort’); and 3 of the factors related to aspects of the quality of life of the farmer (labelled ‘Workload’, ‘Farmer Mood’, and ‘Job Characteristics’). Positive beliefs about both cow movement (factor called Cow Movement) and cow behaviour (factor called Cow Behaviour) were correlated with farmers being more positive about working in the dairy (factor called Operator Comfort; P < 0.05 and P < 0.01, respectively) and the characteristics of the job (factor called Job Characteristics; P < 0.01). These relationships suggest that improvements in cow behaviour may lead to improvements in both job satisfaction and the quality of life of the farmer. Furthermore, regression analysis revealed that a number of the shed features, such as height of the breast rail, presence of stall gates, length and width of the platform and solid side on first milking bail, were significant predictors of one or more of these 6 PCA factors. Although these results may not reflect causal relationships, these relationships between shed characteristics and a number of job-related characteristics of the farmer highlight the potential importance of shed design to both the cow and the farmer and provide a valuable guide in identifying features of milking sheds that require future examination as to their effects on cow behaviour.

Summary. A detailed survey was undertaken in the spring of 1995 with 20 wool producers in south-west Victoria and the south-east of South Australia to determine the impact of their participation for 18 months in a program called the Grassland’s Productivity Program. This program involved groups of producers establishing paired-paddock comparisons on their own farms with guidance from an experienced facilitator. Productive pasture practices (increased fertiliser rates, responsive pasture species and high stocking rates) were used in one paddock, while the remaining paddock was managed with existing practices. A second group of 15 producers from the same districts who did not participate in the Grassland’s Productivity Program were selected at random and also surveyed. Although the 2 groups of producers had similar pasture productivity parameters (phosphorus fertiliser, stocking rates and pasture resowing rates) in the autumn of 1993, the Grassland’s Productivity Program participants had significantly (P<0.05) increased phosphorus fertiliser rates on average from 5.7 to 10.5 kg P/ha, stocking rates from 9.4 to 10.7 dse/ha, and the area of the farm that was being resown to new pasture from 2.9 to 4.0%, by the spring of 1995. There was no change in the pasture practices of the non- Grassland’s Productivity Program producers over this period. The Grassland’s Productivity Program participants also increased their use of soil testing and plant tissue testing and changed their rationale for making fertiliser and stocking decisions. The decisions were now based on an assessment of soil fertility and animal production target levels, together with accurate assessment of pasture production and animal requirements, rather than on past experiences and normal district practices. The increased adoption of the productive pasture technology (practice change) was directly related to a change in attitude to decision making. This change in attitude or beliefs among Grassland’s Productivity Program participants was a result of the action learning experiences that disposed or modified existing beliefs, while integrating the productive pasture technology in a contextualised manner. The paired-paddock approach to learning enabled each participant to witness the productive pasture technology perform on their own farm, in direct comparison with the existing management approach. The participants developed increased confidence in their ability to manage this technology from group-learning experiences, which occurred at regular group meetings.

Abstract Objectives Associations between diet and colorectal cancer (CRC) have not yet been examined in a population inhabiting the Palestinian territories, which are undergoing a nutrition transition. Understanding how diet may impact CRC risk among Palestinians is essential to developing targeted, culturally-relevant strategies that could alleviate the burden of this disease. The aim of this study was to examine how dietary fiber and fruit & vegetable (FV) intakes are associated with the risk of CRC among Palestinian adults recruited from a tertiary care facility in East Jerusalem. Methods This was a case-control study of 528 Palestinian men and women &gt;18 years old who were recruited from Augusta Victoria Hospital (AVH) between 2014 and 2016. Cases included 118 patients who were treated for CRC at AVH. Controls included 410 individuals who consisted of a community-based sample of Palestinian individuals without cancer. All participants completed a survey regarding demographics, CRC-related risk factors, and a validated food screener to assess intakes of dietary fiber and FV. Multivariable logistic regression models tested associations between dietary fiber and FV intakes (categorized into quartiles) with the risk of CRC, adjusting for sex, diabetes, family history of CRC, and inflammatory bowel disease. Results After adjusting for covariates, as dietary fiber increased across quartiles of intake, the risk of CRC significantly decreased (OR for Q4 vs Q1 = 0.26, 95% CI: 0.12–0.58, p-trend = 0.0007). There was no significant association observed between FV intake and CRC risk. Conclusions Consumption of high dietary fiber was associated with lower CRC risk in this case-control study of a Palestinian population. The development and testing of culturally-relevant dietary interventions to promote increasing dietary fiber intake among Palestinians are needed, particularly interventions targeting those at high risk for developing CRC. Funding Sources USDA/NIFA Hatch Project 1,011,487 and a Pears Foundation Scholarship from the Robert H. Smith Faculty of Agriculture, Hebrew University of Jerusalem.

Profitability of the pulse industry relies considerably on crop nitrogen fixation because this process supplies greater than 60% of pulse crop nitrogen. Therefore the industry requires the most efficient Rhizobium symbioses and effective inoculation management. Re-appraisal of the recommended inoculant strain for field pea, SU303, in south-east Australia, was warranted by field evidence that SU303 failed to maximise grain yield at sites in Western Australia. Re-appraisal of the inoculant strain for faba bean and lentil, WSM1274, was warranted because of anecdotal evidence from Western Australia of associated crop failures. In addition, a glasshouse study in Western Australia reported greater dry matter production by faba bean and lentil inoculated with strains other than WSM1274. This paper reports trials comparing potential inoculant strains for field pea and faba bean in soils of south-east Australia. Comparisons are based on efficiency for nitrogen fixation, survival on seed and survival in soil. Additionally, because the pulse industry lacked comprehensive information to assist decision making on the need for recurring inoculation, relevant investigation of this issue is also reported. The results of 3 field experiments for efficiency for nitrogen fixation, over mildly (pHCa 5.0) to strongly (pHCa 4.3) acidic soil in south-east Australia supported replacing SU303 as the commercial inoculant. The efficiency for nitrogen fixation of WSM1274 on faba bean was not found to be inferior to alternative strains. However, its capacity for survival on seed at temperatures of 15°C and above, over a wide range of relative humidity, and perhaps its capacity for survival in acidic soil, was inferior. This provided additional evidence to justify the replacement of this inoculant strain that was agreed to by a national steering committee in 2001, based on the Western Australia reports, the early experiments in this study and those of a collaborative study in Victoria. Alternative inoculant strains to SU303 and WSM1274 were identified in the current study. Temperature and relative humidity conditions suitable for maintaining inoculant viability with extended storage of inoculated field pea and faba bean are also discussed. A survey of rhizobia surviving in soil was used to determine the time scale of persistence of Rhizobium leguminosarum bv. viciae and Bradyrhizobium sp. (Lupinus) in soils of the south-east. It was concluded that in soils of pH (CaCl2) <5.1, inoculation of field pea and faba bean should be routinely practiced; none of the strains of R. leguminosarum bv. viciae tested showed ability for survival in strongly acidic soil sufficient to obviate seed inoculation. It was further concluded that the absence of a legume host for lupin rhizobia for 4 or more years would also warrant reintroducing inoculant of B. sp. (Lupinus).

Aquaculture production in Tanzania has increased in recent years, responding to an increased demand for fish, but the scale and productivity of smallholder aquaculture remains below the level needed to support significant sector growth in Tanzania. This study assesses, through geospatial analyses, the suitability for freshwater pond farming of Oreochromis niloticus and Clarias gariepinus in Tanzania, by assessing the geographical distribution of seven criteria (water availability, water temperature, soil texture, terrain slope, availability of farm inputs, potential farm-gate sales, and access to local markets) identified as important for fish pond farming. The criteria were developed and standardized from 15 sub-criteria, which were classified into a four-level suitability scale based on physical scores. The individual weights of the different criteria in the overall GIS suitability assessment were determined through a multi-criteria evaluation. The final results were validated and compared through field observations, interviews with 89 rural and 11 urban aquaculture farmers, and a questionnaire survey with 16 regional fisheries officers. Our results indicate that there is a good potential for aquaculture in Tanzania. Almost 60% of Tanzania is assessed as being suitable and 40% as moderately suitable for small-scale subsistence pond farming, which is the dominating fish farming practice currently. The corresponding figures for medium-scale commercial farming, which many regions expect to be the dominating farming method within ten-years, were 52% and 47% respectively. The availability of water was the most limiting factor for fish pond farming, which was confirmed by both farmers and regional fisheries officers, and assessed as being “suitable” in only 28% of the country. The availability of farm-gate sales and local markets were “moderate suitable” to “suitable” and were seen as a constraint for commercial farms in rural areas. The availability of farm inputs (agriculture waste and manure) was overall good (26% very suitable and 32% suitable), but high-quality fish feed was seen as a constraint to aquaculture development, both by farmers and regional fisheries officers. Soil, terrain, and water temperature conditions were assessed as good, especially at low altitudes and in regions close to the sea and south of Lake Victoria.

The high-rainfall zone (HRZ) of southern Australia is the arable areas where annual rainfall is between 450 and 800 mm in Western Australia and between 500 and 900 mm in south-eastern Australia, resulting in a growing-season length of 7–10 months. In the last decade, there has been a growing recognition of the potential to increase crop production in the HRZ. We combined (1) a survey of 15 agricultural consultants, each of whom have ~40–50 farmer clients across the HRZ, (2) 28 farm records of crop yields and area for 2000–2010, (3) 86 wheat and 54 canola yield observations from well managed experiments, and (4) long-term simulated crop yields at 13 HRZ locations, to investigate recent trends in crop production, quantify the gap between potential and actual crop yields, and consider the factors thought to limit on-farm crop yields in the HRZ. We found in the past 10 years a trend towards more cropping, particularly in WA, an increased use of canola, and advances in the adaptation of germplasm to HRZ environments using winter and longer-season spring types. Consultants and the farm survey data confirmed that the rate of future expansion of cropping in the HRZ will slow, especially when compared with the rapid changes seen in the 1990s. In Victoria, New South Wales and South Australia the long-term water-limited potential yield in HRZ areas, as measured by experimental yields, consultant estimates and simulations for slow developing spring cultivars of wheat and canola was 5–6 and 2–3 t/ha for a decile 5 season. For Western Australia it was 4–5 and 2–3 t/ha, where yields were less responsive to good seasons than in the other states. The top performing farmers were achieving close to the water-limited potential yield. There are yield advantages of ~2 t/ha for ‘winter’ over ‘spring’ types of both wheat and canola, and there is scope for better adapted germplasm to further raise potential yield in the HRZ. Consultants stated that there is scope for large gains in yield and productivity by encouraging the below-average cropping farmers to adopt the practices and behaviours of the above-average farmers. The scope for improvement between the below- and above-average farmers was 1–3 t/ha for wheat and 0.5–1.5 t/ha for canola in a decile 5 season. They also stated that a lack of up-to-date infrastructure (e.g. farm grain storage) and services is constraining the industry’s ability to adopt new technology. Priorities for future research, development and extension among consultants included: overcoming yield constraints where growing-season rainfall exceeds 350 mm; adaptation of winter and long-season spring types of cereals and canola and management of inputs required to express their superior yield potential; and overcoming barriers to improved planning and timeliness for crop operations and adoption of technology.

The Red Fox (Vulpes vulpes), wild Dog (Canis lupus familiaris), Rabbit (Oryctolagus cuniculus), and feral Pig (Sus scrofa) can have a significant and profound impact on biodiversity and/ or agricultural production in Australia (Saunders et al. 1995; Williams et al. 1995; Choquenot et al. 1996; Fleming et al. 2001). Baiting programmes with 1080 (sodium fluoroacetate) form an integral and, in some cases, the only means by which the impacts of these invasive species can be managed over a large-scale (Saunders et al. 1995; Williams et al. 1995; Choquenot et al. 1996; Fleming et al. 2001). However, in recent times, there has been growing concern among some Australian rural communities that some 1080 products are not as effective as they once were, particularly those used for baiting foxes. Although such reports are often anecdotal, their increasing frequency is of concern. Recently, the Malleefowl Preservation Group in Western Australia conducted a semi-formal survey of their Newsletter readers regarding the effectiveness of 1080 products against Foxes, wild Dogs, and Rabbits. Over 40 responses were received from 15 different postcode regions with up to 50% of these respondents believing some 1080 products were no longer effective (Malleefowl Preservation Group unpublished data). Similarly, participants in coordinated community 1080-baiting programmes in Victoria surveyed during 2004/05 suggested that poor bait take, loss of efficacy, risk to farm dogs, and the high associated costs were the main reasons for less than ideal control programmes (McPhee 2005). This suggests that questions regarding the effectiveness of 1080 products are not unique to Western Australia. More recently, in NSW, the effectiveness of some 1080-baiting programmes was shown to be less than ideal, even when a coordinated approach was used (Gentle 2007a; Bengsen In Press). In one instance, such a programme with 3 mg 1080 baits reduced fox abundance by only 30% (Bengsen In Press). There are a number of reasons why baiting programmes may have, or are perceived to have failed (see below), including the loss of effectiveness of the active ingredient against the target species. With respect to foxes, the only assessment of their sensitivity to 1080 was a provisional study undertaken in the late 1980s when the sensitivity to 1080 of 11 foxes was determined: 3 from the Australian Capital Territory (ACT) and 8 from Western Australia (WA) (McIlroy and King 1990). The provisional nature of this study precluded a detailed estimate of the sensitivity of these foxes to 1080. Moreover, it is also possible, and probably highly likely, that the sensitivity of Australian foxes to 1080 has changed since the assessment undertaken in the 1980s. This Forum Essay raises some of the possible reasons for any decreased baiting effectiveness, particularly the impact of any decrease in the sensitivity of foxes to 1080. The original data of McIlroy and King (1990) are reworked so as to gain estimates of the Lethal Dose 50 and Lethal Dose 99 values and their associated 95% Confidence Limits. The implications of these findings for pest management and conservation programmes, and some suggestions for future research, are also discussed.

Poore, G.C.B. (2021). Indo-West Pacific and Australian species of Eucalliacidae with descriptions of four new species (Crustacea: Axiidea). Memoirs of Museum Victoria 80: 1–41. Surveys of coral reefs and sandy shallow environments in the Indo-West Pacific and Australia have discovered 14 species of Eucalliacidae, of which four are new. All species are diagnosed, and Andamancalliax arafura sp. nov., Eucalliaxiopsis dworschaki sp. nov., Eucalliaxiopsis paradoxa sp. nov. and Eucalliaxiopsis patio sp. nov. are described as new. The collection is an opportunity to re-diagnose other species and provide colour photographs of some. Calliaxina xishaensis Liu and Liang, 2016, is synonymised with Calliaxina novaebritanniae (Borradaile, 1900).

AbstractAgriculture is the backbone of Uganda’s economy, with about 24.9% contribution to the gross domestic product (GDP) as per the Uganda National Household Survey 2016/17. Agricultural productivity (yield per hectare) is still low due to the high dependence on rain-fed subsistence farming. Climate change is expected to further reduce the yield per hectare. Therefore, this study aims to evaluate the potential impact of climate change on maize yield in the Victoria Nile Sub-basin using the AquaCrop model. It further assesses the possible adaptation measures to climate change. The Hadley Centre Global Environmental Model version 2–Earth System (HadGEM2-ES) data downloaded from the Coordinated Regional Downscaling Experiment (CORDEX) was used to simulate maize yield in the near future (2021–2040), mid future (2041–2070) and late future (2071–2099). Results show that maize yield is likely to reduce by as high as 1–10%, 2–42% and 1–39% in the near, mid and late futures, respectively, depending on the agro-ecological zone. This decline in maize yield can have a significant impact on regional food security as well as socio-economic well-being since maize is a staple crop. The study also shows that improving soil fertility has no significant impact on maize yield under climate change. However, a combined application of supplementary irrigation and shifting the planting dates is a promising strategy to maintain food security and socio-economic development. This study presents important findings and adaptation strategies that policymakers and other stakeholders such as farmers can implement to abate the effects of climate change on crop production.

People’s livelihoods in developing countries are often directly dependent on wetlands and watersheds for the provision of food, water, fuel, wood, fibre, and genetic resources. The high rural population density within the Lake Victoria basin is facilitating the rapid conversion of land to settlement and agriculture. These activities have resulted in the depletion of wetland resources to the extent that they cannot replenish naturally, thus threatening the Nyando wetland ecosystem, potential recreational opportunities, and the livelihoods of local communities. This paper, therefore, examines the implication of Nyando wetland utilisation in provisioning ecosystem services. A case study survey design approach was employed for data collection. Both quantitative and qualitative data were collected to answer the study objectives. Stratified random sampling was conducted to collect data from 391 households using a structured questionnaire. An interview guide was also used to collect data from stakeholder representatives at the national and county governmental level, non-governmental organisations, and members of the local community. Descriptive statistics were used to analyse the quantitative data, while qualitative data were analysed through content analysis by ordering distinct themes into similar categories. A land-use change analysis was performed using an unsupervised classification technique. The results show that the local community depends on the wetland for farming, firewood, settlement, roofing and mat-making materials, and fishing for domestic and commercial use. The local community’s increased demand and utilisation of Nyando wetland resources has contributed to a reduction in the size of the wetland and consequently affected the availability of ecosystem services. Thus, sustainable utilisation of the wetland is needed.

IntroductionSydney’s Garden Palace was a magnificent building with a grandeur that dominated the skyline, stretching from the site of the current State Library of New South Wales to the building that now houses the Sydney Conservatorium of Music. The Palace captivated society from its opening in 1879. This article outlines the building of one of Sydney’s early structural icons and how, despite being destroyed by fire after three short years in 1882, it had an enormous impact on the burgeoning colonial community of New South Wales, thus building a physical structure, pride and a suite of memories.Design and ConstructionIn February 1878, the Colonial Secretary’s Office announced that “it is intended to hold under the supervision of the Agricultural Society of New South Wales an international Exhibition in Sydney in August 1879” (Official Record ix). By December the same year it had become clear that the Agricultural Society lacked the resources to complete the project and control passed to the state government. Colonial Architect James Barnet was directed to prepare “plans for a building suitable for an international exhibition, proposed to be built in the Inner Domain” (Official Record xx). Within three days he had submitted a set of drawings for approval. From this point on there was a great sense of urgency to complete the building in less than 10 months for the exhibition opening the following September.The successful contractor was John Young, a highly experienced building contractor who had worked on the Crystal Palace for the 1851 London International Exhibition and locally on the General Post Office and Exhibition Building at Prince Alfred Park (Kent 6). Young was confident, procuring electric lights from London so that work could be carried out 24 hours a day, to ensure that the building was delivered on time. The structure was built, as detailed in the Colonial Record (1881), using over 1 million metres of timber, 2.5 million bricks and 220 tonnes of galvanised corrugated iron. Remarkably the building was designed as a temporary structure to house the Exhibition. At the end of the Exhibition the building was not dismantled as originally planned and was instead repurposed for government office space and served to house, among other things, records and objects of historical significance. Ultimately the provisional building materials used for the Garden Palace were more suited to a temporary structure, in contrast with those used for the more permanent structures built at the same time which are still standing today.The building was an architectural and engineering wonder set in a cathedral-like cruciform design, showcasing a stained-glass skylight in the largest dome in the southern hemisphere (64 metres high and 30 metres in diameter). The total floor space of the exhibition building was three and half hectares, and the area occupied by the Garden Palace and related buildings—including the Fine Arts Gallery, Agricultural Hall, Machinery Hall and 10 restaurants and places of refreshment—was an astounding 14 hectares (Official Record xxxvi). To put the scale of the Garden Palace into contemporary perspective it was approximately twice the size of the Queen Victoria Building that stands on Sydney’s George Street today.Several innovative features set the building apart from other Sydney structures of the day. The rainwater downpipes were enclosed in hollow columns of pine along the aisles, ventilation was provided through the floors and louvered windows (Official Record xxi) while a Whittier’s Steam Elevator enabled visitors to ascend the north tower and take in the harbour views (“Among the Machinery” 70-71). The building dominated the Sydney skyline, serving as a visual anchor point that welcomed visitors arriving in the city by boat:one of the first objects that met our view as, after 12 o’clock, we proceeded up Port Jackson, was the shell of the Exhibition Building which is so rapidly rising on the Domain, and which next September, is to dazzle the eyes of the world with its splendours. (“A ‘Bohemian’s’ Holiday Notes” 2)The DomeThe dome of the Garden Palace was directly above the intersection of the nave and transept and rested on a drum, approximately 30 metres in diameter. The drum featured 36 oval windows which flooded the space below with light. The dome was made of wood covered with corrugated galvanised iron featuring 12 large lattice ribs and 24 smaller ribs bound together with purlins of wood strengthened with iron. At the top of the dome was a lantern and stained glass skylight designed by Messrs. Lyon and Cottier. It was light blue, powdered with golden stars with wooden ribs in red, buff and gold (Notes 6). The painting and decorating of the dome commenced just one month before the exhibition was due to open. The dome was the sixth largest dome in the world at the time. During construction, contractor Mr Young allowed visitors be lifted in a cage to view the building’s progress.During the construction of the Lantern which surmounts the Dome of the Exhibition, visitors have been permitted, through the courtesy of Mr. Young, to ascend in the cage conveying materials for work. This cage is lifted by a single cable, which was constructed specially of picked Manilla hemp, for hoisting into position the heavy timbers used in the construction. The sensation whilst ascending is a most novel one, and must resemble that experienced in ballooning. To see the building sinking slowly beneath you as you successively reach the levels of the galleries, and the roofs of the transept and aisles is an experience never to be forgotten, and it seems a pity that no provision can be made for visitors, on paying a small fee, going up to the dome. (“View from the Lantern of the Dome Exhibition” 8)The ExhibitionInternational Exhibitions presented the opportunity for countries to express their national identities and demonstrate their economic and technological achievements. They allowed countries to showcase the very best examples of contemporary art, handicrafts and the latest technologies particularly in manufacturing (Pont and Proudfoot 231).The Sydney International Exhibition was the ninth International Exhibition and the colony’s first, and was responsible for bringing the world to Sydney at a time when the colony was prosperous and full of potential. The Exhibition—opening on 17 September 1879 and closing on 20 April 1880—had an enormous impact on the community, it boosted the economy and was the catalyst for improving the city’s infrastructure. It was a great source of civic pride.Image 1: The International Exhibition Sydney, 1879-1880, supplement to the Illustrated Sydney News Jan. 1880. Image credit: Mitchell Library, State Library of NSW (call no.: DL X8/3)This bird’s eye view of the Garden Palace shows how impressive the main structure was and how much of the Gardens and Domain were occupied by ancillary buildings for the Exhibition. Based on an original drawing by John Thomas Richardson, chief engraver at the Illustrated Sydney News, this lithograph features a key identifying buildings including the Art Gallery, Machinery Hall, and Agricultural Hall. Pens and sheds for livestock can also be seen. The parade ground was used throughout the Exhibition for displays of animals. The first notable display was the International Show of Sheep featuring Australian, French and English sheep; not surprisingly the shearing demonstrations proved to be particularly popular with the community.Approximately 34 countries and their colonies participated in the Exhibition, displaying the very best examples of technology, industry and art laid out in densely packed courts (Barnet n.p.). There were approximately 14,000 exhibits (Official Record c) which included displays of Bohemian glass, tapestries, fine porcelain, fabrics, pyramids of gold, metals, minerals, wood carvings, watches, ethnographic specimens, and heavy machinery. Image 2: “Meet Me under the Dome.” Illustrated Sydney News 1 Nov. 1879: 4. Official records cite that between 19,853 and 24,000 visitors attended the Exhibition on the opening day of 17 September 1879, and over 1.1 million people visited during its seven months of operation. Sizeable numbers considering the population of the colony, at the time, was just over 700,000 (New South Wales Census).The Exhibition helped to create a sense of place and community and was a popular destination for visitors. On crowded days the base of the dome became a favourite meeting place for visitors, so much so that “meet me under the dome” became a common expression in Sydney during the Exhibition (Official Record lxxxiii).Attendance was steady and continuous throughout the course of the Exhibition and, despite exceeding the predicted cost by almost four times, the Exhibition was deemed a resounding success. The Executive Commissioner Mr P.A. Jennings remarked at the closing ceremony:this great undertaking […] marks perhaps the most important epoch that has occurred in our history. In holding this exhibition we have entered into a new arena and a race of progress among the nations of the earth, and have placed ourselves in kindly competition with the most ancient States of the old and new world. (Official Record ciii)Initially the cost of admission was set at 5 shillings and later dropped to 1 shilling. Season tickets for the Exhibition were also available for £3 3s which entitled the holder to unlimited entry during all hours of general admission. Throughout the Exhibition, season ticket holders accounted for 76,278 admissions. The Exhibition boosted the economy and encouraged authorities to improve the city’s services and facilities which helped to build a sense of community as well as pride in the achievement of such a fantastic structure. A steam-powered tramway was installed to transport exhibition-goers around the city, after the Exhibition, the tramway network was expanded and by 1905–1906 the trams were converted to electric traction (Freestone 32).After the exhibition closed, the imposing Garden Palace building was used as office space and storage for various government departments.An Icon DestroyedIn the early hours of 22 September 1882 tragedy struck when the Palace was engulfed by fire (“Destruction of the Garden Palace” 7). The building – and all its contents – destroyed.Image 3: Burning of the Garden Palace from Eaglesfield, Darlinghurst, sketched at 5.55am, Sep 22/82. Image credit: Mitchell Library, State Library of NSW (call no.: SSV/137) Many accounts and illustrations of the Garden Palace fire can be found in contemporary newspapers and artworks. A rudimentary drawing by an unknown artist held by the State Library of New South Wales appears to have been created as the Palace was burning. The precise time and location is recorded on the painting, suggesting it was painted from Eaglesfield, a school on Darlinghurst Road. It purveys a sense of immediacy giving some insight into the chaos and heat of the tragedy. A French artist living in Sydney, Lucien Henry, was among those who attempted to capture the fire. His assistant, G.H. Aurousseau, described the event in the Technical Gazette in 1912:Mister Henry went out onto the balcony and watched until the Great Dome toppled in; it was then early morning; he went back to his studio procured a canvas, sat down and painted the whole scene in a most realistic manner, showing the fig trees in the Domain, the flames rising through the towers, the dome falling in and the reflected light of the flames all around. (Technical Gazette 33-35)The painting Henry produced is not the watercolour held by the State Library of New South Wales, however it is interesting to see how people were moved to document the destruction of such an iconic building in the city’s history.What Was Destroyed?The NSW Legislative Assembly debate of 26 September 1882, together with newspapers of the day, documented what was lost in the fire. The Garden Palace housed the foundation collection of the Technological and Sanitary Museum (the precursor to the Powerhouse Museum, now the Museum of Applied Arts and Sciences), due to open on 1 December 1882. This collection included significant ethnological specimens such as Australian Indigenous artefacts, many of which were acquired from the Sydney International Exhibition. The Art Society of New South Wales had hung 300 paintings in preparation for their annual art exhibition due to open on 2 October of that year, all of these paintings consumed by fire.The Records of the Crown Lands Occupation Office were lost along with the 1881 Census (though the summary survived). Numerous railway surveys were lost, as were: £7,000 worth of statues, between 20,000 and 30,000 plants and the holdings of the Linnean Society offices and museum housed on the ground floor. The Eastern Suburbs Brass Band performed the day before at the opening of the Eastern Suburbs Horticultural Society Flower show; all the instruments were stored in the Garden Palace and were destroyed. Several Government Departments also lost significant records, including the: Fisheries Office; Mining Department; Harbour and Rivers Department; and, as mentioned, the Census Department.The fire was so ferocious that the windows in the terraces along Macquarie Street cracked with the heat and sheets of corrugated iron were blown as far away as Elizabeth Bay. How Did The Fire Start?No one knows how the fire started on that fateful September morning, and despite an official enquiry no explanation was ever delivered. One theory blamed the wealthy residents of Macquarie Street, disgruntled at losing their harbour views. Another was that it was burnt to destroy records stored in the basement of the building that contained embarrassing details about the convict heritage of many distinguished families. Margaret Lyon, daughter of the Garden Palace decorator John Lyon, wrote in her diary:a gentleman who says a boy told him when he was putting out the domain lights, that he saw a man jump out of the window and immediately after observed smoke, they are advertising for the boy […]. Everyone seems to agree on his point that it has been done on purpose – Today a safe has been found with diamonds, sapphires and emeralds, there were also some papers in it but they were considerably charred. The statue of her majesty or at least what remains of it, for it is completely ruined – the census papers were also ruined, they were ready almost to be sent to the printers, the work of 30 men for 14 months. Valuable government documents, railway and other plans all gone. (MLMSS 1381/Box 1/Item 2) There are many eyewitness accounts of the fire that day. From nightwatchman Mr Frederick Kirchen and his replacement Mr John McKnight, to an emotional description by 14-year-old student Ethel Pockley. Although there were conflicting accounts as to where the fire may have started, it seems likely that the fire started in the basement with flames rising around the statue of Queen Victoria, situated directly under the dome. The coroner did not make a conclusive finding on the cause of the fire but was scathing of the lack of diligence by the authorities in housing such important items in a building that was not well-secured a was a potential fire hazard.Building a ReputationA number of safes were known to have been in the building storing valuables and records. One such safe, a fireproof safe manufactured by Milner and Son of Liverpool, was in the southern corner of the building near the southern tower. The contents of this safe were unscathed in contrast with the contents of other safes, the contents of which were destroyed. The Milner safe was a little discoloured and blistered on the outside but otherwise intact. “The contents included three ledgers, or journals, a few memoranda and a plan of the exhibition”—the glue was slightly melted—the plan was a little discoloured and a few loose papers were a little charred but overall the contents were “sound and unhurt”—what better advertising could one ask for! (“The Garden Palace Fire” 5).barrangal dyara (skin and bones): Rebuilding CommunityThe positive developments for Sydney and the colony that stemmed from the building and its exhibition, such as public transport and community spirit, grew and took new forms. Yet, in the years since 1882 the memory of the Garden Palace and its disaster faded from the consciousness of the Sydney community. The great loss felt by Indigenous communities went unresolved.Image 4: barrangal dyara (skin and bones). Image credit: Sarah Morley.In September 2016 artist Jonathan Jones presented barrangal dyara (skin and bones), a large scale sculptural installation on the site of the Garden Palace Building in Sydney’s Royal Botanic Garden. The installation was Jones’s response to the immense loss felt throughout Australia with the destruction of countless Aboriginal objects in the fire. The installation featured thousands of bleached white shields made of gypsum that were laid out to show the footprint of the Garden Palace and represent the rubble left after the fire.Based on four typical designs from Aboriginal nations of the south-east, these shields not only raise the chalky bones of the building, but speak to the thousands of shields that would have had cultural presence in this landscape over generations. (Pike 33)ConclusionSydney’s Garden Palace was a stunning addition to the skyline of colonial Sydney. A massive undertaking, the Palace opened, to great acclaim, in 1879 and its effect on the community of Sydney and indeed the colony of New South Wales was sizeable. There were brief discussions, just after the fire, about rebuilding this great structure in a more permanent fashion for the centenary Exhibition in 1888 (“[From Our Own Correspondents] New South Wales” 5). Ultimately, it was decided that this achievement of the colony of New South Wales would be recorded in history, gifting a legacy of national pride and positivity on the one hand, but on the other an example of the destructive colonial impact on Indigenous communities. For many Sydney-siders today this history is as obscured as the original foundations of the physical building. What we build—iconic structures, civic pride, a sense of community—require maintenance and remembering. References“Among the Machinery.” The Sydney Mail and New South Wales Advertiser 10 Jan. 1880: 70-71.Aurousseau, G.H. “Lucien Henry: First Lecturer in Art at the Sydney Technical College.” Technical Gazette 2.III (1912): 33-35.Barnet, James. International Exhibition, Sydney, 1880: References to the Plans Showing the Space and Position Occupied by the Various Exhibits in the Garden Palace. Sydney: Colonial Architect’s Office, 1880.“A ‘Bohemian’s’ Holiday Notes.” The Singleton Argus and Upper Hunter General Advocate 23 Apr. 1879: 2.Census Department. New South Wales Census. 1881. 3 Mar. 2017 <http://hccda.ada.edu.au/pages/NSW-1881-census-02_vi>. “Destruction of the Garden Palace.” Sydney Morning Herald 23 Sep. 1882: 7.Freestone, Robert. “Space Society and Urban Reform.” Colonial City, Global City, Sydney’s International Exhibition 1879. Eds. Peter Proudfoot, Roslyn Maguire, and Robert Freestone. Darlinghurst, NSW: Crossing P, 2000. 15-33.“[From Our Own Correspondents] New South Wales.” The Age (Melbourne, Vic.) 30 Sep. 1882: 5.“The Garden Palace Fire.” Sydney Morning Herald 25 Sep. 1882: 5.Illustrated Sydney News and New South Wales Agriculturalist and Grazier 1 Nov. 1879: 4.“International Exhibition.” Australian Town and Country Journal 15 Feb. 1879: 11.Kent, H.C. “Reminiscences of Building Methods in the Seventies under John Young. Lecture.” Architecture: An Australian Magazine of Architecture and the Arts Nov. (1924): 5-13.Lyon, Margaret. Unpublished Manuscript Diary. MLMSS 1381/Box 1/Item 2.New South Wales, Legislative Assembly. Debates 22 Sep. 1882: 542-56.Notes on the Sydney International Exhibition of 1879. Melbourne: Government Printer, 1881.Official Record of the Sydney International Exhibition 1879. Sydney: Government Printer, 1881.Pike, Emma. “barrangal dyara (skin and bones).” Jonathan Jones: barrangal dyara (skin and bones). Eds. Ross Gibson, Jonathan Jones, and Genevieve O’Callaghan. Balmain: Kaldor Public Arts Project, 2016.Pont, Graham, and Peter Proudfoot. “The Technological Movement and the Garden Palace.” Colonial City, Global City, Sydney’s International Exhibition 1879. Eds. Peter Proudfoot, Roslyn Maguire, and Robert Freestone. Darlinghurst, NSW: Crossing Press, 2000. 239-249.“View from the Lantern of the Dome of the Exhibition.” Illustrated Sydney News and New South Wales Agriculturalist and Grazier 9 Aug. 1879: 8.