Academic literature on the topic 'Agricultural surveys Victoria'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Contents
Consult the lists of relevant articles, books, theses, conference reports, and other scholarly sources on the topic 'Agricultural surveys Victoria.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Journal articles on the topic "Agricultural surveys Victoria"
1
Price, TV, and BL Williams. "Studies of the severity and incidence of Paspalum leaf blight." Australian Journal of Agricultural Research 41, no. 2 (1990): 377. http://dx.doi.org/10.1071/ar9900377.
Full textAbstract:
Levels of paspalum leaf blight (Ascochyta paspali) severity (%LAD), diseased dry matter (%DDM) and incidence on tillers and leaves on dairy pastures in northern Victoria assessed during the summer months (November-March) of 1983-84, 1984-85, 1985-86 and 1986-87 fluctuated between samplings and farms. Infected tissues accounted for 19-22% of the total dry matter in 1983-84 and 1984-85. Disease severity (%LAD) was significantly (P<0.001) linearly related to incidence of infected tillers (IT) or leaves (IL) and highest correlations were obtained following natural logarithmic transformations of severity and incidence data. Incidence of infected tillers on a 1 ha site in Northern Victoria ranged over 7- 19% in 1985-86 when samples were taken along a M-transect and 1.75-30% in 1986-87 when stratified random samples were taken using a microcomputer-based program 'Field Runner'. The latter reduced sampling bias, indicated that the distribution of disease was aggregated and a minimum sample size of 450 tillers was required. The fluctuating incidence levels with time were correlated with sampling intervals following grazing. Incidence of infected tillers on 11 farms in northern Victoria and Finley, N.S.W., in January 1987, ranged from 11.8 to 56.4%. The significance of the severity-incidence relationships, the aggregated distribution of paspalum leaf blight, variation in levels between farms, the effects of grazing on epidemics of paspalum leaf blight and crop loss and the use of 'Field Runner' in disease surveys is discussed.
2
Johnson, Matthew, Paul Reich, and Ralph Mac Nally. "Bird assemblages of a fragmented agricultural landscape and the relative importance of vegetation structure and landscape pattern." Wildlife Research 34, no. 3 (2007): 185. http://dx.doi.org/10.1071/wr06103.
Full textAbstract:
Many of the world’s agricultural areas have greatly reduced levels of natural vegetation. This results in highly fragmented mosaic landscapes with multiple land-use types. We examined the importance of vegetation and landscape pattern by comparing the bird assemblages of riparian zones, non-riparian forest patches, and pasture in a fragmented agricultural landscape in south-eastern Australia. Bird surveys were conducted every four weeks at 27 sites in the Goldfields region of central Victoria for one year. The landscape context (position and shape of patches) and vegetation attributes were measured for each site. We found that bird assemblages strongly differed among these landscape elements. Mean abundance was significantly greater at forested patches, and there was a three-fold reduction in species richness at pasture sites. Bird assemblage structure was influenced substantially more by vegetation than by the landscape context of sites. Our results indicate that riparian vegetation is a key element for avian diversity, even in massively altered landscapes. The restoration of riparian vegetation and its connectivity with adjacent forest types would greatly benefit bird assemblages in agricultural areas.
3
Di Leo, A., and M. Tallini. "Irrigation, groundwater exploitation and cult of water in the rural settlements of Sabina, Central Italy, in Roman times." Water Supply 7, no. 1 (March 1, 2007): 191–99. http://dx.doi.org/10.2166/ws.2007.022.
Full textAbstract:
Archaeological surveys conducted in Sabina, about 50 km away from Rome, intended to reconstruct the ancient agricultural and pastoral landscape. They identified interesting remains of roman small family farms at Montenero Sabino and Mompeo (province of Rieti), villages located near Via Salaria (the “salt way”) and the Farfa stream, a tributary of the Tiber River, which in ancient times, both were the main trade routes of central Italy, linking Rome to the Apennines and to the Adriatic coast. There a network of underground channels and tanks, fictile water pipes and pools, at times connected to one another, was found. Many of them are still used today, given the low population growth and the lack of modern industrial development of this area and to its isolation, in spite of its proximity to Rome. Moreover the study area holds a votive stone dedicated to the Sabine-Roman goddess of water Vacuna, a multiform Sabine and Central-Italic goddess with many characteristics and functions, known also as Minerva-Bellona-Victoria, Feronia, Caerere, or as Angerona-Angitia. It was related to an agricultural-pastoral shrine for the cult of water whose anthropological relevance still survives in yearly livestock fairs and in the local worship of the Holy Mary of parturients.
4
Mcdonald, G., TR New, and RA Farrow. "Geographical and Temporal Distribution of the Common Armyworm, Mythimna Convecta (Lepidoptera: Noctuidae), in Eastern Australia: Larval Habitats and Outbreaks." Australian Journal of Zoology 43, no. 6 (1995): 601. http://dx.doi.org/10.1071/zo9950601.
Full textAbstract:
Surveys for juvenile Mythimna convecta throughout the agricultural and arid regions of eastern Australia were conducted from 1986 to 1989. Armyworm populations north of 33 degrees S were generally dominated by M. convecta, and further south by Persectania ewingii. M. convecta was most widely distributed in spring. Incidence during autumn and winter ranged from very low in Victoria to high in northern New South Wales and southern Queensland. Summer infestations were found mostly on the south-east coast where favourable habitats were abundant. Colonised habitats included extremely arid regions, where small numbers of larvae were associated with grasses in temporary watercourses, and the higher-rainfall, eastern regions. The largest infestations occurred in south-east Queensland and north central and north-east New South Wales, particularly after heavy autumn rains. There appeared to be two generations of M. convecta over the autumn/winter period: the first a synchronised event starting on the autumn rains and the second commencing in June/July and comprising a wide spread in age distribution. The progeny of the winter generation are probably the source of most economic outbreaks. Mythimna convecta larvae were collected from subtropical and temperate grasses. In the former, most larvae were found in tussocks, particularly of Dichanthium sericeum and Chloris truncata, which provided a dense, fine-leaf crown and canopy. After good autumn rainfall and vegetative growth, the wiry-stemmed tussocks, including Astrebla spp. and C. ciliaris, were also common hosts. The temperate grasses, particularly Avena fatua and Hordeum leporinum, were the main winter hosts although the greatest densities were found only in thick swards of growth, particularly those that contained dried grass. Two of the largest surveys, in autumn 1987 and 1988, followed periods of heavy rain and provided strongly contrasting results. The 1987 survey of central and south-west Queensland located no M. convecta larvae, indicating that densities were below detection thresholds. The paucity of larvae was attributed to lack of suitable atmospheric conditions to assist moth immigrations and absence of adequate populations in potential source areas. The 1988 survey revealed a major outbreak of M. convecta larvae in south-east Queensland and northern New South Wales. The area received record rains during early April of that year, and the outbreak probably arose from moth migrations from the east and south-east coast. An outbreak of similar scale occurred after further heavy autumn rains in 1989.
5
Martin-Albarracin, Valeria L., Martin A. Nuñez, and Guillermo C. Amico. "Replacement of native by non-native animal communities assisted by human introduction and management on Isla Victoria, Nahuel Huapi National Park." PeerJ 3 (October 20, 2015): e1328. http://dx.doi.org/10.7717/peerj.1328.
Full textAbstract:
One of the possible consequences of biological invasions is the decrease of native species abundances or their replacement by non-native species. In Andean Patagonia, southern Argentina and Chile, many non-native animals have been introduced and are currently spreading. On Isla Victoria, Nahuel Huapi National Park, many non-native vertebrates were introduced ca. 1937. Records indicate that several native vertebrates were present before these species were introduced. We hypothesize that seven decades after the introduction of non-native species and without appropriate management to maintain native diversity, non-native vertebrates have displaced native species (given the known invasiveness and impacts of some of the introduced species). We conducted direct censuses in linear transects 500 m long (n= 10) in parallel with camera-trapping (1,253 camera-days) surveys in two regions of the island with different levels of disturbance: high (n= 4) and low (n= 6) to study the community of terrestrial mammals and birds and the relative abundances of native and non-native species. Results show that currently non-native species are dominant across all environments; 60.4% of census records and 99.7% of camera trapping records are of non-native animals. We detected no native large mammals; the assemblage of large vertebrates consisted of five non-native mammals and one non-native bird. Native species detected were one small mammal and one small bird. Species with the highest trapping rate were red and fallow deer, wild boar, silver pheasant (all four species are non-native) and chucao (a native bird). These results suggest that native species are being displaced by non-natives and are currently in very low numbers.
6
BHASKAR, HASEENA, S. MELVIN MOHAN, and M. SREESHA. "Establishment and spread of the invasive mite, Tetranychus gloveri Banks (Prostigmata: Tetranychidae) in Kerala, India." Zoosymposia 22 (November 30, 2022): 164. http://dx.doi.org/10.11646/zoosymposia.22.1.107.
Full textAbstract:
Tetranychus gloveri Banks was first recorded as Tetranychus okinawanus Ehara in India on an ornamental plant, Adenium obesum from Thrissur district, Kerala state, during 2016 (Zeity et al. 2016). Recently, Sharkey et al. (2022) synonymized T. okinawanus with T. gloveri based on morphological and molecular data. In Kerala, T. gloveri has emerged as a predominant species of mite infesting major agricultural and horticultural crops in the district (Arunima et al. 2018). In order to investigate the distribution and host range of the mite species in Kerala, periodical surveys were conducted in different agricultural ecosystems across the state during March 2020 to June 2022. Spider mite infested samples were collected from fruit crops, vegetables, ornamental plants, medicinal plants and other non-crop plants from different localities, kept in polythene bags. The GPS data of the locality and host plants were recorded. In the laboratory, a single gravid female from each sample was used to establish isoline culture providing unique accession number. Male and female specimens from each isoline culture were slide mounted on Hoyer’s medium and morphological characterization of the slide mounted mite specimens were carried to establish the species identity. Characters such as chaetotaxy of hysterosoma and legs, structure of empodium and pattern of dorsal striae between e1 and f1 of female were used for genus level identification, while the shape of male genitalia, aedeagus, was used for species level identification. In this study, T. gloveri was recorded from a wide host range of 35 host plants in 24 plant families viz., Malvaceae, Cucurbitaceae, Fabaceae, Amaranthaceae, Rutaceae, Solanaceae, Musaceae, Moraceae, Anacardiaceae, Caricaceae, Adoxaceae, Rosaceae, Compositae, Gentianaceae, Convolvulaceae, Balsaminaceae, Orchidaceae, Asparagaceae, Goodeniaceae, Apocyanaceae, Euphorbiaceae, Oxalidaceae, Lamiaceae and Pontederiaceae. The mite species was distributed in seven districts covering northern, central and southern regions viz., Wayanad, Malappuram, Thrissur, Palakkad, Ernakulam, Alappuzha and Thiruvananthapuram districts of Kerala. Curry leaf, country kreat (Exacum bicolor), sunflower, Victoria corn plant (Dracaena sp.), Calotropis gigantea, little tree plant (Biophytum sensitivum), holy basil (Ocimum sanctum) and the aquatic pickerel weed (Monochoria vaginalis) are new host records for T. gloveri. The study confirms that the mite species has established and spread across Kerala by widening its host range and expanding its geographical area of distribution, within a short span after its introduction into the state.
7
Norton, Briony A., Linda J. Thomson, and Michael A. Nash. "Ophyiulus in Victoria: results of millipede surveys from south-eastern Australia." Proceedings of the Royal Society of Victoria 127, no. 2 (2015): 69. http://dx.doi.org/10.1071/rs15019.
Full textAbstract:
The composition and ecology of the millipede fauna of Victoria remain poorly understood. We collected millipedes as part of a series of ecological arthropod surveys across south-eastern Australia, focusing mainly on Victoria. These samples almost exclusively contained millipedes from the introduced order Julida. We pursued species identification of the julids when it became apparent there were species other than the well-recorded Ommatoiulus moreleti (Lucas, 1860) (Portuguese millipede) in the samples. The majority of specimens were O. moreleti, but we also detected at least one species of Cylindroiulus Verhoeff, 1894, as well as an Ophyiulus Berlese, 1884, species, specimens of which have been identified as Ophyiulus cf. targionii. These are the first Ophyiulus records for Victoria to our knowledge. We present preliminary data on the abundance through the year of Ophyiulus. This is the first study to examine this species in Victoria and little is currently known about its likely impact on agriculture or on native species. Monitoring and research of the species in the future is therefore warranted.
8
Roos, Nanna, Md Abdul Wahab, Mostafa Ali Reza Hossain, and Shakuntala Haraksingh Thilsted. "Linking Human Nutrition and Fisheries: Incorporating Micronutrient-Dense, Small Indigenous Fish Species in Carp Polyculture Production in Bangladesh." Food and Nutrition Bulletin 28, no. 2_suppl2 (June 2007): S280—S293. http://dx.doi.org/10.1177/15648265070282s207.
Full textAbstract:
Background Fish and fisheries are important for the livelihoods, food, and income of the rural population in Bangladesh. Increased rice production and changing agricultural patterns have resulted in a large decline in inland fisheries. Implementation of carp pond polyculture has been very successful, whereas little focus has been given to the commonly consumed small indigenous fish species, some of which are rich in vitamin A and minerals, such as calcium, iron, and zinc, and are an integral part of the rural diet. Objective The overall objective of the research and capacity-building activities described in this paper is to increase the production, accessibility, and intake of nutrient-dense small indigenous fish species, in particular mola ( Amblypharyngodon mola), in order to combat micronutrient deficiencies. The large contribution from small indigenous fish species to recommended intakes of vitamin A and calcium and the perception that mola is good for or protects the eyes have been well documented. Methods An integrated approach was conducted jointly by Bangladeshi and Danish institutions, linking human nutrition and fisheries. Activities included food-consumption surveys, laboratory analyses of commonly consumed fish species, production trials of carp–mola pond polyculture, teaching, training, and dissemination of the results. Results No decline in carp production and thus in income was found with the inclusion of mola, and increased intake of mola has the potential to combat micronutrient deficiencies. Teaching and training of graduates and field staff have led to increased awareness of the role of small indigenous fish species for good nutrition and resulted in the promotion of carp–mola pond polyculture and research in small indigenous fish species. The decline in accessibility, increase in price, and decrease in intake of small indigenous fish species by the rural poor, as well as the increased intake of silver carp ( Hypophthalmichthys molitrix), the most commonly cultured fish species, which is poor in micronutrients and not preferred for consumption, are being addressed, and some measures taken by inland fisheries management have been discussed. Conclusions The successful linking of human nutrition and fisheries to address micronutrient deficiencies has relevance for other countries with rich fisheries resources, such as Cambodia and countries in the Lake Victoria region of Africa.
9
Rodoni, BC, G. Hepworth, C. Richardson, and JR Moran. "The use of a sequential batch testing procedure and ELISA to determine the incidence of five viruses in Victorian cut-flower Sim carnations." Australian Journal of Agricultural Research 45, no. 1 (1994): 223. http://dx.doi.org/10.1071/ar9940223.
Full textAbstract:
A sequential batch testing procedure was used in conjunction with ELISA to estimate levels of virus incidence in Victorian cut-flower 'Sim' carnations. The industry was surveyed for five viruses, namely; carnation mottle virus (CarMV), carnation etched ring virus (CERV), carnation vein mottle virus (CarVMV), carnation latent virus (CarLV) and carnation ringspot virus (CarRSV). CarMV was the most prevalent virus (9.9%), and lower levels of CERV (0 2%), CarVMV (0.1%) and CarLV (0.1%) were detected. CarRSV was not detected in any of the samples tested. Levels of CarMV were lower than in a previous survey in 1985, suggesting that the Plant Improvement Program which has been in operation in Victoria has been instrumental in reducing the incidence of this virus. Growers who purchased cuttings from specialist propagators had lower levels of virus than propagators who implemented little or no quality control. Growers who introduced pathogen-tested cuttings at regular intervals also had lower levels of virus infection.
10
Hubert, J. G., A. Pinel-Galzi, D. Dibwe, E. Cinyabuguma, A. Kaboré, D. Fargette, D. Silué, E. Hébrard, and Y. Séré. "First Report of Rice yellow mottle virus on Rice in the Democratic Republic of Congo." Plant Disease 97, no. 12 (December 2013): 1664. http://dx.doi.org/10.1094/pdis-06-13-0650-pdn.
Full textAbstract:
Rice yellow mottle virus (RYMV), genus Sobemovirus, is a widespread rice pathogen reported in nearly all rice-growing countries of Africa. Although the virus was detected in Cameroon, Chad, Tanzania, Rwanda, Burundi, and Uganda (2,3), RYMV has never been described in the Democratic Republic of Congo (DRC). In July 2012, plants with leaf yellowing and mottling symptoms were observed in large irrigated rice production schemes 30 km south of Bukavu, in eastern DRC, and in lowland subsistence fields in the surroundings of Bukavu. Several dozen hectares affected by the disease were abandoned by the farmers. Symptomatic leaf samples were collected in different farmer fields. Back-inoculations to susceptible rice variety IR64 resulted in the same yellowing and mottling symptoms 7 to 9 days post-inoculation. Infected leaves gave positive results using double antibody sandwich (DAS)-ELISA tests with polyclonal antisera (as described in [1]), indicating for the first time the presence of RYMV in DRC. Triple antibody sandwich (TAS)-ELISA tests with discriminant monoclonal antibodies (1) revealed that they all belong to serotype 4 found in the neighboring region in Rwanda. Total RNA of three samples from South Kivu was extracted with the RNeasy Plant Mini kit (Qiagen, Germany). The 720 nucleotide coat protein (CP) gene was amplified by reverse transcription (RT)-PCR with primers 5′CTCCCCCACCCATCCCGAGAATT3′ and 5′CAAAGATGGCCAGGAA3′ (1). The sequences were deposited in GenBank (Accessions KC788208, KC788209, and KC788210). A set of CP sequences of 45 isolates representative of the RYMV diversity in Africa, including the sequences of the DRC samples, were used for phylogenetic reconstruction by maximum-likelihood method. The isolates from South Kivu belonged to strain S4-lv, mainly found around Lake Victoria. Specifically, within the S4-lv strain, the South Kivu isolates clustered with isolates from eastern and southern provinces of Rwanda and Burundi, respectively (2), suggesting a recent spread from these countries. Recently, efforts have been directed to shift from the traditional upland system to lowland and irrigated systems in which water availability allows sequential planting and maintenance of higher crop intensity. This agricultural change may increase insect vectors and alternate host plant populations which may result in higher RYMV incidence in DRC (3). Similar yellowing and mottling symptoms have been observed in Bas-Congo and Equateur provinces of the country, which would justify further surveys and characterisation of RYMV in the DRC. References: (1) D. Fargette et al. Arch. Virol. 147:583, 2002. (2) I. Ndikumana et al. Plant Dis. 96:1230, 2012. (3) O. Traoré et al. Mol. Ecol. 14:2097, 2005.
Book chapters on the topic "Agricultural surveys Victoria"
1
Peach, Ceri. "Empire, the Economy, and Immigration Britain 1850–2000." In The Peopling of Britain. Oxford University Press, 2002. http://dx.doi.org/10.1093/oso/9780198297598.003.0014.
Full textAbstract:
To survey the changes in British population between 1850 and 2000 requires some large-scale generalizations. At the beginning of my period, Britain had an empire that held a quarter of the world’s population, but by the end of the period Britain had become part of the European Union and contained one-sixth of the Union’s population. For the first hundred years of the period, Britain was exporting its population to the empire; for the last fifty years, the empire had struck back. The last 150 years have seen huge transformations of the British economy. There has been a shift from agriculture to industry and from industry to services. Coal production rose from 50 million tons in the middle of the nineteenth century to 300 million tons in 1913. By 1999 it had returned to below its 1851 level. Mining scarred the landscape of all the coalfields. Oil production rose from none in 1970 to about 128 million tonnes in 1997, but left hardly a mark on settlement. The steel industry rose and fell. In 1860 there was no crude steel produced (Mitchell 1975: 399). By 1960 25 million tons were produced and now it is down to about half that level. The United Kingdom has undergone the demographic transition. The population rose from 10 million in 1801 to 38 million in 1901 to 59 million now. Six million more people have left the United Kingdom than have entered it since 1851. A tide, from the beginning of the twentieth century, has swept the rural population into the biggest cities until the post-1950 backwash has scattered it out to suburbia, exurbia, and market towns. Urbanization has been followed by suburbanization; suburbanization by counter-urbanization. The Fordist system of mass production produced the Fordist city of mass-produced housing design, the Victorian, terraced inner city. The post-Fordist era hollowed out the inner cities and produced the green belts, the new towns, and the scatter of light industry. The new international division of labour squeezed the manufacturing employment of the country out to the third world.
Reports on the topic "Agricultural surveys Victoria"
1
Donati, Kelly, and Nick Rose. Growing Edible Cities and Towns: A Survey of the Victorian Urban Agriculture Sector. Sustain: The Australian Food Network, October 2022. http://dx.doi.org/10.57128/miud6079.
Full textAbstract:
This report presents findings from a survey of urban agriculture practitioners in greater Melbourne (including green wedge areas), Bendigo, Ballarat and Geelong. The findings provide baseline data regarding the composition, activities, market channels, challenges, needs and aspirations of the urban agriculture sector, as well as opportunities for its support and growth. The report also proposes a roadmap for addressing critical challenges that face the sector and for building on the strength of its social and environmental commitments, informed by the survey findings and relevant academic literature on urban agriculture. This report’s findings and recommendations are of relevance to policymakers at all levels of government, especially as food security, climate change, human and ecological health and urban sustainability emerge as key interconnected priorities in this challenging decade.