To see the other types of publications on this topic, follow the link: Abc-F.

Journal articles on the topic 'Abc-F'

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the top 50 journal articles for your research on the topic 'Abc-F.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.

1

ZHAO, Li-Xia, Cheng-Ji ZHOU, Arowu TANAKA, Masanori NAKATA, Takahiro HIRABAYASHI, Teruo AMACHI, Seiji SHIODA, Kazumitsu UEDA, and Nobuya INAGAKI. "Cloning, characterization and tissue distribution of the rat ATP-binding cassette (ABC) transporter ABC2/ABCA2." Biochemical Journal 350, no. 3 (September 8, 2000): 865–72. http://dx.doi.org/10.1042/bj3500865.

Full text
Abstract:
The ABC1 (ABCA) subfamily of the ATP-binding cassette (ABC) transporter superfamily has a structural feature that distinguishes it from other ABC transporters. Here we report the cloning, molecular characterization and tissue distribution of ABC2/ABCA2, which belongs to the ABC1 subfamily. Rat ABC2 is a protein of 2434 amino acids that has 44.5%, 40.0% and 40.8% identity with mouse ABC1/ABCA1, human ABC3/ABCA3 and human ABCR/ABCA4 respectively. Immunoblot analysis showed that proteins of 260 and 250kDa were detected in COS-1 cells transfected with ABC2 having a haemagglutinin tag, while no band was detected in mock-transfected cells. After incubation with N-glycosidase F, the mobilities of the two proteins increased and a single band was detected, suggesting that ABC2 is a glycoprotein. Photoaffinity labelling with 8-azido-[α-32P]ATP confirmed that ATP binds to the ABC2 protein in the presence of Mg2+. RNA blot analysis showed that ABC2 mRNA is most abundant in rat brain. Examination of brain by in situ hybridization determined that ABC2 is expressed at high levels in the white matter, indicating that it is expressed in the oligodendrocytes. ABC2, therefore, is a glycosylated ABC transporter protein, and may play an especially important role in the brain. In addition, the N-terminal 60-amino-acid sequence of the human ABC1, which was missing from previous reports, has been determined.
APA, Harvard, Vancouver, ISO, and other styles
2

Kumar, Vikas, Shilpi Garg, Lalita Gupta, Kuldeep Gupta, Cheikh Tidiane Diagne, Dorothée Missé, Julien Pompon, Sanjeev Kumar, and Vishal Saxena. "Delineating the Role of Aedes aegypti ABC Transporter Gene Family during Mosquito Development and Arboviral Infection via Transcriptome Analyses." Pathogens 10, no. 9 (September 2, 2021): 1127. http://dx.doi.org/10.3390/pathogens10091127.

Full text
Abstract:
Aedes aegypti acts as a vector for several arboviral diseases that impose a major socio-economic burden. Moreover, the absence of a vaccine against these diseases and drug resistance in mosquitoes necessitates the development of new control strategies for vector-borne diseases. ABC transporters that play a vital role in immunity and other cellular processes in different organisms may act as non-canonical immune molecules against arboviruses, however, their role in mosquito immunity remains unexplored. This study comprehensively analyzed various genetic features of putative ABC transporters and classified them into A-H subfamilies based on their evolutionary relationships. Existing RNA-sequencing data analysis indicated higher expression of cytosolic ABC transporter genes (E & F Subfamily) throughout the mosquito development, while members of other subfamilies exhibited tissue and time-specific expression. Furthermore, comparative gene expression analysis from the microarray dataset of mosquito infected with dengue, yellow fever and West Nile viruses revealed 31 commonly expressed ABC transporters suggesting a potentially conserved transcriptomic signature of arboviral infection. Among these, only a few transporters of ABCA, ABCC and ABCF subfamily were upregulated, while most were downregulated. This indicates the possible involvement of ABC transporters in mosquito immunity.
APA, Harvard, Vancouver, ISO, and other styles
3

Du Toit, Andrea. "ABC-F proteins protect bacterial ribosomes." Nature Reviews Microbiology 14, no. 5 (April 12, 2016): 267. http://dx.doi.org/10.1038/nrmicro.2016.54.

Full text
APA, Harvard, Vancouver, ISO, and other styles
4

Kersley, Susan E. "ABC of change: D, E, F." BMJ 328, no. 7438 (February 28, 2004): s87.1—s87. http://dx.doi.org/10.1136/bmj.328.7438.s87.

Full text
APA, Harvard, Vancouver, ISO, and other styles
5

Dubey, Mukesh K., Dan Funck Jensen, and Magnus Karlsson. "An ATP-Binding Cassette Pleiotropic Drug Transporter Protein Is Required for Xenobiotic Tolerance and Antagonism in the Fungal Biocontrol Agent Clonostachys rosea." Molecular Plant-Microbe Interactions® 27, no. 7 (July 2014): 725–32. http://dx.doi.org/10.1094/mpmi-12-13-0365-r.

Full text
Abstract:
ATP-binding cassette (ABC) transporters mediate active efflux of natural and synthetic toxicants and are considered to be important for drug tolerance in microorganisms. In biological control agents (BCA), ABC transporters can play important roles in antagonism by providing protection against toxins derived from the fungal prey and by mediating the secretion of endogenous toxins. In the present study, we generated deletion and complementation strains of the ABC transporter abcG5 in the fungal BCA Clonostachys rosea to study its role in xenobiotic tolerance and antagonism. Gene expression analysis shows induced expression of abcG5 in the presence of the Fusarium mycotoxin zearalenone (ZEA), secreted metabolites of F. graminearum, and different classes of fungicides. Phenotypic analysis of abcG5 deletion and complementation strains showed that the deletion strains were more sensitive towards F. graminearum culture filtrates, ZEA, and iprodione- and mefenoxam-based fungicides, thus suggesting the involvement of abcG5 in cell protection. The ΔabcG5 strains displayed reduced antagonism towards F. graminearum in a plate confrontation assay. Furthermore, the ΔabcG5 strains failed to protect barley seedlings from F. graminearium foot rot disease. These data show that the abcG5 ABC transporter is important for xenobiotic tolerance and biocontrol traits in C. rosea.
APA, Harvard, Vancouver, ISO, and other styles
6

Kim, Seon Hwa, and Vladimir Vujanovic. "ATP-Binding Cassette (ABC) Transporters in Fusarium Specific Mycoparasite Sphaerodes mycoparasitica during Biotrophic Mycoparasitism." Applied Sciences 12, no. 15 (July 29, 2022): 7641. http://dx.doi.org/10.3390/app12157641.

Full text
Abstract:
Recent transcriptomic profiling has revealed importance membrane transporters such as ATP-binding cassette (ABC) transporters in fungal necrotrophic mycoparasites. In this study, RNA-Seq allowed rapid detection of ABC transcripts involved in biotrophic mycoparasitism of Sphaerodes mycoparasitica against the phytopathogenic and mycotoxigenic Fusarium graminearum host, the causal agent of Fusarium head blight (FHB). Transcriptomic analyses of highly expressed S. mycoparasitica genes, and their phylogenetic relationships with other eukaryotic fungi, portrayed the ABC transporters’ evolutionary paths towards biotrophic mycoparasitism. Prior to the in silico phylogenetic analyses, transmission electron microscopy (TEM) was used to confirm the formation of appressorium/haustorium infection structures in S. mycoparasitica during early (1.5 d and 3.5 d) stages of mycoparasitism. Transcripts encoding biotrophy-associated secreted proteins did uncover the enrolment of ABC transporter genes in this specific biocontrol mode of action, while tandem ABC and BUB2 (non-ABC) transcripts seemed to be proper for appressorium development. The next-generation HiSeq transcriptomic profiling of the mycoparasitic hypha samples, revealed 81 transcripts annotated to ABC transporters consisting of a variety of ABC-B (14%), ABC-C (22%), and ABC-G (23%), and to ABC-A, ABC-F, aliphatic sulfonates importer (TC 3.A.1.17.2), BtuF, ribose importer (TC 3.A.1.2.1), and unknown families. The most abundant transcripts belonged to the multidrug resistance exporter (TC 3.A.1.201) subfamily of the ABC-B family, the conjugate transporter (TC 3.A.1.208) subfamily of the ABC-C family, and the pleiotropic drug resistance (PDR) (TC 3.A.1.205) subfamily of the ABC-G family. These findings highlight the significance of ABC transporter genes that control cellular detoxification against toxic substances (e.g., chemical pesticides and mycotoxins) in sustaining a virulence of S. mycoparasitica for effective biotrophic mycoparasitism on the F. graminearum host. The findings of this study provide clues to better understand the biotrophic mycoparasitism of S. mycoparasitica interacting with the Fusarium host, which implies that the ABC transporter group of key proteins is involved in the mycoparasite’s virulence and multidrug resistance to toxic substances including cellular detoxification.
APA, Harvard, Vancouver, ISO, and other styles
7

Ousalem, Farès, Shikha Singh, Olivier Chesneau, John F. Hunt, and Grégory Boël. "ABC-F proteins in mRNA translation and antibiotic resistance." Research in Microbiology 170, no. 8 (November 2019): 435–47. http://dx.doi.org/10.1016/j.resmic.2019.09.005.

Full text
APA, Harvard, Vancouver, ISO, and other styles
8

Alzar-Teruel, María, Fidel Hita-Contreras, Antonio Martínez-Amat, María Leyre Lavilla-Lerma, Raquel Fábrega-Cuadros, José Daniel Jiménez-García, and Agustín Aibar-Almazán. "SARC-F and the Risk of Falling in Middle-Aged and Older Community-Dwelling Postmenopausal Women." International Journal of Environmental Research and Public Health 18, no. 21 (November 4, 2021): 11570. http://dx.doi.org/10.3390/ijerph182111570.

Full text
Abstract:
(1) Background: The objective of the present study was to determine the ability of the SARC-F questionnaire to identify individuals at risk of falling among middle-aged and older community-dwelling postmenopausal women. (2) Methods: An analytical cross-sectional study was conducted on 157 women (70.80 ± 8.37 years). The SARC-F questionnaire was used to screen for risk of sarcopenia. Fear of falling and balance confidence, as measured by the Falls Efficacy Scale-International (FES-I) and the Activities-Specific balance Scale-16 items (ABC-16) respectively, were used to assess risk of falling. Anxiety and depression (Hospital Anxiety and Depression Scale), fatigue (Fatigue Severity Scale), body mass index, waist-to-hip ratio, and sleep duration were also determined. (3) Results: Logistic regression showed that higher risk of falling as assessed by FES-I was associated with higher SARC-F scores (OR = 1.656), anxiety levels (OR = 1.147), and age (OR = 1.060), while increased SARC-F scores (OR = 1.612), fatigue (OR = 1.044), and shorter sleep duration (OR = 0.75) were related to ABC-16 scores. In addition, a SARC-F cutoff of 1.50 (83.33% sensitivity and 59.13% specificity) and 3.50 (44.44% sensitivity and 89.26% specificity) were shown to be able to discriminate participants at risk of falling according to the FES-I and the ABC-16, respectively. (4) Conclusions: our results show that SARC-F is an independent predictor of the risk of falling among middle-aged and older community-dwelling postmenopausal women.
APA, Harvard, Vancouver, ISO, and other styles
9

Wohl, David A., Yazdan Yazdanpanah, Axel Baumgarten, Amanda Clarke, Melanie Thompson, Cynthia Brinson, Debbie Hagins, et al. "LB4. A Phase 3, Randomized, Controlled Clinical Trial of Bictegravir in a Fixed-Dose Combination, B/F/TAF, vs. ABC/DTG/3TC in Treatment-Naïve Adults at Week 96." Open Forum Infectious Diseases 5, suppl_1 (November 2018): S760—S761. http://dx.doi.org/10.1093/ofid/ofy229.2178.

Full text
Abstract:
Abstract Background Bictegravir (B), a potent INSTI with a high barrier to resistance, is coformulated with emtricitabine (F) and tenofovir alafenamide (TAF) as the FDA-approved single-tablet regimen B/F/TAF. We report Week 96 results from an ongoing phase 3 study comparing B/F/TAF to coformulated dolutegravir, abacavir, and lamivudine (DTG/ABC/3TC) in treatment-naïve adults living with HIV-1. Primary outcome at W48 demonstrated noninferior virologic responses, similar bone and renal profiles, and no viral resistance. Methods We randomized 1:1 HLA-B*5701-negative adults, without HBV and with estimated glomerular filtration rate (eGFR) ≥50 mL/minute to receive blinded B/F/TAF (50/200/25 mg) or DTG/ABC/3TC (50/600/300 mg) with matching placebos QD. Primary endpoint was proportion with HIV-1 RNA <50 copies/mL at W48 (FDA snapshot), with secondary analyses at W96. Noninferiority was assessed with 95% confidence intervals (CI) (12% margin). Other secondary endpoints were safety (adverse events [AEs], laboratory abnormalities) and predefined analyses of bone mineral density (BMD) and measures of renal function (eGFR, proteinuria). Results A total of 629 adults were randomized/treated (314 B/F/TAF, 315 DTG/ABC/3TC). At W96, B/F/TAF was noninferior to DTG/ABC/3TC: 87.9% vs. 89.8%, respectively, achieved HIV-1 RNA <50 copies/mL (difference −1.9%; 95%CI −6.9% to 3.1%, P = 0.45). In per-protocol analysis, 99.6% on B/F/TAF vs. 98.9% on DTG/ABC/3TC achieved HIV-1 RNA <50 copies/mL (P = 0.33). Most common AEs overall were nausea (11% B/F/TAF, 24% DTG/ABC/3TC, P < 0.001), diarrhea (15%, 16%), and headache (13%, 16%). Through W96, no participant had emergent resistance to study drugs. No participant discontinued B/F/TAF due to AEs; five (2%) discontinued DTG/ABC/3TC due to AEs (one after W48). Treatment-related AEs occurred in 28% B/F/TAF vs. 40% DTG/ABC/3TC (P = 0.002); most common was nausea (6%, 17%. P < 0.001). At W96, mean percentage changes in spine and hip BMD were small and similar between groups (table); median change in eGFR was significantly less with B/F/TAF, while median % changes in proteinuria were similar. Conclusion At W96, B/F/TAF was virologically noninferior to DTG/ABC/3TC, with no viral resistance or safety-related discontinuations. B/F/TAF was well tolerated with less nausea than DTG/ABC/3TC and similar bone and renal safety. Disclosures D. A. Wohl, Gilead: Grant Investigator and Scientific Advisor, Consulting fee and Research grant. Y. Yazdanpanah, AbbVie: Consultant, Consulting fee. Bristol-Myers Squibb: Consultant, Consulting fee. Gilead: Consultant, Consulting fee. MSD: Consultant, Consulting fee. Pfizer: Consultant, Consulting fee. Johnson & Johnson: Consultant, Consulting fee. ViiV Healthcare: Consultant, Consulting fee. A. Baumgarten, AbbVie: Consultant and Speaker’s Bureau, Consulting fee and Speaker honorarium. BMS: Consultant and Speaker’s Bureau, Consulting fee and Speaker honorarium. Gilead: Consultant and Speaker’s Bureau, Consulting fee and Speaker honorarium. Janssen-Cilag: Consultant and Speaker’s Bureau, Consulting fee and Speaker honorarium. MSD: Consultant and Speaker’s Bureau, Consulting fee and Speaker honorarium. ViiV: Consultant and Speaker’s Bureau, Consulting fee and Speaker honorarium. A. Clarke, GSK: Scientific Advisor, Consulting fee. Gilead: Conference attendence, Scientific Advisor and Speaker’s Bureau, Conference attendance support, Consulting fee and Speaker honorarium. BMS: Conference attendence, Conference attendance support. Janssen: Conference attendence, Conference attendance support. M. Thompson, Bristol Myers Squibb: Research Contractor, Research support. ViiV Healthcare: Research Contractor, Research support. C. Brinson, Gilead: Investigator, Scientific Advisor and Speaker’s Bureau, Research support and Speaker honorarium. Theratech: Investigator, Research support. BMS: Investigator, Research support. SlieaGen: Investigator, Research support. GSK ViiV: Consultant, Investigator and Scientific Advisor, Consulting fee, Research support and Speaker honorarium. Daiichi Sankyo: Sub Investigator, Research support. Novo Nordisk: Investigator, Research support. Sanofi: Investigator, Research support. Watson: Investigator, Research support. Salix: Investigator, Research support. Janssen: Investigator, Research support. Roche: Investigator, Research support. Colucid: Investigator, Research support. Eisai: Investigator, Research support. Shionogi: Investigator, Research support. Elcelyx: Investigator, Research support. Sangamo: Sub Investigator, Research support. D. Hagins, GlaxoSmithKline: Scientific Advisor and Speaker’s Bureau, Honoraria and Speaker honorarium. ViiV Healthcare: Scientific Advisor and Speaker’s Bureau, Honoraria and Speaker honorarium. Gilead: Scientific Advisor, Honoraria and Speaker honorarium. Bristol-Myers Squibb: Scientific Advisor and Speaker’s Bureau, Honoraria and Speaker honorarium. M. Ramgopal, Gilead: Grant Investigator, Research grant. A. Antinori, AbbVie: Consultant, Consulting fee. BMS: Consultant and Grant Investigator, Consulting fee and Research grant. Gilead: Consultant and Grant Investigator, Consulting fee and Research grant. Janssen-Cilag: Consultant and Grant Investigator, Consulting fee and Research grant. Merck: Consultant, Consulting fee. ViiV Healthcare: Consultant and Grant Investigator, Consulting fee and Research grant. X. Wei, Gilead: Shareholder, Salary and Stock. K. White, Gilead: Employee and Shareholder, Salary and Stock. S. Collins, Gilead: Employee and Shareholder, Salary and Stock. A. Cheng, Gilead: Employee and Shareholder, Salary and Stock. E. Quirk, Gilead: Employee and Shareholder, Salary and Stock. H. Martin, Gilead: Employee and Shareholder, Salary and Stock.
APA, Harvard, Vancouver, ISO, and other styles
10

Liu, Hanbin, Zanru Guo, Shuai He, Hongyao Yin, and Yujun Feng. "Synthesis and self-assembly of ABC linear triblock copolymers to target CO2-responsive multicompartment micelles." RSC Advances 6, no. 89 (2016): 86728–35. http://dx.doi.org/10.1039/c6ra18826e.

Full text
Abstract:
A series of ABC triblock copolymers were synthesized by tailoring the block length, suggesting polymers in a narrow composition window (0.34 ≤ fF ≤ 0.38) might transform from spherical micelles to multicompartment micelles upon stimulation of CO2.
APA, Harvard, Vancouver, ISO, and other styles
11

Huggett, Matthew T., Helen Passant, Chris Hurt, Stephen P. Pereira, John A. Bridgewater, and Somnath Mukherjee. "Outcome and patterns of care in advanced biliary tract carcinoma (ABC): Experience from two tertiary institutions in the United Kingdom." Journal of Clinical Oncology 31, no. 4_suppl (February 1, 2013): 272. http://dx.doi.org/10.1200/jco.2013.31.4_suppl.272.

Full text
Abstract:
272 Background: The ABC-02 trial has defined the standard therapy for patients with advanced biliary tract cancer (ABC), however outcome in an unselected patient population in the UK has not been described. We report the outcome of a series of patients with ABC from two large UK cancer networks. Methods: We retrospectively reviewed all cases of ABC presenting to two UK cancer networks over a 9-year period. Patients with a diagnosis recorded under anatomical site (liver, gallbladder or biliary tree) or histological diagnosis (cholangiocarcinoma or adenocarcinoma, liver), were included. Any patients who had surgery with curative intent were excluded. Overall survival (OS) and factors influencing OS were assessed. For the analysis, chemotherapy regimens were considered as: (i) gemcitabine (G)-based vs. non-G-based, (ii) platinum (P)-based vs. non-P-based and (iii) fluoropyrimidine (F)-based vs. non-F-based. Results: 402 patients were available for analysis. The median OS was 6.2 months. On univariate analysis, age ≥ 70 years (p=0.047), advanced disease stage (p<0.001), gall bladder primary (p=0.033), poor performance status (p<0.001) and lack of chemotherapy (p<0.001) were associated with worse outcome. Survival was superior in the 36.4% of patients who received palliative chemotherapy (12.5 versus 4.3 months; p<0.001). In patients receiving chemotherapy, on multivariate analysis males had higher mortality than females (HR=1.71; p=0.006) and stage 4 disease had a higher mortality (HR=2.62; p=0.002) than stage 1-2 disease. Patients who did not receive F-based regimens (HR=5.12; p=0.022) or G-based regimens (HR=5.01; p=0.021) had a higher mortality, whereas the effect of P-containing regimens was of borderline significance (HR=2.23; p=0.086). Sites, age, and multi-agent regimens were not significant. Conclusions: This is the first retrospective series from the UK and one of the largest population-based studies in ABC and confirms the benefit of palliative chemotherapy in an unselected group of patients. F-based regimens appear to be as effective as G-based treatments.
APA, Harvard, Vancouver, ISO, and other styles
12

Wang, Dan, Liqiang Liu, Yueyang Ben, Pingan Dai, and Jiancheng Wang. "Seabed Terrain-Aided Navigation Algorithm Based on Combining Artificial Bee Colony and Particle Swarm Optimization." Applied Sciences 13, no. 2 (January 15, 2023): 1166. http://dx.doi.org/10.3390/app13021166.

Full text
Abstract:
Position errors of inertial navigation systems (INS) increase over time after long-term voyages of the autonomous underwater vehicle. Terrain-aided navigation (TAN) can effectively reduce the accumulated error of the INS. However, traditional TAN algorithms require a long positioning time and need better positioning accuracy, and nonmatching and mismatching are prone to occur, especially when the initial position error is large. To solve this problem, a new algorithm combining the artificial bee colony (ABC) and particle swarm optimization (PSO) was proposed according to the principle of terrain matching, to improve the matching effect. Considering that PSO easily falls into a local optimum, the acceleration factor and inertia weight of PSO were improved. The improved PSO was called WAPSO. ABC was introduced based on WAPSO and could help WAPSO escape local optimum. The final algorithm was termed ABC search-based WAPSO (F-WAPSO). During the continuous iteration of particles, F-WAPSO seeks the optimal position for the particles. Simulation tests show that F-WAPSO can effectively improve the matching accuracy. When the initial position error is 1000 m, the matching error can be reduced to 93.5 m, with a matching time of only 13.7 s.
APA, Harvard, Vancouver, ISO, and other styles
13

Mycock, Katie, Lin Zhan, Gavin Taylor-Stokes, Gary Milligan, and Debanjali Mitra. "Real-World Palbociclib Use in HR+/HER2− Advanced Breast Cancer in Canada: The IRIS Study." Current Oncology 28, no. 1 (January 24, 2021): 678–88. http://dx.doi.org/10.3390/curroncol28010066.

Full text
Abstract:
Background: Palbociclib is a selective cyclin-dependent kinase (CDK) 4/6 inhibitor used in combination with aromatase inhibitors or fulvestrant for patients with hormone receptor-positive (HR+) human epidermal growth factor receptor 2 (HER2)-negative advanced/metastatic breast cancer (ABC/MBC). Palbociclib was the first CDK 4/6 inhibitor approved for HR+/HER2− ABC/MBC treatment in Canada in combination with letrozole (P+L) as an initial endocrine-based therapy (approved March 2016), or with fulvestrant (P+F) following disease progression after prior endocrine therapy (approved May 2017). The Ibrance Real World Insights (IRIS) study (NCT03159195) collected real-world outcomes data for palbociclib-treated patients in several countries, including Canada. Methods: This retrospective chart review included women with HR+/HER2− ABC/MBC receiving P+L or P+F in Canada. Physicians reviewed medical records for up to 14 patients, abstracting demographic and clinical characteristics, treatment patterns, and clinical outcomes. Progression-free rates (PFRs) and survival rates (SRs) at 6, 12, 18, and 24 months were estimated via Kaplan–Meier analysis. Results: Thirty-three physicians examined medical records for 247 patients (P+L, n = 214; P+F, n = 33). Median follow-up was 8.8 months for P+L and 7.0 months for P+F. Most patients were initiated on palbociclib 125 mg/d (P+L, 90.2%; P+F, 84.8%). Doses were reduced in 16.6% of P+L and 14.3% of P+F patients initiating palbociclib at 125 mg/d. The PFR for P+L was 90.3% at 12 months and 78.2% at 18 months; corresponding SRs were 95.6% and 93.0%. For P+F, 6-month PFR was 91.0%; 12-month SR was 100.0%. Conclusions: Dose reduction rates were low and PFR and SR were high in this Canadian real-world assessment of P+L and P+F treatments, suggesting that palbociclib combinations are well tolerated and effective.
APA, Harvard, Vancouver, ISO, and other styles
14

Cristofanilli, Massimo, Angela DeMichele, Carla Giorgetti, Dennis J. Slamon, Seock-Ah Im, Norikazu Masuda, Shailendra Verma, et al. "Predictors of prolonged benefit from palbociclib (PAL) plus fulvestrant (F) in women with endocrine-resistant hormone receptor–positive/human epidermal growth factor receptor 2–negative (HR+/HER2–) advanced breast cancer (ABC) in PALOMA-3." Journal of Clinical Oncology 35, no. 15_suppl (May 20, 2017): 1050. http://dx.doi.org/10.1200/jco.2017.35.15_suppl.1050.

Full text
Abstract:
1050 Background: PAL+F improved progression-free survival (PFS) over F + placebo (P) in patients (pts) with endocrine-resistant HR+/HER2– ABC. We examined factors predictive of long-term benefit on PAL+F. Methods: Pre/postmenopausal pts with HR+/HER2– ABC that progressed on prior endocrine therapy (ET) were randomized 2:1 to PAL (125 mg/d oral [3 wk on, 1 wk off]) + F (500 mg) or P+F. Characteristics of pts with prolonged benefit (treatment [tx] duration ≥18 mo for PAL+F; ≥12 mo for P+F based on median PFS and tx duration) were compared with the intent-to-treat (ITT) population. Results: PAL+F improved PFS vs P+F (11.2 vs 4.6 mo; hazard ratio, 0.50). By Aug 2016, 138 pts had long-term benefit: 100/347 (29%) pts on PAL+F received tx for ≥18 mo, including 70 (20%) who received > 2 y (26–39 cycles). In contrast, 38/174 (22%) pts on P+F received ≥12 mo of tx; only 16 (9%) received > 2 y (27–38 cycles). No apparent differences in baseline characteristics of pts with long-term benefit were observed between groups except that a greater proportion of those on P+F had a single site of disease involvement (40% PAL+F vs 63% P+F). Pts with long-term benefit on PAL+F had lower rates of visceral disease (42% vs 60%), liver metastases (18% vs 40%), and ≥3 disease sites (27% vs 39%) at baseline vs the ITT population; no difference in sensitivity to prior ET was observed (84% vs 79%). Objective response rate (ORR) was higher among pts with prolonged benefit on PAL+F vs ITT (36% vs 26%). Conclusions: PAL+F is associated with prolonged benefit in about a third of pts treated with the combination in PALOMA-3. These pts achieve higher ORR compared to other study pts and the benefit is independent of baseline site and number of metastatic recurrences and prior endocrine sensitivity. Benefit from F alone is less prolonged and appears limited to those with 1 site of disease involvement. The analysis confirms the efficacy of PAL+F in HR+ ABC with visceral recurrence. Biomarker analyses are ongoing in pts with long-term benefit to understand molecular features predictive of tx sensitivity. Funding: Pfizer. Clinical trial information: NCT01942135.
APA, Harvard, Vancouver, ISO, and other styles
15

Fanther, Refaldo, and Carto Hendriawan Prasetyo. "EDUKASI PELANGGAN DAN PROMOSI PENJUALAN UNTUK MENINGKATKAN PENJUALAN RETAIL (Studi Kasus Ritel Pasar Raja Galuh Majalengka)." Value: Jurnal Manajemen dan Akuntansi 12, no. 2 (June 19, 2019): 149–55. http://dx.doi.org/10.32534/jv.v12i2.483.

Full text
Abstract:
Penelitian ini bertujuan Untuk menganalisis pengaruh Edukasi pelanggan terhadap Peningkatan penjualan ritel kopi abc susu ,menganalisis pengaruh Promosi penjualan terhadap penjualan peningkatan penjualan rietl kopi abc susu, Untuk menganalisis pengaruh edukasi pelanggan dan promosi penjualan terhadap penjualan ritel kopi abc susu. Metode penelitian yang digunakan dalam penelitian ini adalah penelitian kausal. Metode penelitian kausal adalah metode penelitian untuk mengetahui seberapa besar pengaruh anatar satu variabel (variabel X) sebagai variable independen atau kualitas produk dengan variabel lain (variabel Y) sebagaiVariabel dependen atau penjualan ritel. Edukasi Pelanggan dan Promosi Penjualan berpengaruh signifikan terhadap Penjualan Retail. Hal ini dapat dilihat dari nilai koefisien regresi yang bernilai 0,710 (0,564 ; 0.146) dan nilai f hitung lebih besar daripada f tabel (20,470 ? 3,34) pada tingkat signifikansi 5%. Selain itu, nilai signifikansi Edukasi Pelanggan dan Promosi Penjualan terhadap Penjualan Retail lebih kecil daripada nilai signifikansi ? = 5% (0,000 > 0,050) yang menunjukkan bahwa pengaruh Edukasi Pelanggan dan Promosi Penjualan berpengaruh dan signifikan terhadap Penjualan Retail Kata Kunci : Edukasi Pelanggan, Promosi Penjualan, Penjualan Retail
APA, Harvard, Vancouver, ISO, and other styles
16

MOUNSEY, K. E., D. C. HOLT, J. McCARTHY, and S. F. WALTON. "Identification of ABC transporters inSarcoptes scabiei." Parasitology 132, no. 6 (February 3, 2006): 883–92. http://dx.doi.org/10.1017/s0031182005009716.

Full text
Abstract:
We have identified and partially sequenced 8 ABC transporters from an EST dataset ofSarcoptes scabieivar.hominis, the causative agent of scabies. Analysis confirmed that most of the known ABC subfamilies are represented in the EST dataset including several members of the multidrug resistance protein subfamily (ABC-C). Although P-glycoprotein (ABC-B) sequences were not found in the EST dataset, a partial P-glycoprotein sequence was subsequently obtained using a degenerate PCR strategy and library screening. Thus a total of 9 potentialS. scabieiABC transporters representing the subfamilies A, B, C, E, F and H have been identified. Ivermectin is currently used in the treatment of hyper-infested (crusted) scabies, and has also been identified as a potentially effective acaricide for mass treatment programmes in scabies-endemic communities. The observation of clinical andin vitroivermectin resistance in 2 crusted scabies patients who received multiple treatments has raised serious concerns regarding the sustainability of such programmes. One possible mechanism for ivermectin resistance is through ABC transporters such as P-glycoprotein. This work forms an important foundation for further studies to elucidate the potential role of ABC transporters in ivermectin resistance ofS. scabiei.
APA, Harvard, Vancouver, ISO, and other styles
17

Acosta, Rima K., Grace Q. Chen, Silvia Chang, Ross Martin, Xinxin Wang, Hailin Huang, Diana Brainard, Sean E. Collins, Hal Martin, and Kirsten L. White. "Three-year study of pre-existing drug resistance substitutions and efficacy of bictegravir/emtricitabine/tenofovir alafenamide in HIV-1 treatment-naive participants." Journal of Antimicrobial Chemotherapy 76, no. 8 (April 21, 2021): 2153–57. http://dx.doi.org/10.1093/jac/dkab115.

Full text
Abstract:
Abstract Objectives Two Phase 3, randomized, double-blind, active-controlled studies of initial HIV-1 treatment demonstrated that bictegravir/emtricitabine/tenofovir alafenamide (B/F/TAF) was non-inferior to dolutegravir/abacavir/lamivudine (DTG/ABC/3TC; Study 1489) or to DTG+F/TAF (Study 1490) through 144 weeks. In both studies, there was no emergent resistance to study drugs. Here, the 3 year resistance analysis and impact of baseline resistance substitutions on treatment response are described. Methods Population sequencing of HIV-1 protease and reverse transcriptase (RT) was performed at screening. Retrospective baseline next generation sequencing of protease, RT and integrase (IN) was analysed at a ≥ 15% cutoff. Resistance analyses were performed on participants with confirmed viral rebound of HIV-1 RNA ≥200 copies/mL through Week 144 or last visit who did not resuppress to &lt;50 copies/mL while on study drug. Results Transmitted primary drug resistance substitutions were present in the following proportions of participants: integrase strand transfer inhibitor (INSTI) resistance (-R) in 1.3% (17/1270) of participants; NRTI-R in 2.7% (35/1274); NNRTI-R in 14.1% (179/1274); and PI-R in 3.5% (44/1274). These pre-existing resistance substitutions not associated with study drug did not affect treatment outcomes. One participant in the B/F/TAF group had pre-existing bictegravir and dolutegravir resistance substitutions (Q148H+G140S in integrase) at baseline and suppressed and maintained HIV-1 RNA &lt;50 copies/mL through Week 144. In total, 21 participants qualified for resistance testing [1.3% (8/634) B/F/TAF; 1.9% (6/315) DTG/ABC/3TC; 2.2% (7/325) DTG+F/TAF]; none had emergent resistance to study drugs. Conclusions Treatment with B/F/TAF, DTG/ABC/3TC, or DTG+F/TAF achieved high, durable rates of virological suppression in HIV-1 treatment-naive participants. The presence of pre-existing resistance substitutions did not affect treatment outcomes, and there was no treatment-emergent resistance.
APA, Harvard, Vancouver, ISO, and other styles
18

Qi, Peng-Fei, Ya-Zhou Zhang, Cai-Hong Liu, Jing Zhu, Qing Chen, Zhen-Ru Guo, Yan Wang, et al. "Fusarium graminearum ATP-Binding Cassette Transporter Gene FgABCC9 Is Required for Its Transportation of Salicylic Acid, Fungicide Resistance, Mycelial Growth and Pathogenicity towards Wheat." International Journal of Molecular Sciences 19, no. 8 (August 10, 2018): 2351. http://dx.doi.org/10.3390/ijms19082351.

Full text
Abstract:
ATP-binding cassette (ABC) transporters hydrolyze ATP to transport a wide range of substrates. Fusarium graminearum is a major causal agent of Fusarium head blight, which is a severe disease in wheat worldwide. FgABCC9 (FG05_07325) encodes an ABC-C (ABC transporter family C) transporter in F. graminearum, which was highly expressed during the infection in wheat and was up-regulated by the plant defense hormone salicylic acid (SA) and the fungicide tebuconazole. The predicted tertiary structure of the FgABCC9 protein was consistent with the schematic of the ABC exporter. Deletion of FgABCC9 resulted in decreased mycelial growth, increased sensitivity to SA and tebuconazole, reduced accumulation of deoxynivalenol (DON), and less pathogenicity towards wheat. Re-introduction of a functional FgABCC9 gene into ΔFgABCC9 recovered the phenotypes of the wild type strain. Transgenic expression of FgABCC9 in Arabidopsis thaliana increased the accumulation of SA in its leaves without activating SA signaling, which suggests that FgABCC9 functions as an SA exporter. Taken together, FgABCC9 encodes an ABC exporter, which is critical for fungal exportation of SA, response to tebuconazole, mycelial growth, and pathogenicity towards wheat.
APA, Harvard, Vancouver, ISO, and other styles
19

Hunnicutt, David W., Michael J. Kempf, and Mark J. McBride. "Mutations in Flavobacterium johnsoniae gldF and gldG Disrupt Gliding Motility and Interfere with Membrane Localization of GldA." Journal of Bacteriology 184, no. 9 (May 1, 2002): 2370–78. http://dx.doi.org/10.1128/jb.184.9.2370-2378.2002.

Full text
Abstract:
ABSTRACT Flavobacterium johnsoniae moves rapidly over surfaces by a process known as gliding motility. The mechanism of this form of motility is not known. Four genes that are required for F. johnsoniae gliding motility, gldA, gldB, gldD, and ftsX, have recently been described. GldA is similar to the ATP-hydrolyzing components of ATP binding cassette (ABC) transporters. Tn4351 mutagenesis was used to identify two additional genes, gldF and gldG, that are required for cell movement. gldF and gldG appear to constitute an operon, and a Tn4351 insertion in gldF was polar on gldG. pMK314, which carries the entire gldFG region, restored motility to each of the gldF and gldG mutants. pMK321, which expresses GldG but not GldF, restored motility to each of the gldG mutants but did not complement the gldF mutant. GldF has six putative membrane-spanning segments and is similar in sequence to channel-forming components of ABC transporters. GldG is similar to putative accessory proteins of ABC transporters. It has two apparent membrane-spanning helices, one near the amino terminus and one near the carboxy terminus, and a large intervening loop that is predicted to reside in the periplasm. GldF and GldG are involved in membrane localization of GldA, suggesting that GldA, GldF, and GldG may interact to form a transporter. F. johnsoniae gldA is not closely linked to gldFG, but the gldA, gldF, and gldG homologs of the distantly related gliding bacterium Cytophaga hutchinsonii are arranged in what appears to be an operon. The exact roles of F. johnsoniae GldA, GldF, and GldG in gliding are not known. Sequence similarities of GldA to components of other ABC transporters suggest that the Gld transporter may be involved in export of some material to the periplasm, outer membrane, or beyond.
APA, Harvard, Vancouver, ISO, and other styles
20

Rizzato, Alex, Natalie D’Alessandro, Elisabetta Berenci, Alice Rinchi, Garrett Enten, Giuliano Vezzani, Maurizio Proietti, Alberto Fiorito, Enrico Camporesi, and Gerardo Bosco. "Effect of mild hyperbaric oxygen therapy on children diagnosed with autism." Undersea and Hyperbaric Medicine 45, no. 6 (November 1, 2018): 639–44. http://dx.doi.org/10.22462/11.12.2018.3.

Full text
Abstract:
Introduction: Hyperbaric oxygen (HBO2) therapy is emerging internationally as the primary treatment modality for inflammatory pathways related to neurological disorders. Currently, literature concerning its effectiveness in autistic children is limited. Using neurocognitive tests and clinical-diagnostic evaluations, this study evaluates the clinical, cognitive and behavioral effects of HBO2 on children diagnosed with autism. Methods: An experimental HBO2 group (EXP: F = 1; M = 7; mean age: 7 ± 2.33; years) and a control non-HBO2 group of autistic children (CTRL: F = 2; M= 5; mean age: 6.6 ± 2.7 years) correctly completed the Aberrant Behavior Checklist-Community (ABC) before HBO2 (T0), after 40 sessions of HBO2 (T1), and one month after the end of treatments (T2). Additionally, the experimental HBO2 group was evaluated with the Childhood Autism Rating Scale at T0 and T2. Results: Total ABC score was lower at T2 (mean ± SD: 50.38 ± 18.55; p < 0.001) compared to scores obtained at T0 (mean ± SD: 57.5 ± 19.01). Similarly, in the control group the total ABC score differed statistically (p < 0.05) between T0 (103.6 ± 20.38) and (T2: 59 ± 25.25). Conclusions: Despite the improvements reported in both groups, our results do not support the utility of HBO2 in children diagnosed with autism.
APA, Harvard, Vancouver, ISO, and other styles
21

Muradov, Firudin Kh. "On Characterization of Open Sets in Euclidean Spaces." ITM Web of Conferences 22 (2018): 01007. http://dx.doi.org/10.1051/itmconf/20182201007.

Full text
Abstract:
A ternary semigroup is a nonempty set T together with a ternary oper- ation [abc] satisfying the associative law [[abc] de] = [a [bcd] e] = [ab [cde]] for all a, b, c, d, e ε T. A map f between topological spaces X and Y is called open if the image of each set open in X is open in Y. The pur- pose of this paper is to give an abstract characterization of the ternary semigroups of open maps defined on open sets in Euclidean n-spaces.
APA, Harvard, Vancouver, ISO, and other styles
22

ARDELLI, B. F., L. E. STITT, and J. B. TOMPKINS. "Inventory and analysis of ATP-binding cassette (ABC) systems inBrugia malayi." Parasitology 137, no. 8 (March 17, 2010): 1195–212. http://dx.doi.org/10.1017/s0031182010000120.

Full text
Abstract:
SUMMARYABC systems are one of the largest described protein superfamilies. These systems have a domain organization that may contain 1 or more transmembrane domains (ABC_TM1F) and 1 or 2 ATP-binding domains (ABC_2). The functions (e.g., import, export and DNA repair) of these proteins distinguish the 3 classes of ABC systems. Mining and PCR-based cloning were used to identify 33 putative ABC systems from theBrugia malayigenome. There were 31 class 2 genes, commonly called ABC transporters, and 2 class 3 genes. The ABC transporters were divided into subfamilies. Three belonged to subfamily A, 16 to subfamily B, 5 to subfamily C, 1 to subfamily E and 3 to subfamilies F and G, respectively. None were placed in subfamilies D and H. Similar to other ABC systems, the ABC_2 domain ofB. malayigenes was conserved and contained the Walker A and B motifs, the signature sequence/linker region and the switch region with the conserved histidine. The ABC_TM1F domain was less conserved. The relative abundance of ABC systems was quantified using real-time reverse transcription PCR and was significantly higher in female adults ofB. malayithan in males and microfilaria, particularly those in subfamilies B and C, which are associated with drug resistance.
APA, Harvard, Vancouver, ISO, and other styles
23

Sharkey, Liam K. R., and Alex J. O’Neill. "Antibiotic Resistance ABC-F Proteins: Bringing Target Protection into the Limelight." ACS Infectious Diseases 4, no. 3 (January 27, 2018): 239–46. http://dx.doi.org/10.1021/acsinfecdis.7b00251.

Full text
APA, Harvard, Vancouver, ISO, and other styles
24

Sulieman Mohammad Jaradat, Mohammad, Khaled Abdalla Moh’d AL-Tamimi, Samer Fakhri Obeidat, and Ashraf Bataineh. "The impact of selected internal factors on the profitability of commercial banks in Jordan." Banks and Bank Systems 17, no. 3 (October 4, 2022): 227–36. http://dx.doi.org/10.21511/bbs.17(3).2022.19.

Full text
Abstract:
This paper analyzes the impact of internal factors on the profitability of commercial banks in Jordan in the period of 2009–2019. Bank size, capital adequacy, bank loans, bank and liquidity risk are taken as explanatory variables, with the rate of return on assets as a dependent variable. EViews software was used for regression analysis. This study highlights a significant and positive effect of f-statistics for SGBJ Bank, Kuwait Bank, Capital Bank, ABC Bank, and Arab Bank – 11.34, 5.46, 5.11, 5,14 and 5.62, respectively. This means that internal factors affect their profitability, there is a positive effect of internal factors on the profitability of SGBJ, Kuwait Bank, ABC Bank, and Arab Bank. SGBJ’s R-squared was 88%.This indicates that any change inthe bank’s profitability is 88% due to a change in internal factors, while R-squared of Kuwait Bank, Capital Bank, ABC Bank and Arab Bank was 78%, 77%, 77%, and 77%, respectively, indicating that changes in the banks’ profitability were caused by internal factors. This is due to the bank loan ratio, where SGBJ’s ratio 48.6 and the bank loan rate were 79% of total assets. Kuwait Bank 29.1, so bank loan rate is 56% of total assets, Cairo Bank 36.3, ABC Bank 11.8, and Capital Bank 16.37; f-statistics of Alethad Bank, Invest Bank, Arab Invest Bank, Housing Bank, Ahli Bank, Commercial Bank, Cairo Bank, and Jordan Bank were 0.75, 2.17, 1.61, 2.48, 2.26, 3.25, and 2.72, respectively. This indicates that internal factors do not affect the profitability of these banks.
APA, Harvard, Vancouver, ISO, and other styles
25

Gulia, Nishika, Kamna Solanki, Sandeep Dalal, Amita Dhankhar, Omdev Dahiya, and N. Ummal Salmaan. "Intrusion Detection System Using the G-ABC with Deep Neural Network in Cloud Environment." Scientific Programming 2023 (April 28, 2023): 1–15. http://dx.doi.org/10.1155/2023/7210034.

Full text
Abstract:
Cloud computing plays a pivotal role in sharing resources and information. It is challenging to secure cloud services from different intruders. Intrusion detection system (IDS) plays a vital role in detecting intruder attacks, and it is also used to monitor the traffic in the network. The paper is aimed to control the attacks using the machine learning (ML) technique integrated with the artificial bee colony (ABC) named Group-ABC (G-ABC). The IDS detector has been implemented and further simulation results have been determined using the G-ABC. The evaluation has been carried out using the measures such as precision, recall, accuracy, and F-measure. Different attacks such as user to root (U2R), probe, root to local (R2L), backdoors, worms, and denial-of-service (DoS) attacks have been detected. The simulation analysis is performed using two datasets, namely, the NSL-KDD dataset and UNSW-NB15 dataset, and comparative analysis is performed against the existing work to prove the effectiveness of the proposed IDS. The objective of the work is to determine the intruder attacker system using the deep learning technique.
APA, Harvard, Vancouver, ISO, and other styles
26

Mehmood, Nayyar, Israr Ali Khan, Muhammad Ayyaz Nawaz, and Niaz Ahmad. "Existence results for ABC-fractional BVP via new fixed point results of F-Lipschitzian mappings." Demonstratio Mathematica 55, no. 1 (January 1, 2022): 452–69. http://dx.doi.org/10.1515/dema-2022-0028.

Full text
Abstract:
Abstract In this article, fixed point results for self-mappings in the setting of two metrics satisfying F F -lipschitzian conditions of rational-type are proved, where F F is considered as a semi-Wardowski function with constant τ ∈ R \tau \in {\mathbb{R}} instead of τ > 0 \tau \gt 0 . Two metrics have been considered, one as an incomplete while the other is orbitally complete. The mapping is taken to be orbitally continuous from one metric to another. Some examples are provided to validate our results. For applications, we present existence results for the solutions of a new type of ABC-fractional boundary value problem.
APA, Harvard, Vancouver, ISO, and other styles
27

Khalid, Khalid. "Metode Hibridasi Artificial Bee Colony dan Fuzzy K-Modes untuk Klasterisasi Data Kategorikal." Systemic: Information System and Informatics Journal 4, no. 2 (January 31, 2019): 36–42. http://dx.doi.org/10.29080/systemic.v4i2.466.

Full text
Abstract:
Fuzzy K-Modes (FKMO) merupakan metode klasterisasi data yang efektif untuk data kategorikal. Metode ini menggunakan metode fuzzy dan pencocokan ukuran ketidaksamaan (dissimilarity measure) yang sederhana untuk memutakhirkan titik pusat klaster dan mendapatkan solusi yang optimal. Meskipun demikian Fuzzy K-Modes memiliki kelemahan adanya kemungkinan berhenti dalam solusi lokal optimal. Artificial Bee Colony (ABC) merupakan metode optimasi yang efektif dan terbukti memiliki kemampuan mendapatkan solusi global. Penelitian ini mengusulkan penggunaan algoritma Artificial Bee Colony untuk melakukan optimasi terhadap Fuzzy K-Modes untuk klasterisasi data kategorikal (ABC-FKMO). Implementasi Artifical Bee Colony untuk optimasi Fuzzy K-Modes terbukti mampu meningkatkan performa klasterisasi data kategorikal khususnya dalam aspek nilai Objective Function, F-Measure, dan Accuracy. Hasil pengujian dengan dataset Soybean Disease, Breast Cancer dan Congressional Voting Records dari UCI data repository, menunjukkan rata-rata accuracy sebesar 0.991, 0.615, dan 0.867. Objective Function lebih baik rata rata sebesar 2,73 %, F-Measure lebih baik rata-rata sebesar 4,31 % dan Accuracy lebih baik rata-rata sebesar 5,16 %.
APA, Harvard, Vancouver, ISO, and other styles
28

Ero, Rya, Veerendra Kumar, Weixin Su, and Yong‐Gui Gao. "Ribosome protection by ABC‐F proteins—Molecular mechanism and potential drug design." Protein Science 28, no. 4 (March 4, 2019): 684–93. http://dx.doi.org/10.1002/pro.3589.

Full text
APA, Harvard, Vancouver, ISO, and other styles
29

Srivastava, Anand Kumar, Yugal Kumar, and Pradeep Kumar Singh. "Artificial Bee Colony and Deep Neural Network-Based Diagnostic Model for Improving the Prediction Accuracy of Diabetes." International Journal of E-Health and Medical Communications 12, no. 2 (July 2021): 32–50. http://dx.doi.org/10.4018/ijehmc.2021030102.

Full text
Abstract:
A large number of machine learning approaches are implemented in healthcare field for effective diagnosis and prediction of different diseases. The aim of these machine learning approaches is to build automated diagnostic tool for helping the physician as well as monitor the health status of patients. These diagnostic tools are widely adopted in intensive care unit for life expectancy of patients. In this study, an effort is made to design an automated diagnostic model for the diagnosis and prediction of diabetes patients. The proposed diagnostic model is designed using artificial bee colony (ABC) algorithm and deep neural network (DNN) technique, called ABC-DNN-based diagnostic model. The ABC algorithm is applied to determine the relevant features for diabetes prediction and diagnosis while DNN technique is adopted for the prediction and diagnosis of diabetes affected patients. The performance of proposed diagnostic model is tested over Pima Indian Diabetes dataset and evaluated using accuracy, sensitivity, specificity, F-measure, Kappa, and area under curve (AUC) parameters. Further, 10-fold and 50-50% training-testing method are considered to assess the performance of proposed diagnostic model. The experimental results of proposed ABC-DNN model is compared with DNN technique and several existing diabetes studies. It is observed that proposed ABC-DNN model achieves 94.74% accuracy rate using 10-fold method.
APA, Harvard, Vancouver, ISO, and other styles
30

Camerini, A., O. Garrone, C. Valsuani, C. Puccetti, M. Rondini, S. Donati, O. Siclari, S. Barni, P. Pronzato, and D. Amoroso. "Effect of fulvestrant treatment on serum VEGF levels in hormone-sensitive metastatic breast cancer patients." Journal of Clinical Oncology 27, no. 15_suppl (May 20, 2009): 1124. http://dx.doi.org/10.1200/jco.2009.27.15_suppl.1124.

Full text
Abstract:
1124 Background: Fulvestrant (F) is a pure antiestrogen agent available for the hormonal treatment (HT) of post-menopausal ormone-sensitive advanced breast cancer (ABC). We previously reported (ASCO 2007 abs1085) a lipid lowering effect of F possibly related to an action on progesterone (P) receptor. Aim of the study is to analyze the effect of F treatment on serum VEGF levels that may represent an effect of P pathway alteration. Methods: 21 pts (median age 75 yrs [range 43–82]) with hormone-sensitive ABC were enrolled. All patients were heavily pretreated receiving a median of 2 [1–4] HT-lines and 2 [1–5] CT-lines before F. Last HT before F administration was exemestane in 8/21, letrozole in 9/21, anastrozole 3/21, and tamoxifene in 1/21. Treatment-related data, including response according to RECIST criteria and toxicity, were collected. Fulvestrant was administered as standard monthly 250 mg injection. Peripheral venous blood samples were collected before F administration, every 3 months, and at discontinuation time. VEGF levels were evaluated by ELISA and expressed as absolute absorbance values. Baseline values were always compared to the last available sample. Results: At report time pts received a median of 4 F injections (range 3–8). We observed a PR in 3/21, SD in 7/21, and PD in 11/21 pts with a clinical benefit of 45% and a median TTP of 4.5 [3–9] months. Serum VEGF levels significantly decreased during F treatment (156.8 ± 28.5 vs. 122.2 ± 14.5 A; p = 0.01). VEGF reduction was independent from clinical benefit (186.4 ± 44.6 vs. 131.1 ± 21.8 A, p = 0.04 in pts with CB and 158.9 ± 52.5 vs. 125.0 ± 27.9 A, p = 0.1 ns in pts without CB), type of last HT or treatment duration. Conclusions: We observed a reduction of serum VEGF levels associated with F treatment in our study population. Our data seem to strengthen the hypothesis of a possible effect of F on P pathway affecting both lipid metabolism and VEGF production regulation. No significant financial relationships to disclose.
APA, Harvard, Vancouver, ISO, and other styles
31

Suzuki, Eiichiro, John A. Bridgewater, Juan W. Valle, John Neil Primrose, Anna Dorothea Wagner, Andre Lopes, and Richard Fox. "Sex difference in patients with biliary tract cancer receiving chemotherapy: Post hoc analysis of ABC-01, -02, -03, -04, BILCAP." Journal of Clinical Oncology 38, no. 4_suppl (February 1, 2020): 517. http://dx.doi.org/10.1200/jco.2020.38.4_suppl.517.

Full text
Abstract:
517 Background: The relationship between toxicity from chemotherapy and clinical outcome in biliary tract cancer (BTC) is uncertain. Aim: This post hoc analysis evaluated differences by sex in the frequency of adverse events (AEs) and overall survival (OS) and its impact on progression-free survival (PFS)/recurrence-free survival (RFS) for BTC patients. Methods: Individual patient data were retrieved from ABC -01, -02, -03, -04, and BILCAP study. AEs were graded according to National Cancer Institute's Common Toxicity Criteria v 4.02 and odds ratios along with 95%CI and p-values derived from logistic regression were used to assess the effect of sex on the risk of AEs. Time to event outcomes were evaluated using Cox regression and plotted using Kaplan-Meier plots. All statistical tests were two-sided. Results: Overall 994 patients-data were examined: 86 in ABC-01, 324 in-02, 124 in -03, 13 in -04 and 447 in BILCAP. A total of 484 (49%) were males (M) and 510 (51%) were females (F). 770 patients were evaluable for AEs because a total of 224 patients in BILCAP study belonged to the observation group. Urinary tract infection (M, 1.6%; F, 5.5%), nausea (M, 50.7%; F, 69.9%), vomiting (M, 29.1%; F, 46.1%), alopecia (M, 11.3%; F, 27.3%), are dominant in F, hyperbilirubinaemia (M, 36.7%; F, 29.1%) and thrombocytopenia (M, 43.1%; F, 34.3%) and hiccups (M, 2.4%; F, 0.5%) are dominant in M at any grade. Vomiting (M, 3.5%; F, 7.0%) and fatigue (M, 4.0%; F, 8.5%) are higher in F than in M for grade 3-5. The median OS (M, 16.2 months (Mo); F, 17.5 Mo), PFS (M, 6.4 Mo; F, 6.5 Mo) and RFS (M, 20.8 Mo; F 19.4 Mo) were similar. Amongst the subgroup of patients with gallbladder, F achieved longer OS (M, 11.5 Mo; F 13.3 Mo, 0.73 (95%CI:0.54,0.99), p = 0.041) and RFS than M (M, 20.8 Mo; median PFS for F not reached, HR:0.52 (95%CI:0.27,1.02), p = 0.057). Conclusions: Females with BTC have tended to have more AEs, especially grade 3+. Although no difference was observed in OS, PFS, and RFS between males and females for the overall cohort of patients, females with gallbladder cancer had an improved OS and RFS compared with males. These findings suggest, in BTC, sex may play a role when designing clinical trials as well as in making treatment decisions.
APA, Harvard, Vancouver, ISO, and other styles
32

Wusahaningtyas, Lu’lu’ Sahara, Moh Mirza Nuryady, Lintang Winantya Firdausy, Ahmad Fahrurrozi Zs, and R. Wisnu Nurcahyo. "Molecular Identification of ABC2 Transporter Gene Encode Protein Ngawi Trypanosoma evansi Isolate that suspected resistance to Isometamidium Chloride." BIO Web of Conferences 41 (2021): 06003. http://dx.doi.org/10.1051/bioconf/20214106003.

Full text
Abstract:
This study aims to determine the profile of the ABC2 encoding transporter on Trypanosoma evansi (T. evansi) Ngawi isolates, Indonesia, exposed with Isometamidium Chloride (ISM). This study used blood samples of mice containing Trypanosoma evansi that had been exposed with ISM 0.05 mg/kg BW, ISM 0.1 mg/kg BW and ISM 0.3 mg/kg BW for 4 weeks, and control group. Blood samples were extracted and amplified using primers. ABC2 F 5 ’GCTTGTCCGACCATCTTGCA 3’ and ABC2 R 5 ’AGGTCCACTCCCATGCTACA 3’ that produced 350 basepairs (bp). The sequencing results were then analyzed using BLAST and MEGA 7.0. There was 1 deference nucleotide (107) derived from multiple alignments, while in amino acids there was no difference in all samples. Trypanosoma evansi which was exposed with ISM does not have many differences in nucleotide or amino acid and only one type of mutation. The ABC2 Transporters of four groups of T.evansi have high similarity to ABC Transporters of T. brucei gambiense, T. brucei brucei, and T. brucei brucei (Tbabc2). Therefore, further research on the ABC2 Transporter gene is needed.
APA, Harvard, Vancouver, ISO, and other styles
33

Gading, I. Ketut, Siti Aishah Hassan, Abu Yazid Abu Bakar, and Kade Sathya Gita Rismawan. "Solution-focused brief counseling and ABC manipulation technique in self-control training to reduce aggressive behaviour." Jurnal Cakrawala Pendidikan 40, no. 3 (October 20, 2021): 670–712. http://dx.doi.org/10.21831/cp.v40i3.40755.

Full text
Abstract:
Aggressive behaviours in the society have been very alarming, including among high school students. To reduce aggressive behaviours, the main effort is to increase self-control. This study is aimed at describing the differences between the effectiveness of solution-focused brief counseling (SFBC) and Self-Control Training with the Antecedent-Behavioral-Consequence (ABC) manipulation technique to reduce students’ aggressive behavior tendencies. The study is a quasi-experimental research with a pretest-posttest control group design. The population of the study consists of 563 students. The sample selected by the simple random sampling technique amounts to 60 students. The data collection method of the study is a non-test technique. The instrument used for data collection is the Aggression Questionnaire (AQ) with 25 statement items. The data are analyzed using ANOVA test. The ANOVA test results show an F value of 348.300 with a significance value of 0.000 (Sig 0.05); so, it can be interpreted that both solution-focused brief counseling (SFBC) and the Self-Control Training with the Antecedent-Behavioral-Consequence (ABC) are effective in reducing aggressive behaviors. However, the ABC self-control training model is found to be more effective. Therefore, guidance and counseling teachers are expected to continue working on self-control training for children, through the ABC self-control training model.
APA, Harvard, Vancouver, ISO, and other styles
34

De, Prithwijit, and Gerry Leversha. "A triangular exploration." Mathematical Gazette 105, no. 564 (October 13, 2021): 501–6. http://dx.doi.org/10.1017/mag.2021.118.

Full text
Abstract:
In this Article we study the following problem: Let ΔABC be an acute-angled triangle. Let the points D, E, F on the sides BC, CA and AB, respectively, be such that AD is the median from A, BE is the internal angle bisector of ∠ABC, and CF is the altitude from C. This is shown in Figure 1.
APA, Harvard, Vancouver, ISO, and other styles
35

Mak, Margaret KY. "Concurrent and Discriminative Validity of the Mini Balance Evaluation Systems Test (miniBESTest) in People with Parkinson's Disease." Indian Journal of Physical Medicine and Rehabilitation 26, no. 2 (2015): 43–48. http://dx.doi.org/10.5005/ijopmr-26-2-43.

Full text
Abstract:
Abstract Purpose To examine the concurrent and discriminative validity of the miniBESTest in individuals with Parkinson's disease (PD). Method Thirty-four individuals with PD participated in study 1. Thirty-one healthy subjects and 127 individuals with PD completed study 2. All participants were assessed at the University Balance and motion analysis laboratory. Balance performance was assessed using the miniBESTest and Berg's balance scale (BBS). Self-perceived balance confidence level of subjects was measured by the activities-specific balance confidence (ABC) scale. Results In study 1, results of Pearson's correlation showed that the scores of the miniBESTest correlated well with BBS (r=0.765; p<0.001) and moderately well with ABC scores (r=0.587; p<0.001). For study 2, results of one-way analysis of variance demonstrated significant differences in miniBESTest scores among healthy subjects, PD non-fallers (PD-NF) and PD fallers (PD-F). Healthy subjects obtained the highest mini-BESTest score of 88.2 ± 8.9%, followed by PD-NF (73.6 ± 14.7%) and PDF (57.1 ± 17.0%) (all p<0.001). Significant differences were also observed among healthy subjects, PD-NF and PD-F for each miniBESTest domain score (all p<0.05). Conclusion The miniBESTest is a valid method to document balance performance in individuals with PD. Both total and domain miniBESTest scores could differentiate between healthy subjects, PD-NF and PD-F.
APA, Harvard, Vancouver, ISO, and other styles
36

Stanković, Aleksandar, Goran Petrović, Danijel Marković, Žarko Ćojbašić, and Nikola Simić. "Metaheuristic algorithms for the flexible job-shop scheduling problem." IMK-14 - Istrazivanje i razvoj 26, no. 2 (2020): 49–56. http://dx.doi.org/10.5937/imk2002049s.

Full text
Abstract:
The problem with flexible job planning (FJSP) is a modification o f the classic job booking problem. This paper deals with the problem o f flexible job deployment and processing o f operations on one machine from a set o f alternative machines. The problem o f deploying flexible jobs in real time is one o f a group o f difficult NP problems (Non-deterministic polynomial time). The motive o f this paper is to show the application o f meta-heuristic algorithms on the example of flexible job schedules and present the appropriate method to future studies. To solve this problem, two meta-heuristic algorithms were used: Particle Swarm Optimization (PSO) and Artificial Bee Colony (ABC). The aim o f the paper is to achieve the speed o f the conversion solution in a series o f iterations, minimizing the total time o f deployment of jobs on an alternative set of machines, as well as minimizing the total schedule time. The problem o f deploying flexible jobs has great application, and with this test we propose an algorithm for solving this problem.
APA, Harvard, Vancouver, ISO, and other styles
37

Boël, Grégory, Paul C. Smith, Wei Ning, Michael T. Englander, Bo Chen, Yaser Hashem, Anthony J. Testa, et al. "The ABC-F protein EttA gates ribosome entry into the translation elongation cycle." Nature Structural & Molecular Biology 21, no. 2 (January 5, 2014): 143–51. http://dx.doi.org/10.1038/nsmb.2740.

Full text
APA, Harvard, Vancouver, ISO, and other styles
38

Daniel, Jaiyanth, Liz Abraham, Amanda Martin, Xyryl Pablo, and Shelby Reyes. "Rv2477c is an antibiotic-sensitive manganese-dependent ABC-F ATPase in Mycobacterium tuberculosis." Biochemical and Biophysical Research Communications 495, no. 1 (January 2018): 35–40. http://dx.doi.org/10.1016/j.bbrc.2017.10.168.

Full text
APA, Harvard, Vancouver, ISO, and other styles
39

Partohaghighi, Mohammad, Mustafa Inc, Mustafa Bayram, and Dumitru Baleanu. "On Numerical Solution Of The Time Fractional Advection-Diffusion Equation Involving Atangana-Baleanu-Caputo Derivative." Open Physics 17, no. 1 (December 31, 2019): 816–22. http://dx.doi.org/10.1515/phys-2019-0085.

Full text
Abstract:
Abstract A powerful algorithm is proposed to get the solutions of the time fractional Advection-Diffusion equation(TFADE): $^{ABC}\mathcal{D}_{0^+,t}^{\beta}u(x,t) =\zeta u_{xx}(x,t)- \kappa u_x(x,t)+$ F(x, t), 0 < β ≤ 1. The time-fractional derivative $^{ABC}\mathcal{D}_{0^+,t}^{\beta}u(x,t)$is described in the Atangana-Baleanu Caputo concept. The basis of our approach is transforming the original equation into a new equation by imposing a transformation involving a fictitious coordinate. Then, a geometric scheme namely the group preserving scheme (GPS) is implemented to solve the new equation by taking an initial guess. Moreover, in order to present the power of the presented approach some examples are solved, successfully.
APA, Harvard, Vancouver, ISO, and other styles
40

Kolobkova, Anastasia A. "The educational books on the French language in Russia in the XVIII century." Problems of Modern Education (Problemy Sovremennogo Obrazovaniya), no. 5, 2020 (2020): 163–71. http://dx.doi.org/10.31862/2218-8711-2020-5-163-171.

Full text
Abstract:
The article considers the features of the genesis and development of the first textbooks on the French language in the XVIII century in Russia. The most popular and well-known author’s textbooks are analyzed: V. E. Teplov’s translation work “New French grammar...”, based on the German compilation of the French grammar by P. Resto; A. de Lavy’s “the French ABC book”, which combines the norms and rules of a foreign language and the norms of Christian morality; Ya. Sigezbek’s “Instructing what it is in French for...”, which later became the first Soviet textbook of French; the Academy of Sciences’ “French ABC book”, which combined elements of de Lavy’s academic ABC book and secularizing pragmatism of Sigezbek’s “Instructions...”; “New French dictionary” by P. Bogdanovich for self-taught students, “the Leader” by F. Karzhavin, which became an academic manual for mature linguodidactics. The main trends in the development of the first educational books on the French language in the period under study are summarized; their main problem points and advantages are identified.
APA, Harvard, Vancouver, ISO, and other styles
41

Zhang, Yuan, Kai He, Xuhao Guo, Jia Jiang, Le Qian, Jianqiang Xu, Zhiping Che, Xiaobo Huang, and Shengming Liu. "Transcriptomic Profiling of Fusarium pseudograminearum in Response to Carbendazim, Pyraclostrobin, Tebuconazole, and Phenamacril." Journal of Fungi 9, no. 3 (March 8, 2023): 334. http://dx.doi.org/10.3390/jof9030334.

Full text
Abstract:
Fusarium pseudograminearum has been identified as a significant pathogen. It causes Fusarium crown rot (FCR), which occurs in several major wheat-producing areas in China. Chemical control is the primary measure with which to control this disease. In this study, transcriptome sequencing (RNA-Seq) was used to determine the different mechanisms of action of four frequently used fungicides including carbendazim, pyraclostrobin, tebuconazole, and phenamacril on F. pseudograminearum. In brief, 381, 1896, 842, and 814 differentially expressed genes (DEGs) were identified under the carbendazim, pyraclostrobin, tebuconazole, and phenamacril treatments, respectively. After the joint analysis, 67 common DEGs were obtained, and further functional analysis showed that the ABC transported pathway was significantly enriched. Moreover, FPSE_04130 (FER6) and FPSE_11895 (MDR1), two important ABC multidrug transporter genes whose expression levels simultaneously increased, were mined under the different treatments, which unambiguously demonstrated the common effects. In addition, Mfuzz clustering analysis and WGCNA analysis revealed that the core DEGs are involved in several critical pathways in each of the four treatment groups. Taken together, these genes may play a crucial function in the mechanisms of F. pseudograminearum‘s response to the fungicides stress.
APA, Harvard, Vancouver, ISO, and other styles
42

Tian, Ying, Ming Fang, and Shun’ichi Kaneko. "Absent Color Indexing: Histogram-Based Identification Using Major and Minor Colors." Mathematics 10, no. 13 (June 23, 2022): 2196. http://dx.doi.org/10.3390/math10132196.

Full text
Abstract:
The color histogram is a statistical behavior for robust pattern search or matching; however, difficulties have arisen in using it to discriminate among similar objects. Our method, called absent color indexing (ABC), describes how to use absent or minor colors as a feature in order to solve problems while robustly recognizing images, even those with similar color features. The proposed approach separates a source color histogram into apparent (AP) and absent (AB) color histograms in order to provide a fair way of focusing on the major and minor contributions together. A threshold for this separation is automatically obtained from the mean color histogram by considering the statistical significance of the absent colors. After these have been separated, an inversion operation is performed to reinforce the weight of AB. In order to balance the contributions of the two histograms, four similarity measures are utilized as candidates for combination with ABC. We tested the performance of ABC in terms of the F-measure using different similarity measures, and the results show that it is able to achieve values greater than 0.95. Experiments on Mondrian random patterns verify the ability of ABC to distinguish similar objects by margin. The results of extensive experiments on real-world images and open databases are presented here in order to demonstrate that the performance of our relatively simple algorithm remained robust even in difficult cases.
APA, Harvard, Vancouver, ISO, and other styles
43

Dahiya, Priyanka, Anil Kumar, Ashok Kumar, and Bijan Nahavandi. "Modified Artificial Bee Colony Algorithm-Based Strategy for Brain Tumor Segmentation." Computational Intelligence and Neuroscience 2022 (May 11, 2022): 1–13. http://dx.doi.org/10.1155/2022/5465279.

Full text
Abstract:
Medical image segmentation is a technique for detecting boundaries in a 2D or 3D image automatically or semiautomatically. The enormous range of the medical image is a considerable challenge for image segmentation. Magnetic resonance imaging (MRI) scans to aid in the detection and existence of brain tumors. This approach, however, requires exact delineation of the tumor location inside the brain scan. To solve this, an optimization algorithm will be one of the most successful techniques for distinguishing pixels of interest from the background, but its performance is reliant on the starting values of the centroids. The primary goal of this work is to segment tumor areas within brain MRI images. After converting the gray MRI image to a color image, a multiobjective modified ABC algorithm is utilized to separate the tumor from the brain. The intensity determines the RGB color generated in the image. The simulation results are assessed in terms of performance metrics such as accuracy, precision, specificity, recall, F-measure, and the time in seconds required by the system to segment the tumor from the brain. The performance of the proposed algorithm is computed with other algorithms like the single-objective ABC algorithm and multiobjective ABC algorithm. The results prove that the proposed multiobjective modified ABC algorithm is efficient in analyzing and segmenting the tumor from brain images.
APA, Harvard, Vancouver, ISO, and other styles
44

Camerini, A., D. Amoroso, O. Garrone, M. Vincenti, G. Tartarelli, S. Donati, C. Valsuani, O. Siclari, V. Polla Mattiot, and A. Sgambato. "Lipid lowering effect of fulvestrant in hormone-sensitive metastatic breast cancer patients." Journal of Clinical Oncology 25, no. 18_suppl (June 20, 2007): 1085. http://dx.doi.org/10.1200/jco.2007.25.18_suppl.1085.

Full text
Abstract:
1085 Background: Fulvestrant (F) is a pure anti-estrogen agent available for the HT of post-menopausal ormone-sensitive advanced breast cancer (ABC). Aim of the study is to analyze the effect(s) of F treatment on lipid profile, endometrial mucosa and coagulation indices (CI). Methods: 24 pts (mean age 66.2 ± 9.5 yrs) with hormone-sensitive ABC were enrolled. All patients (data on 21 pts) received at least one previous HT course, with 90.5% receiving =2 HT courses. Last HT was exemestane in 13/21, letrozole in 5/21 and other in 3/21 with a median withdrawal time of 19 days (range 3–1,456). All pts but one received at least one previous CT regimen, with 60% receiving =2 CT regimens. Complete fasting lipid blood profile and CI were assessed before F administration, every 3 months and at discontinuation. Endometrial mucosa thickness was evaluated before F administration and at end-study time. All patients referred no significant dietary changes during treatment. Pts receiving statins were excluded. Results: pts received a median of 6 F injections (range 3–14). We observed SD in 10/21 pts and PD in 11/21 pts with a mean TTP of 6.2 ± 2.9 months. Total cholesterol (C) levels significantly decreased during F treatment (214.1 ± 48.7 vs 194.0 ± 41.0 mg/dl; p=0.0084) together with LDL-C (119.5 ± 40.7 vs 104.2 ± 30.4 mg/dl; p=0.0067). HDL-C (62.4 ± 17.8 vs 64.3 ± 19.5 mg/dl; p = ns) and triglycerides (152.4 ± 64.5 vs 148.2 ± 61.6 mg/dl; p=ns) did not show significant changes. Subgroup analysis demonstrated a reduction in both pts receiving = 6 (n=17) or >6 (n=11) injections (204.6 ± 45.3 vs 186.6 ± 41.2 mg/dl, p=0.014 and 219.5 ± 48.9 vs 203.9 ± 33.3 mg/dl, p=ns respectively). All CI and mean endometrial mucosa thickness value did not vary. Conclusions: We observed a clear lipid lowering effect of F in our study population. We suggest a possible effect of F on lipid metabolism. Lipid lowering effect of F it’s evident during the first six months of treatment lasting in pts continuing therapy. No significant financial relationships to disclose.
APA, Harvard, Vancouver, ISO, and other styles
45

Brar, Indira, Peter Ruane, Douglas Ward, Jean-michel Molina, Anthony Mills, Mezgebe Berhe, Cynthia Brinson, et al. "1028. Long-term Follow-up After a Switch to Bictegravir, Emtracitabine, Tenofovir Alafenamide from Dolutegravir, Abacavir, Lamivudine." Open Forum Infectious Diseases 7, Supplement_1 (October 1, 2020): S543—S544. http://dx.doi.org/10.1093/ofid/ofaa439.1214.

Full text
Abstract:
Abstract Background Bictegravir, emtricitabine and tenofovir alafenamide (B/F/TAF) is a guidelines-recommended single-tablet regimen (STR) for people living with HIV-1 (PLWH). Week (W) 48 primary endpoint results of this phase 3 study switching to B/F/TAF from dolutegravir (DTG), abacavir (ABC) and lamivudine (3TC) established the safety and efficacy of B/F/TAF. Here we report outcomes from an open-label (OL) extension of B/F/TAF. Methods Adults virologically suppressed on DTG, ABC, and 3TC were randomized 1:1 to switch to B/F/TAF once daily or continue their current regimen as a STR in a double blind (DB) manner. Unblinding occurred after the W48 primary endpoint, then participants received B/F/TAF in an OL extension while transitioning off the study. All participants who received B/F/TAF in the DB or OL phases are included in analyses. Efficacy was assessed as the proportion with HIV-1 RNA &lt; 50 copies/mL at each study visit using missing=excluded (M=E) analysis, efficacy in in subgroups with pre-existing resistance was assessed using last observation carried forward. Safety was assessed by adverse events (AEs) and laboratory results. Results 563 participants were randomized and treated (282 B/F/TAF, 281 ABC/DTG/3TC); 524 (93%) completed the DB phase and received OL B/F/TAF; a total of 547 participants received B/F/TAF in DB and/or OL phases: 11% women, 21% Black, median age 47 yrs (range 21, 71). The median duration of B/F/TAF was 96 weeks (IQR 49-119). HIV-1 RNA &lt; 50 c/mL was maintained in 99-100% at all timepoints (M=E) through a maximum of 168 weeks, including high efficacy in those with archived resistance (Table 1). No participant developed resistance to B/F/TAF. Study drug-related AEs occurred in 7% on B/F/TAF; most were grade 1; the most common was headache (1.6%). 7 (1%) participants had an AE leading to premature study drug discontinuation, only 1, headache, occurred in the OL phase. Estimated GFR and lipids were mostly stable with slightly increased LDL at W96; weight changes are noted at W48 and W96. (Table 2). Table 1. Table 2. Conclusion Extended follow-up to the study of switching to B/F/TAF from DTG/ABC/3TC, demonstrates continued high rates of virologic suppression with no resistance and excellent safety and tolerability of B/F/TAF through a maximum of 168 weeks for treatment of PLWH. Disclosures Indira Brar, MD, Gilead (Speaker’s Bureau)janssen (Speaker’s Bureau)ViiV (Speaker’s Bureau) Peter Ruane, MD, AbbVie (Consultant, Grant/Research Support, Speaker’s Bureau)Bristol-Myers Squibb (Grant/Research Support)Gilead Sciences Inc. (Consultant, Grant/Research Support, Scientific Research Study Investigator, Shareholder, Speaker’s Bureau)Idenix (Consultant)Janssen (Grant/Research Support, Speaker’s Bureau)Viiv Healthcare (Grant/Research Support) Douglas Ward, MD, Gilead Sciences Inc. (Grant/Research Support, Scientific Research Study Investigator, Advisor or Review Panel member, Speaker’s Bureau)Merck (Advisor or Review Panel member)Viiv Healthcare (Advisor or Review Panel member, Speaker’s Bureau) Jean-michel Molina, MD, PhD, Bristol-Myers Squibb (Advisor or Review Panel member)Gilead Sciences Inc. (Grant/Research Support, Scientific Research Study Investigator, Advisor or Review Panel member)Janssen (Advisor or Review Panel member)Merck (Advisor or Review Panel member)Teva (Advisor or Review Panel member)Viiv Healthcare (Advisor or Review Panel member) Anthony Mills, MD, Gilead (Grant/Research Support, Advisor or Review Panel member)Janssen Pharmaceutica (Grant/Research Support, Advisor or Review Panel member)Merck (Grant/Research Support, Advisor or Review Panel member)Shionogi (Grant/Research Support)ViiV Healthcare (Grant/Research Support, Advisor or Review Panel member) Mezgebe Berhe, MD, Gilead Sciences Inc. (Grant/Research Support, Scientific Research Study Investigator) Cynthia Brinson, MD, Gilead (Advisor or Review Panel member, Speaker’s Bureau)ViiV Healthcare (Advisor or Review Panel member, Speaker’s Bureau) Moti Rampogal, MD, Gilead Sciences (Consultant, Research Grant or Support, Speaker’s Bureau)Janssen (Consultant, Research Grant or Support, Speaker’s Bureau)Merck (Consultant, Research Grant or Support)ViiV Healthcare (Consultant, Research Grant or Support, Speaker’s Bureau) Keith Henry, MD, Gilead (Research Grant or Support, Paid to institution)GSK/ViiV (Research Grant or Support, Paid to institution)Janssen (Research Grant or Support, Paid to institution)Merck (Research Grant or Support, Paid to institution) Hailin Huang, PhD, Gilead Sciences Inc. (Employee, Shareholder) Kristen Andreatta, MSc, Gilead Sciences (Employee, Shareholder) Hal Martin, MD, MPH, Gilead Sciences Inc. (Employee, Shareholder)
APA, Harvard, Vancouver, ISO, and other styles
46

Samen, Ulrike, Birgit Gottschalk, Bernhard J. Eikmanns, and Dieter J. Reinscheid. "Relevance of Peptide Uptake Systems to the Physiology and Virulence of Streptococcus agalactiae." Journal of Bacteriology 186, no. 5 (March 1, 2004): 1398–408. http://dx.doi.org/10.1128/jb.186.5.1398-1408.2004.

Full text
Abstract:
ABSTRACT Streptococcus agalactiae is a major cause of invasive infections in human newborns. To satisfy its growth requirements, S. agalactiae takes up 9 of the 20 proteinogenic amino acids from the environment. Defined S. agalactiae mutants in one or several of four putative peptide permease systems were constructed and tested for peptide uptake, growth in various media, and expression of virulence traits. Oligopeptide uptake by S. agalactiae was shown to be mediated by the ABC transporter OppA1-F, which possesses two substrate-binding proteins (OppA1 and OppA2) with overlapping substrate specificities. Dipeptides were found to be taken up in parallel by the oligopeptide permease OppA1-F, by the dipeptide ABC transporter DppA-E, and by the dipeptide symporter DpsA. Reverse transcription-PCR analysis revealed a polycistronic organization of the genes oppA1-F and dppA-E and a monocistronic organization of dpsA in S. agalactiae. The results of quantitative real-time PCR revealed a medium-dependent expression of the operons dppA-E and oppA1-F in S. agalactiae. Growth of S. agalactiae in human amniotic fluid was shown to require an intact dpsA gene, indicating an important role of DpsA during the infection of the amniotic cavity by S. agalactiae. Deletion of the oppB gene reduced the adherence of S. agalactiae to epithelial cells by 26%, impaired its adherence to fibrinogen and fibronectin by 42 and 33%, respectively, and caused a 35% reduction in expression of the fbsA gene, which encodes a fibrinogen-binding protein in S. agalactiae. These data indicate that the oligopeptide permease is involved in modulating virulence traits and virulence gene expression in S. agalactiae.
APA, Harvard, Vancouver, ISO, and other styles
47

Wang, Shuangchao, Shaojian Ruan, Mingming Zhang, Jianhua Nie, Clement Nzabanita, and Lihua Guo. "Interference of Small RNAs in Fusarium graminearum through FgGMTV1 Infection." Journal of Fungi 8, no. 12 (November 22, 2022): 1237. http://dx.doi.org/10.3390/jof8121237.

Full text
Abstract:
Small RNA (sRNA) plays a central role in RNA silencing in fungi. The genome of Fusarium graminearum gemytripvirus 1 (FgGMTV1) is comprised of three DNA segments: DNA-A, DNA-B, and DNA-C. DNA-A and DNA-B are associated with fungal growth and virulence reduction. To elucidate the role of RNA silencing during the interactions of fungi and viruses, the sRNA profiles of F. graminearum in association with FgGMTV1 were established, using an FgGMTV1-free library (S-S), a library for infection with the DNA-A and DNA-B segments (S-AB), and a library for infection with the DNA-A, DNA-B, and DNA-C segments (S-ABC). A large amount of virus-derived sRNA (vsiRNA) was detected in the S-AB and S-ABC libraries, accounting for 9.9% and 13.8% of the total sRNA, respectively, indicating that FgGMTV1 triggers host RNA silencing. The total numbers of sRNA reads differed among the three libraries, suggesting that FgGMTV1 infection interferes with host RNA silencing. In addition, the relative proportions of the different sRNA lengths were altered in the S-AB and S-ABC libraries. The genome distribution patterns of the mapping of vsiRNA to DNA-A and DNA-B in the S-AB and S-ABC libraries were also different. These results suggest the influence of DNA-C on host RNA silencing. Transcripts targeted by vsiRNAs were enriched in pathways that included flavin adenine dinucleotide binding, protein folding, and filamentous growth.
APA, Harvard, Vancouver, ISO, and other styles
48

GUBA, V. S., and M. V. SAPIR. "RIGIDITY PROPERTIES OF DIAGRAM GROUPS." International Journal of Algebra and Computation 12, no. 01n02 (February 2002): 9–17. http://dx.doi.org/10.1142/s0218196702000882.

Full text
Abstract:
In this paper we establish a rigid connection between two classical objects: the R. Thompson group F and the Dunce hat (the topological space obtained from the triangle ABC by gluing AB, BC, and AC). We prove that a diagram group of a directed 2-complex contains a copy of the R. Thompson group if and only if the 2-complex contains a copy of the Dunce hat.
APA, Harvard, Vancouver, ISO, and other styles
49

Mohamad, Merianne, David Nicholson, Chayan Kumar Saha, Vasili Hauryliuk, Thomas A. Edwards, Gemma C. Atkinson, Neil A. Ranson, and Alex J. O’Neill. "Sal-type ABC-F proteins: intrinsic and common mediators of pleuromutilin resistance by target protection in staphylococci." Nucleic Acids Research 50, no. 4 (February 7, 2022): 2128–42. http://dx.doi.org/10.1093/nar/gkac058.

Full text
Abstract:
Abstract The first member of the pleuromutilin (PLM) class suitable for systemic antibacterial chemotherapy in humans recently entered clinical use, underscoring the need to better understand mechanisms of PLM resistance in disease-causing bacterial genera. Of the proteins reported to mediate PLM resistance in staphylococci, the least-well studied to date is Sal(A), a putative ABC-F NTPase that—by analogy to other proteins of this type—may act to protect the ribosome from PLMs. Here, we establish the importance of Sal proteins as a common source of PLM resistance across multiple species of staphylococci. Sal(A) is revealed as but one member of a larger group of Sal-type ABC-F proteins that vary considerably in their ability to mediate resistance to PLMs and other antibiotics. We find that specific sal genes are intrinsic to particular staphylococcal species, and show that this gene family is likely ancestral to the genus Staphylococcus. Finally, we solve the cryo-EM structure of a representative Sal-type protein (Sal(B)) in complex with the staphylococcal 70S ribosome, revealing that Sal-type proteins bind into the E site to mediate target protection, likely by displacing PLMs and other antibiotics via an allosteric mechanism.
APA, Harvard, Vancouver, ISO, and other styles
50

Prieß, Marten, and Lars V. Schäfer. "Release of Entropic Spring Reveals Conformational Coupling Mechanism in the ABC Transporter BtuCD-F." Biophysical Journal 110, no. 11 (June 2016): 2407–18. http://dx.doi.org/10.1016/j.bpj.2016.04.027.

Full text
APA, Harvard, Vancouver, ISO, and other styles
We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!

To the bibliography