Journal articles on the topic 'A P M Forests Pty Ltd'

Recent drilling by BHP Billiton Pty Ltd in WA-155-P(1) and WA-12-R, on behalf of its partners Apache Energy Ltd and INPEX ALPHA LTD, has resulted in the discovery of four oil fields in the southern Exmouth Sub-basin, namely Ravensworth, Crosby, Stickle and Harrison. These discoveries, together with the earlier discoveries made by West Muiron–5 and Pyrenees–2, define the Early Cretaceous Pyrenees Member play fairway.The Pyrenees Trend play was first conceived in 1999 following appraisal of the Macedon gas field (Keall, 1999), but the concept remained dormant until the integration of geological information with high quality 3D seismic data led to the recognition of hydrocarbon related seismic attributes in the postulated play fairway.Ravensworth–1 intersected a 37 m gross oil column below a 7 m gas cap in high quality Pyrenees Member sandstones beneath the regionally significant Intra- Hauterivian Unconformity. Ravensworth, located on a northeast–southwest trending fault terrace, is a complex structural-stratigraphic trap that relies on separate top, base and cross-fault seals. High quality 3D seismic data coupled with recent interpretation techniques were integral to its discovery. In particular, the quantitative interpretation of seismic amplitude populations was a key factor in decreasing exploration risk.The Ravensworth discovery was followed by successful exploration wells on the adjacent Crosby, Stickle and Harrison fault terraces. Four appraisal wells have since been drilled at the northern ends of the main discoveries.The oil in the Pyrenees Member discoveries is biodegraded, moderately viscous (8–11 cp) and heavy (18–19° API gravity). Methane-dominated gas caps were intersected in Ravensworth–1, West Muiron–5 and Pyrenees–2.The recent drilling and coring campaigns by BHP Billiton and others in the Exmouth Sub-basin have significantly advanced knowledge of the stratigraphy and depositional environments of the late Tithonian to early Berriasian Macedon, Muiron and Pyrenees Members of the lower Barrow Group. The lower Barrow Group is a third order sequence deposited rapidly in marine to fluviodeltaic environments in response to the breakup of Gondwana and the onset of active rifting along the West Australian margin.BHP Billiton and its joint venture partners are assessing the commercial viability of the Pyrenees Trend discoveries.

Background: Literature suggests an association between shift work and cardiovascular disease (CVD). Limited evidence is available on how a cessation of shift work affects CVD risk factors. Aim: We investigated whether a five-month plant shutdown affected CVD risk factors in 30 industrial shift workers. Methods: We collected demographic data, self-reported data on physical activity (PA) and medical history by questionnaire. Pre- and post-plant shutdown, we measured blood pressure (BP), heart rate, lipids, glycosylated hemoglobin (HbA1c) and C-reactive protein (CRP). Additionally, we collected markers of inflammation, Matrix metalloproteinase-9 (MMP-9), Interleukin-6 (IL-6), Monocyte chemoattractant protein-1 (MCP-1), Tumor necrosis factor-alpha (TNF-α), P-selectin, Interleukin-1 beta (IL-1β), and Interleukin-23 (IL-23). We also examined arterial stiffness (central blood pressure, augmentation pressure, and pulse wave velocity) by means of SphygmoCor® (AtCor Medical Pty Ltd., Sydney, Australia). We monitored sleep by actigraphy prior to and after plant shutdown, with additional registration of sleep quality and assessment of insomnia symptoms. Results: After five months of plant shutdown, we found that HbA1c increased by 1.9 mmol/mol, weight by 1 kg and MCP-1 by 27.3 pg/mL, all unexpectedly. The other markers of inflammation did not change during shutdown, but CRP decreased close to significant levels. There were no changes in lipids during follow-up. Pulse-wave velocity (PWV) was reduced from 8.1 m/s (SD = 1.5) to 7.6 m/s (SD = 1.5), p = 0.03. The workers reported fewer signs of insomnia after shutdown. Conclusions: Our findings suggest that a five-month cessation in shift work increases weight and HbA1c, but also improves insomnia symptoms and reverses arterial stiffening.

Abstract Aim: To perform a systematic review of the efficacy of monotherapy with bortezomib versus thalidomide in patients with relapsed or refractory multiple myeloma. Methods: Published English literature from 1966 to June 2005 (MEDLINE, EMBASE, Cochrane library), publication reference lists, Janssen-Cilag Pty Ltd data-on-file, and abstracts from recent multiple myeloma conferences were reviewed. Prospective studies containing at least a single arm of any treatment group with n ≥ 30 and using continuing or variable thalidomide dosing were included. Studies adding dexamethasone for non-responders were excluded. Outcomes were analysed on an intent-to-treat basis. Statistical pooling was performed where possible for the following outcome measures: primary outcome of response rate, defined by a serum M-protein reduction ≥50% (A) and strict (e.g. EBMT) criteria (B), and for the secondary outcomes of overall survival and progression-free survival. Results: One bortezomib (n=333, APEX, NEJM2005, 352; 2487–98) and 15 thalidomide (n=1007) studies were included. Patient baseline characteristics including age, gender, IgG:IgA, disease duration and β2M were well matched, except that 48% of bortezomib patients had received prior thalidomide. On an intent-to-treat basis, the overall estimate for response rate (A) was 53% for patients receiving bortezomib versus 32% for thalidomide (p<0.001, n=10 studies). For response rate (B) the estimate was 36% for patients receiving bortezomib versus 22% for thalidomide (p<0.001, n=4 studies). One-year survival was 81% for patients receiving bortezomib versus 67% for thalidomide (p<0.001, n=6 studies). Due to differences in disease monitoring and definitions of progression, it was not possible to compare results for progression-free survival. Conclusion: In patients with relapsed or refractory multiple myeloma, bortezomib achieved significantly higher response rates and longer one-year survival than thalidomide, despite 48% of bortezomib-treated patients having received prior thalidomide.

At the present time the great part of soils is exposed to various negative processes. One of the basic processes that lead to the degradation of soils in Ukraine is the erosion. According to the recent data, water and wind erosion covers 13.9 million hectares; it is about 33 % of the total arable land in the country. On this basis, the greater relevance belongs to the scientific studies displaying the features of negative phenomena of our soil, and, most importantly, the ways of solving of these urgent problems on the soil cover of Ukraine. The monograph «Soil erosion in Ukraine: the evolution of theory and practice» of such famous scientists in the field of Soil Erosion Science as Voloshchuk M. D., Petrenko N. I. and Yatsenko S. V. is one of such fundamental works. In the present monograph, considerable attention is paid to the periodization of the formation and development of the doctrine of soil erosion in Ukraine. The authors identify six basic stages of formation of the national Soil Erosion Science. The paper discusses the characteristic features of isolation of Soil Erosion Science as an independent scientific direction and a self-discipline, which are based on the works of such renowned scientists as P. S. Tregubov, M. N. Zaslavsky and G. I. Shvebs. A significant place in the monograph is devoted to the characteristics of the scientific centers of Ukraine, in which the Soil Erosion Science has been developed. These centers are distinguished by leading scientists, under the leadership of whom, the erosion processes have been studied. The authors of the monograph provides four main scientific centers of the country in the field of Soil Erosion Science development: National Scientific Centre «Institute of Agriculture of the National Academy of Agricultural Sciences» (central region), National Scientific Center «Institute for Soil Science and Agrochemistry Research named after O. N. Sokolovsky», Scientific-Technical Center «Fertility» (Kharkiv region), Odessa I. I. Mechnikov National University (south region), Lviv National Agrarian University, Institute of Ecology of the Carpathians of National Academy of Sciences of Ukraine, Ivan Franko National University of Lviv and others (west region). In addition to considering the features of the listed centers, in the work there is a presentation of a brief description of the project, research institutes, agricultural and agroforestry research stations that are active in a scientific work in relation to soil erosion processes. In the work, there are also the historical aspects and mechanisms for the further development of wind erosion researches. Considerable attention the authors of the monograph pay to the analysis of the current state, challenges and prospects of solving the problem on protecting the soil from erosion. The main problem of the country's soil, which is the cause of widespread erosion, is a very high agricultural development of the territory, more than half of which falls onto an arable land. At the end of the monograph, there are a large number of photos, provided by Professor M. D. Voloshchuk, which recorded various aspects of soil erosion manifestations, as well as the ways of its overcoming in the conditions of forest-steppe and steppe zones in Ukraine and on the territory of Moldova. The reviewed monograph is certainly a very relevant and timely generalizing scientific research that will be useful in the theoretical and practical use of students, academic staff of the natural and agricultural higher education institutions, research organizations.

The basidiomycete Heterobasidion annosum (Fr.) Bref. (=Fomes annosus (Fr.) Cooke), one of the most important pathogens in coniferous forests in Europe, Asia, and North America, causes root and butt rot. H. annosum was first recorded on Pinus pinaster Ait. (commonly known as Maritime pine) in France and Great Britain in 1961 (4) and Portugal in 1986 (2). P. pinaster is the most widespread conifer in Spain, with more than 700,000 and 600,000 ha in pure and mixed stands, respectively. Over the last few years, P. pinaster decline was observed in several stands in the center of the Iberian Peninsula. Unusual crown transparency, small needles, foliage discoloration, and early tree death are characteristic decline symptoms associated with the high mortality rate on this species. In June of 2010, 11 trees (40 to 60 years old) with a different degree of decline were felled in two zones (42°2′41″N, 3°18′14″W, elevation 1,096 m and 41°55′40″N, 3°12′3″W, elevation 1,128 m) and cut into sections (stump height, breast height, and near the top). Wood slices were removed from each section and taken to the laboratory. Samples were placed in moist chambers with optimal conditions of humidity and temperature to enhance pathogen growth. After 20 days of incubation in darkness at 25°C, H. annosum (anamorph Spiniger meineckellum [A. Olson] Stalpers) occurred on most of these slices. Conidiophores with subglobose to pyriform conidia (5.8 × 4.2 μm) were observed with a compound microscope. The fungus was isolated to extract DNA by disruption of the mycelium followed by washes with phenol/chloroform/isoamyl alcohol solution (25:24:1). DNA was precipitated with 20% polyethylene glycol solution. PCR was carried out according to the instructions of the manufacturer of Dynazyme II DNA polymerase (Finnzymes Ltd, Espoo, Finland) with ITS primers, 1F (5′-CTTGGTCATTTAGAGGAAGTAA-3′) and 4 (5′-TCCTCCGCTTATTGATATGC-3′). After DNA purification, samples were sequenced (SECUGEN, Madrid, Spain) and aligned and corrected with Geneious Pro 5.3 to obtain the consensus sequences. Resulting DNA sequences of two isolates were deposited in GenBank (Nos. FR850494 and FR850495), and compared with a Blastn search at GenBank showing 100% identity and 100% coverage with H. annosum sensu stricto, former ISG-P (intersterility group of pines). For pathogenicity tests, 10 seedlings (2 year old) were inoculated with autoclaved P. pinaster wood chips colonized by H. annosum, and 10 control seedlings were inoculated with noncolonized wood chips. Inoculums were prepared by growing H. annosum on 4-mm-diameter wood chips placed on potato dextrose agar media for 3 weeks. The wood chips were put inside an oblique incision made at 6 cm above the soil line and wrapped with Parafilm. After 8 weeks in a growth chamber at 22.5°C with a 14-h photoperiod, the inoculated seedlings showed typical symptoms and 3 seedlings of 10 were dead. H. annosum was previously recorded on P. sylvestris in central Spain (1), causing needle drop, swelling at the stump height, and presence of dead trees by circular areas. This pathogen was also reported on P. nigra in northeastern Spain, associated with defoliation and mortality (3). To our knowledge, this is the first record of H. annosum on P. pinaster in Spain. References: (1) J. Benito-Martínez. An. Jardín Bot. Madrid 3:23, 1943. (2) N. Neves et al. EPPO Bull. 16:505, 1986. (3) J. Oliva et al. Bol. Sanidad Vegetal. Plagas. 34:415, 2008. (4) P. Spaulding. US Dep. Agric. Agric. Handb. 197:100, 1961.

In 2003 and 2004, a survey of grapevine (Vitis vinifera L.) trunk pathogens was conducted in 30 vineyards in the Western and Northern Cape and Limpopo provinces of South Africa. In each vineyard, 20 visually healthy plants were sampled randomly by removing the distal part of one cordon arm. Isolations were made onto potato dextrose agar (PDA) from the internal wood decay symptoms observed in the cordon samples. Seven Botryosphaeriaceae spp. were identified, including Lasiodiplodia crassispora (1). Other Botryosphaeriaceae spp. are known grapevine trunk pathogens (2). Species identity was confirmed by DNA sequence data of the partial translation factor 1-α gene (1) and sequences deposited in GenBank (GU233658 and GU233659). The L. crassispora isolates (CBS 125626 and 125627) were associated with brown internal necrosis, a known symptom of grapevine Botryosphaeriaceae spp. infection (3), in the cordon arms of Ruby Cabernet grapevines occurring in two vineyards in the Northern Cape Province. L. crassispora was described from cankered wood of Santalum album in Western Australia and endophytically from Eucalyptus urophylla in Venezuela (1). Its grapevine pathogen status was determined using both isolates in a repeated pathogenicity test that included three isolates each of Botryosphaeria dothidea and Neofusicoccum australe as positive controls (2), Trichoderma harzianum as a nonpathogen treatment, and an uncolonized agar plug as a negative control. The Botryosphaeriaceae spp. and T. harzianum were plated on PDA and incubated at 25°C for 7 days. Lignified, 6-month-old shoots of grapevine cv. Chardonnay were excised from grapevines with internodes 4 to 6 used for inoculations. Before wounding, shoots were disinfected by submersion for 1 min in a 1 ml/liter solution of a quaternary ammonium compound (Sporekill; ICA International Chemicals (Pty) Ltd, Stellenbosch, South Africa). Twelve shoots were used for each isolate or control treatment. Wounds were made 2 mm deep on the fifth internode of the shoots with a 5-mm flame-sterilized cork borer (2,3). Wounds were inoculated with a pathogen colonized agar plug (5 mm in diameter) or an uncolonized agar plug and then covered with Parafilm (2,3). Inoculated shoots were incubated in the dark in moist chambers for 14 days at 25°C. After incubation, the bark of the shoots was peeled from the area around the wound and the lengths of any resultant lesions were measured under sterile conditions. The inoculum effect was assessed by analysis of variance and Student's t-test. Results showed that significantly (P < 0.0001) longer lesions were caused by L. crassispora (13.36 mm) compared with N. australe (9.27 mm) and B. dothidea (5.28 mm) and also significantly longer than lesions caused by the nonpathogen and negative controls (3.23 and 2.90 mm, respectively). To determine if lesions were caused by inoculated fungi, isolations were made from the tissue at the edges of the lesions by aseptically removing five 0.5 × 1 mm pieces of wood and placing them on PDA dishes amended with 0.04 g/liter of streptomycin sulfate. Dishes were incubated under normal fluorescent light at 25°C for 14 days before identifying isolated fungi based on morphological and cultural characteristics (1). To our knowledge, this is the first report of L. crassispora as a grapevine pathogen. References: (1) T. I. Burgess et al. Mycologia 98:423, 2006. (2) J. M. van Niekerk et al. Mycologia 96:781, 2004. (4) J. M. van Niekerk et al. Phytopathol. Mediterr. 45:S43, 2006.

Background: Approximately 40% of patients with diffuse large B-cell lymphoma (DLBCL) are &gt;70 years old and have poor clinical outcomes attributable to treatment-related factors or to disease biology. Genotyping data in elderly DLBCL patients is limited because of lack of representation in clinical trials. R-mini-CHOP is better tolerated than R-CHOP in elderly DLBCL but with reduced efficacy. The addition of ibrutinib to R-CHOP has been shown to be effective in younger pts aged &lt; 60 years but is associated with poor tolerability and outcomes in older patients. The ALLG Ibrutinib with R-mini-CHOP (IRiC) study, a prospective multicentre single-arm phase II study in elderly (≥ 75 years) DLBCL patients provided an opportunity to genotype this uncommon cohort. We therefore aimed to map the genetic landscape of mutations in elderly DLBCL and compare them to a non-trial younger cohort. Methods: Mutations in genes commonly associated with DLBCL were assessed in 55 IRIC study patients with a median age of 81 years (75-91 years) and a gender ratio of 1.0 (27 M/28 F). A cohort of 51 non-trial patients withde novoDLBCL treated with anthracycline-based regimens was also genotyped. The median age of the control group was 65 years (29-91 years) with a gender ratio of 1.2:1 (28 M/23 F). The cell of origin (COO) measured using gene expression profiling on 39/55 trial patients (non-GC=13, GC= 22, unclassified= 4), and Hans algorithm on 45/51 non-trial patients (non-GC=14, GC=31) was comparable (p=0.571). Outcome data was available at a median follow-up of 18 and 40 months for the trial and non-trial cohorts respectively. We extracted genomic DNA from and performed next generation sequencing on diagnostic formalin-fixed paraffin-embedded or fresh frozen tissue samples using a customized capture library (SureSelectXT Target Enrichment System, Aqilent Technologies) covering genes involved in lymphomagenesis. The purified libraries were sequenced on the Illumina NextSeq500 platform at AGRF (Australian Genome Research Facility, Australia). Mutations in the following genes were compared across the two cohorts: ARID1A, BCL2, BTG1, BTG2, CARD11, CCND3, DTX1, EP300, ETS1, EZH2, FOXO1, GNA13, HIST1H1C, IKBKB, IRF8, KDM2B, KLHL6, MYC, MYD88, NOTCH1, NOTCH2, PIK3CD, PIM1, PRDM1, PTEN, PTPN21, SGK1, SPEN, STAT3, TET2, TNFAIP3, TNFRSF11A, TNFRSF14, TP53 and TRAF5. Statistical analysis for nominal data was done using the chi-square test and for ordinal data using the Kruskal-Wallis test (p &lt; 0.05= significant). Kaplan-Meier curves were calculated for patients with and without each mutation and the curves compared using a log-rank approach. Results: Patients were divided into 2 groups, IRiC trial cohort aged &gt;75 years (n=55) + non-trial elderly patients &gt;75 years (n=9) =elderly cohort(n=64) and non-trialnon-elderly cohortof patients &lt; 75 years (n=42). As expected, elderly patients were more likely to have high-risk disease with higher IPI of ≥ 3 (n=42, n=17, p=0.009). There was no significant difference in gender or COO. The frequency of mutations in the elderly (n=64) was compared to the non-elderly cohort (n=42). NOTCH2 was the most common mutation irrespective of age (34 [53%]; 16 [38%], p=0.129). Notably, we found that mutations in MYC (8 [12.5%]; 0, p= 0.021), PTEN (17 [26.5%]; 4 [9%], p=0.045) and TET2 (28 [43.7%]); 7 [16.6%], p=0.004) were more frequent in the elderly. As expected, MYD88 and CD79B mutations were more frequently associated with non-GC subtype (p=0.001). No other associations with COO were identified. No clear prognostic individual genes or gene clusters could be identified in the trial or the elderly cohort. Ibrutinib-responsive (MYD88 [L265P n=7] and CD79B [n=11]) and ibrutinib-resistant mutations (CARD11 [n=6] or PIM1 [n=12]) did not show clear associations with response rate, overall survival or progression-free survival. Conclusions: Our study found that the mutational profile of elderly DLBCL patients aged ≥ 75 years is enriched for targetable mutations in MYC, PTEN and TET2 compared to those &lt; 75 years. PTEN and TET2 are tumour suppressors and MYC is an oncogene with an important regulatory role in cell growth and proliferation. We hypothesize that hypo-methylating agents targeting TET2, BET inhibitors in MYC mutated tumours and PI3K inhibitors to target PTEN deficient lymphoma may help improve clinical outcomes in elderly DLBCL. No clear prognostic markers were identified in this small cohort. Disclosures Trotman: Celgene:Research Funding;BeiGene:Research Funding;Takeda:Research Funding;PCYC:Research Funding;F. Hoffmann-La Roche:Research Funding.Verner:Janssen Cilag Pty Ltd.:Research Funding.Gandhi:Celgene:Research Funding;Bristol-Myers Squibb:Research Funding;Mater Research:Current Employment;Janssen-Cilag:Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding;Roche:Other: Travel, accommodation, expenses ;Genentech:Honoraria;Gilead Sciences:Honoraria;Amgen:Honoraria;Merck Sharp & Dohme:Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees.Gandhi:Integrated Sciences:Current Employment.Talaulikar:Takeda:Research Funding;Amgen:Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding;Janssen:Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding, Speakers Bureau;Roche:Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding.

Abstract Introduction R-mini-CHOP is an established standard of care in elderly patients with DLBCL, with a 2yr OS of 59% and PFS of 47% (Peyrade et al, Lancet Oncol 2011). The addition of ibrutinib to full dose R-CHOP in younger pts with DLBCL has efficacy, but significant toxicity limits the ability to complete therapy in pts ≥60 yrs (Younes et al, JCO 2019). We previously demonstrated the deliverability of ibrutinib with R-mini-CHOP in 80 pts ≥75yrs with DLBCL with a median average relative total dose of 97%; 77% of pts received 6 cycles of R-mini-CHOP despite SAEs in 62% (Verner et al, Haematol Oncol 2019). Here we present the primary efficacy endpoint and key secondary and exploratory endpoints. Methods This was a prospective, multicenter, single-arm, phase 2 study of patients aged ≥75yrs with newly diagnosed DLBCL. Pts received six 21-day cycles of ibrutinib 560mg/d and R-mini-CHOP (Rituximab 375mg/m 2, cyclophosphamide 400mg/m 2, doxorubicin 25mg/m 2, vincristine 1mg on day 1 & prednisone 40mg/m 2 or 100mg/d x 5) followed by an additional two 21-day cycles of rituximab + ibrutinib (or high dose methotrexate for CNS prophylaxis). The efficacy primary endpoint was 2yr OS. Sample size calculations were made using a one-sample two-sided approach to detect a 15% improvement on the fixed reference OS (59%) and PFS (47%) rates (Peyrade et al, Lancet Oncol 2011). Results Eighty pts were recruited from Nov 2015 to Dec 2018. One died prior to receiving treatment and is not included in the analysis. Median age was 82yrs (75-95); 51% female, 81% stage III/IV and 63% IPI 3-5: 47% had a CIRS-G score of ≥6 (range 0-17). On centralized immunohistochemistry (IHC), 57% (45/79) were non-Germinal Centre B cell-like (GCB) subtype; 43% (34/79) were GCB. At a data cut-off of 6June 21, median follow-up was 29.5 months (m) (0.2 to 66.3). Two-year OS was 68% (95% CI 55-77%), not differing significantly from the null hypothesis of 59% (p=0.10), (Figure 1A). Median OS was not reached (NR) (95% CI 34m to NR), and was longer in those with lower IPI (IPI 1-3: NR, IPI 4: 35m, IPI 5: 19m). Two-year PFS was 60% (95% CI 47-70%), significantly different from the reference 47% (p&lt;0.03), (Figure 1B). Median PFS was NR (95% CI 20m to NR). Two-year DFS was 85% (95% CI 60-95%), median NR (95% CI 32m to NR). COO had no impact on either 2yr OS [median GCB NR (95% CI 29m to NR), median non-GCB NR (95% CI 24m to NR) p=0.99] or 2yr PFS [median GCB 39m (95% CI 17m to NR), median non-GCB NR (95% CI 19m to NR) p=0.97]. Cause of death in 28/79 pts (35%) was: 16 progressive lymphoma, 5 infection, 2 respiratory failure, 2 other malignancy, 1 cardiac arrest, 1 intra-abdominal hemorrhage, 1 gastric hemorrhage. At least one adverse event (AE) occurred in 99% pts (78/79): 30% (24/79) grade 1-2, 64% (49/79) grade 3-4, and 6% (5/79) grade 5. Most common grade ≥3 AEs were lung infection (13%), other infections (11%), anemia (11%), febrile neutropenia (9%), thrombocytopenia (9%), and atrial fibrillation (8%). Serious AEs occurred in 67%: most commonly lung infection (11%), atrial fibrillation (9%), fever (9%), and other infection (9%). 12/14 pts with atrial fibrillation/flutter were new onset. Ibrutinib was temporarily ceased in 62% of patients, and permanently ceased in 25%, mostly due to adverse events. As previously reported, the overall response rate on an intention to treat basis was 57/80 (71%) (Verner et al, ASH 2019). Response rates did not differ by cell of origin (COO) (ORR: non-GCB 76%, GCB 68% p=0.44). When recorded, pt's EORTC-QLQ-C30 global health status significantly improved between screening [n=78; mean (SD) 58(25)], end of treatment [n=57; 63(23)] and 18mo post-treatment [n=29; 74(19)] p=0.007. Significant reductions in fatigue, nausea and vomiting, pain, insomnia, appetite loss, constipation and diarrhea were also observed in respondents. There was no impact of CIRS-G score on disease response rate or risk of death. Conclusion The addition of ibrutinib to R-mini-CHOP was deliverable and improved 2-yr PFS compared to R-mini-CHOP alone. However, while there was a trend towards improvement in 2-yr OS, a target 15% increase was not achieved in this small sample size. Despite considerable and not unexpected toxicity in this elderly cohort, the QOL and functional improvements in survivors are also promising. These data support further study of the addition of ibrutinib to R-mini-CHOP in elderly patients with DLBCL. Figure 1 Figure 1. Disclosures Verner: Janssen-Cilag Pty Ltd: Research Funding. Hawkes: Merck KgA: Research Funding; Bristol Myers Squib/Celgene: Membership on an entity's Board of Directors or advisory committees, Research Funding; Specialised Therapeutics: Consultancy; Antigene: Membership on an entity's Board of Directors or advisory committees; Novartis: Membership on an entity's Board of Directors or advisory committees; Janssen: Speakers Bureau; Gilead: Membership on an entity's Board of Directors or advisory committees; Regeneron: Speakers Bureau; Merck Sharpe Dohme: Membership on an entity's Board of Directors or advisory committees; Roche: Membership on an entity's Board of Directors or advisory committees, Other: Travel and accommodation expenses, Research Funding, Speakers Bureau; Astra Zeneca: Membership on an entity's Board of Directors or advisory committees, Research Funding, Speakers Bureau. Lee: Roche: Honoraria; BeiGene: Membership on an entity's Board of Directors or advisory committees. Cheah: BMS: Consultancy, Research Funding; Abbvie: Research Funding; Janssen: Consultancy, Honoraria; MSD: Consultancy, Honoraria; Gilead: Consultancy, Honoraria; Ascentage Pharma: Consultancy, Honoraria; AstraZeneca: Consultancy, Honoraria; Lilly: Consultancy, Honoraria; TG therapeutics: Consultancy, Honoraria; Beigene: Consultancy, Honoraria; Novartis: Consultancy, Honoraria; Roche: Consultancy, Honoraria, Other: travel, Research Funding. Purtill: Novartis: Honoraria; Gilead: Honoraria; BMS Celgene: Honoraria. Enjeti: Novartis: Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Roche: Speakers Bureau; AbbVie: Honoraria; Sanofi: Honoraria; Astra Zeneca: Honoraria. Curnow: Bayer: Consultancy, Research Funding; Pfizer/BMS: Consultancy, Honoraria; Mylan: Consultancy; Norgine: Consultancy, Honoraria. Butcher: WriteSource: Current Employment, Other: Medical writing for Pharma companies. Not pertinent to this abstract for which author is study Statisticiam. Trotman: JANSSEN: Research Funding; TAKEDA: Research Funding; BMS: Research Funding; PCYC: Research Funding; roche: Research Funding; beigene: Research Funding. OffLabel Disclosure: Ibrutinib is not approved for use in DLBCL

The study aims to assess the rate of erosion that occurred in Manjunto Watershed and financial loss using Geographic Information System and Remote Sensing. Model used to determine the erosion is E30 models. The basis for the development of this model is to integrate with the slope of the slope between NDVI. The value of NDVI obtained from satellite imagery. Slope factor obtained through the DEM processing. To determine the amount of economic losses caused by erosion used the shadow prices. The amount of nutrients lost converted to fertilizer price. The results showed that the eroded catchment area has increased significantly. The rate of average annual erosion in the watershed Manjunto in 2000 amounted to 3 Mg ha-1 yr-1. The average erosion rate in the watershed Manjunto annual increase to 27 Mg ha-1 yr-1 in the year 2009. Economic losses due to erosion in 2009 was Rp200,000,- for one hectare. Total losses due to erosion for the total watershed area is Rp15,918,213,133, -. The main factor causing the high rate of erosion is high rainfall, slope and how to grow crops that do not pay attention to the rules of conservation.Keywords: Soil erosion, digital elevation model, GIS, remote sensing, valuation erosion[How to Cite: Gunawan G, D Sutjiningsih, H Soeryantono and S Widjanarko. 2013.Soil Erosion Prediction Using GIS and Remote Sensing on Manjunto Watershed Bengkulu-Indonesia. J Trop Soils 18 (2): 141-148. Doi: 10.5400/jts.2013.18.2.141][Permalink/DOI: www.dx.doi.org/10.5400/jts.2013.18.2.141]REFERENCESAksoy E, G Ozsoy and MS Dirim. 2009. Soil mapping approach in GIS using Landsat satellite imagery and DEM data. Afr J Agric Res 4: 1295-1302.Ananda J and G Herath. 2003. Soil erosion in developing countries: a socio-economic appraisal. J Environ Manage 68: 343-353.Ananda J, G Herath and A Chisholm. 2001. Determination of yield and Erosion Damage Functions Using Subjectivly Elicited Data: application to Smallholder Tea in Sri Lanka. Aust J Agric Resour Ec 45: 275-289.Ande OT, Y Alaga and GA Oluwatosin. 2009. Soil erosion prediction using MMF model on highly dissected hilly terrain of Ekiti environs in southwestern Nigeria. Int J Phys Sci 4: 053-057.Arnold JG, BA Engel and R Srinivasan. 1998. A continuous time grid cell watershed model. Proc. of application of Advanced Technology for management of Natural Resources.Arsyad S. 2010. Konservasi Tanah dan Air. IPB Press. Bogor-Indonesia (in Indonesian).Asdak C.1995. Hydrology and Watershed Management. Gadjah Mada University Press, Yogyakarta.Barlin RD and ID Moore. 1994. Role of buffer strips in management of waterway pollution: a review. Environ Manage 18: 543-58.Brough PA.1986. Principle of Geographical Information Systems For Land Resources Assessment. Oxford University Press, 194p.Clark B and J Wallace. 2003. Global connections: Canadian and world issues. Toronto, Canada: Pearson Education Canada, Inc.Cochrane T A and DC Flanagan. 1999. Assessing water erosion in small watershed using WEPP with GIS and digital elevation models. J Soil Water Conserv 54: 678 685.Dames TWg. 1955. The Soils of East Central Java; with a Soil Map 1:250,000. Balai Besar Penjelidikan Pertanian, Bogor, Indonesia.Dixon JA, LF Scura, RA Carpenter and PB Sherman. 2004. Economic Analysis of Environmental Impacts 2nd ed. Eartscans Publication Ltd., London.Fistikoglu O and NB Harmancioglu. 2002. Integration of GIS with USLE in Assessment of Soil Erosion. Water Resour Manage 16: 447-467.Green K. 1992. Spatial imagery and GIS: integrated data for natural resource management. J Forest 90: 32-36.Hazarika MK and H Honda. 2001. Estimation of Soil Erosion Using Remote Sensing and GIS, Its Valuation & Economic Implications on Agricultural Productions. The 10th International Soil Conservation Organization Meeting at Purdue University and the USDA-ARS Soil Erosion Research Laboratory.Hazarika S, R Parkinson, R Bol, L Dixon, P Russell, S Donovan and D Allen. 2009. Effect of tillage system and straw management on organic matter dynamics. Agron Sustain Develop 29: 525-533. doi: 10.1051/agro/2009024. Honda KL, A Samarakoon, Y Ishibashi, Mabuchi and S Miyajima.1996. Remote Sensing and GIS technologies for denudation estimation in Siwalik watershed of Nepal,p. B21-B26. Proc. 17th Asian Conference on Remote Sensing, Colombo, Sri lanka.Kefi M and K Yoshino. 2010. Evaluation of The Economic Effects of Soil Erosion Risk on Agricultural Productivity Using Remote Sensing: Case of Watershed in Tunisia. International Archives of the Photogrammetry, Remote Sensing and Spatial Information Science, Volume XXXVIII, Part 8, Kyoto Japan.Kefi M, K Yoshino, K Zayani and H Isoda. 2009. Estimation of soil loss by using combination of Erosion Model and GIS: case of study watersheds in Tunisia. J Arid Land Stud 19: 287-290.Lal R. 1998. Soil erosion impact on agronomic productivity and environment quality: Critical Review. Plant Sci 17: 319-464.Lal. 2001. Soil Degradation by Erosion. Land Degrad Develop12: 519-539.Lanya I. 1996. Evaluasi Kualitas lahan dan Produktivitas Lahan Kering Terdegradasi di Daerah Transmigrasi WPP VII Rengat Kabupaten Indragiri Hulu, Riau. [Disertasi Doktor]. Program Pasca Sarjana IPB, Bogor (in Indonesian).Mermut AR and H Eswaran. 2001. Some major developments in soil science since the mid 1960s. Geoderma 100: 403-426.Mongkolsawat C, P Thurangoon and Sriwongsa.1994. Soil erosion mapping with USLE and GIS. Proc. Asian Conf. Rem. Sens., C-1-1 to C-1-6.Morgan RPC, Morgan DDV and Finney HJ. 1984. A predictive model for the assessment of erosion risk. J Agric Eng Res 30: 245-253.Morgan RPC. 2005. Soil Erosion and Conservation. 3rd ed. Malden, MA: Blackwell Publishing Co.Panuju DR, F Heidina, BH Trisasongko, B Tjahjono, A Kasno, AHA Syafril. 2009. Variasi nilai indeks vegetasi MODIS pada siklus pertumbuhan padi. J.Ilmiah Geomat. 15, 9-16 (in Indonesian).Pimentel D, C Harvey, P Resosudarmo, K. Sinclair, D Kurz, M Mc Nair, S Christ, L Shpritz, L Fitton, R Saffouri and R Balir. 1995. Environmental and Economic Costs of Soil Erosion and Conservation Benefits. Science 267: 1117-1123.Saha SK and LM Pande. 1993. Integrated approach towards soil erosion inventory for environmental conservation using satellite and agrometeorological data. Asia Pac Rem Sens J 5: 21-28.Saha SK, Kudrat M and Bhan SK.1991. Erosional soil loss prediction using digital satellitee data and USLE. In: S Murai (ed). Applications of Remote Sensing in Asia and Oceania – Environmental Change Monitoring. Asian Association of Remote Sensing, pp. 369-372.Salehi MH, Eghbal MK and Khademi H. 2003. Comparison of soil variability in a detailed and a reconnaissance soil map in central Iran. Geoderma 111: 45-56.Soil Survey Staff. 1998. Keys to Soil Taxonomy. Eighth Edition. United States Department of Agriculture Natural Resources Conservation Service. Washington, D.C.

Climate change induced sea-level rise (SLR) is on its increase globally. Regionally the lowlands of China, Vietnam, Bangladesh, and islands of the Malaysian, Indonesian and Philippine archipelagos are among the world’s most threatened regions. Sea-level rise has major impacts on the ecosystems and society. It threatens coastal populations, economic activities, and fragile ecosystems as mangroves, coastal salt-marches and wetlands. This paper provides a summary of the current state of knowledge of sea level-rise and its effects on both human and natural ecosystems. The focus is on coastal urban areas and low lying deltas in South-East Asia and Vietnam, as one of the most threatened areas in the world. About 3 mm per year reflects the growing consensus on the average SLR worldwide. The trend speeds up during recent decades. The figures are subject to local, temporal and methodological variation. In Vietnam the average values of 3.3 mm per year during the 1993-2014 period are above the worldwide average. Although a basic conceptual understanding exists that the increasing global frequency of the strongest tropical cyclones is related with the increasing temperature and SLR, this relationship is insufficiently understood. Moreover the precise, complex environmental, economic, social, and health impacts are currently unclear. SLR, storms and changing precipitation patterns increase flood risks, in particular in urban areas. Part of the current scientific debate is on how urban agglomeration can be made more resilient to flood risks. Where originally mainly technical interventions dominated this discussion, it becomes increasingly clear that proactive special planning, flood defense, flood risk mitigation, flood preparation, and flood recovery are important, but costly instruments. Next to the main focus on SLR and its effects on resilience, the paper reviews main SLR associated impacts: Floods and inundation, salinization, shoreline change, and effects on mangroves and wetlands. The hazards of SLR related floods increase fastest in urban areas. This is related with both the increasing surface major cities are expected to occupy during the decades to come and the increasing coastal population. In particular Asia and its megacities in the southern part of the continent are increasingly at risk. The discussion points to complexity, inter-disciplinarity, and the related uncertainty, as core characteristics. An integrated combination of mitigation, adaptation and resilience measures is currently considered as the most indicated way to resist SLR today and in the near future.References Aerts J.C.J.H., Hassan A., Savenije H.H.G., Khan M.F., 2000. Using GIS tools and rapid assessment techniques for determining salt intrusion: Stream a river basin management instrument. Physics and Chemistry of the Earth, Part B: Hydrology, Oceans and Atmosphere, 25, 265-273. Doi: 10.1016/S1464-1909(00)00014-9. Alongi D.M., 2002. Present state and future of the world’s mangrove forests. Environmental Conservation, 29, 331-349. Doi: 10.1017/S0376892902000231 Alongi D.M., 2015. The impact of climate change on mangrove forests. Curr. Clim. Change Rep., 1, 30-39. Doi: 10.1007/s404641-015-0002-x. Anderson F., Al-Thani N., 2016. Effect of sea level rise and groundwater withdrawal on seawater intrusion in the Gulf Coast aquifer: Implications for agriculture. Journal of Geoscience and Environment Protection, 4, 116-124. Doi: 10.4236/gep.2016.44015. Anguelovski I., Chu E., Carmin J., 2014. Variations in approaches to urban climate adaptation: Experiences and experimentation from the global South. Global Environmental Change, 27, 156-167. Doi: 10.1016/j.gloenvcha.2014.05.010. Arustienè J., Kriukaitè J., Satkunas J., Gregorauskas M., 2013. Climate change and groundwater - From modelling to some adaptation means in example of Klaipèda region, Lithuania. In: Climate change adaptation in practice. P. Schmidt-Thomé, J. Klein Eds. John Wiley and Sons Ltd., Chichester, UK., 157-169. Bamber J.L., Aspinall W.P., Cooke R.M., 2016. A commentary on “how to interpret expert judgement assessments of twenty-first century sea-level rise” by Hylke de Vries and Roderik S.W. Van de Wal. Climatic Change, 137, 321-328. Doi: 10.1007/s10584-016-1672-7. Barnes C., 2014. Coastal population vulnerability to sea level rise and tropical cyclone intensification under global warming. BSc-thesis. Department of Geography, University of Lethbridge, Alberta Canada. Be T.T., Sinh B.T., Miller F., 2007. Challenges to sustainable development in the Mekong Delta: Regional and national policy issues and research needs. The Sustainable Mekong Research Network, Bangkok, Thailand, 1-210. Bellard C., Leclerc C., Courchamp F., 2014. Impact of sea level rise on 10 insular biodiversity hotspots. Global Ecology and Biogeography, 23, 203-212. Doi: 10.1111/geb.12093. Berg H., Söderholm A.E., Sönderström A.S., Nguyen Thanh Tam, 2017. Recognizing wetland ecosystem services for sustainable rice farming in the Mekong delta, Vietnam. Sustainability Science, 12, 137-154. Doi: 10.1007/s11625-016-0409-x. Bilskie M.V., Hagen S.C., Medeiros S.C., Passeri D.L., 2014. Dynamics of sea level rise and coastal flooding on a changing landscape. Geophysical Research Letters, 41, 927-934. Doi: 10.1002/2013GL058759. Binh T.N.K.D., Vromant N., Hung N.T., Hens L., Boon E.K., 2005. Land cover changes between 1968 and 2003 in Cai Nuoc, Ca Mau penisula, Vietnam. Environment, Development and Sustainability, 7, 519-536. Doi: 10.1007/s10668-004-6001-z. Blankespoor B., Dasgupta S., Laplante B., 2014. Sea-level rise and coastal wetlands. Ambio, 43, 996- 005.Doi: 10.1007/s13280-014-0500-4. Brockway R., Bowers D., Hoguane A., Dove V., Vassele V., 2006. A note on salt intrusion in funnel shaped estuaries: Application to the Incomati estuary, Mozambique.Estuarine, Coastal and Shelf Science, 66, 1-5. Doi: 10.1016/j.ecss.2005.07.014. Cannaby H., Palmer M.D., Howard T., Bricheno L., Calvert D., Krijnen J., Wood R., Tinker J., Bunney C., Harle J., Saulter A., O’Neill C., Bellingham C., Lowe J., 2015. Projected sea level rise and changes in extreme storm surge and wave events during the 21st century in the region of Singapore. Ocean Sci. Discuss, 12, 2955-3001. Doi: 10.5194/osd-12-2955-2015. Carraro C., Favero A., Massetti E., 2012. Investment in public finance in a green, low carbon economy. Energy Economics, 34, S15-S18. Castan-Broto V., Bulkeley H., 2013. A survey ofurban climate change experiments in 100 cities. Global Environmental Change, 23, 92-102. Doi: 10.1016/j.gloenvcha.2012.07.005. Cazenave A., Le Cozannet G., 2014. Sea level rise and its coastal impacts. GeoHealth, 2, 15-34. Doi: 10.1002/2013EF000188. Chu M.L., Guzman J.A., Munoz-Carpena R., Kiker G.A., Linkov I., 2014. A simplified approach for simulating changes in beach habitat due to the combined effects of long-term sea level rise, storm erosion and nourishment. Environmental modelling and software, 52, 111-120. Doi.org/10.1016/j.envcsoft.2013.10.020. Church J.A. et al., 2013. Sea level change. In: Climate change 2013: The physical science basis. Contribution of working group I to the fifth assessment report of Intergovernmental Panel on Climate Change. Eds: Stocker T.F., Qin D., Plattner G.-K., Tignor M., Allen S.K., Boschung J., Nauels A., Xia Y., Bex V., Midgley P.M., Cambridge University Press, Cambridge, UK. Connell J., 2016. Last days of the Carteret Islands? Climate change, livelihoods and migration on coral atolls. Asia Pacific Viewpoint, 57, 3-15. Doi: 10.1111/apv.12118. Dasgupta S., Laplante B., Meisner C., Wheeler, Yan J., 2009. The impact of sea level rise on developing countries: A comparative analysis. Climatic Change, 93, 379-388. Doi: 10.1007/s 10584-008-9499-5. Delbeke J., Vis P., 2015. EU climate policy explained, 136p. Routledge, Oxon, UK. DiGeorgio M., 2015. Bargaining with disaster: Flooding, climate change, and urban growth ambitions in QuyNhon, Vietnam. Public Affairs, 88, 577-597. Doi: 10.5509/2015883577. Do Minh Duc, Yasuhara K., Nguyen Manh Hieu, 2015. Enhancement of coastal protection under the context of climate change: A case study of Hai Hau coast, Vietnam. Proceedings of the 10th Asian Regional Conference of IAEG, 1-8. Do Minh Duc, Yasuhara K., Nguyen Manh Hieu, Lan Nguyen Chau, 2017. Climate change impacts on a large-scale erosion coast of Hai Hau district, Vietnam and the adaptation. Journal of Coastal Conservation, 21, 47-62. Donner S.D., Webber S., 2014. Obstacles to climate change adaptation decisions: A case study of sea level rise; and coastal protection measures in Kiribati. Sustainability Science, 9, 331-345. Doi: 10.1007/s11625-014-0242-z. Driessen P.P.J., Hegger D.L.T., Bakker M.H.N., Van Renswick H.F.M.W., Kundzewicz Z.W., 2016. Toward more resilient flood risk governance. Ecology and Society, 21, 53-61. Doi: 10.5751/ES-08921-210453. Duangyiwa C., Yu D., Wilby R., Aobpaet A., 2015. Coastal flood risks in the Bangkok Metropolitan region, Thailand: Combined impacts on land subsidence, sea level rise and storm surge. American Geophysical Union, Fall meeting 2015, abstract#NH33C-1927. Duarte C.M., Losada I.J., Hendriks I.E., Mazarrasa I., Marba N., 2013. The role of coastal plant communities for climate change mitigation and adaptation. Nature Climate Change, 3, 961-968. Doi: 10.1038/nclimate1970. Erban L.E., Gorelick S.M., Zebker H.A., 2014. Groundwater extraction, land subsidence, and sea-level rise in the Mekong Delta, Vietnam. Environmental Research Letters, 9, 1-20. Doi: 10.1088/1748-9326/9/8/084010. FAO - Food and Agriculture Organisation, 2007.The world’s mangroves 1980-2005. FAO Forestry Paper, 153, Rome, Italy. Farbotko C., 2010. Wishful sinking: Disappearing islands, climate refugees and cosmopolitan experimentation. Asia Pacific Viewpoint, 51, 47-60. Doi: 10.1111/j.1467-8373.2010.001413.x. Goltermann D., Ujeyl G., Pasche E., 2008. Making coastal cities flood resilient in the era of climate change. Proceedings of the 4th International Symposium on flood defense: Managing flood risk, reliability and vulnerability, 148-1-148-11. Toronto, Canada. Gong W., Shen J., 2011. The response of salt intrusion to changes in river discharge and tidal mixing during the dry season in the Modaomen Estuary, China.Continental Shelf Research, 31, 769-788. Doi: 10.1016/j.csr.2011.01.011. Gosian L., 2014. Protect the world’s deltas. Nature, 516, 31-34. Graham S., Barnett J., Fincher R., Mortreux C., Hurlimann A., 2015. Towards fair outcomes in adaptation to sea-level rise. Climatic Change, 130, 411-424. Doi: 10.1007/s10584-014-1171-7. COASTRES-D-12-00175.1. Güneralp B., Güneralp I., Liu Y., 2015. Changing global patterns of urban expoàsure to flood and drought hazards. Global Environmental Change, 31, 217-225. Doi: 10.1016/j.gloenvcha.2015.01.002. Hallegatte S., Green C., Nicholls R.J., Corfee-Morlot J., 2013. Future flood losses in major coastal cities. Nature Climate Change, 3, 802-806. Doi: 10.1038/nclimate1979. Hamlington B.D., Strassburg M.W., Leben R.R., Han W., Nerem R.S., Kim K.-Y., 2014. Uncovering an anthropogenic sea-level rise signal in the Pacific Ocean. Nature Climate Change, 4, 782-785. Doi: 10.1038/nclimate2307. Hashimoto T.R., 2001. Environmental issues and recent infrastructure development in the Mekong Delta: Review, analysis and recommendations with particular reference to large-scale water control projects and the development of coastal areas. Working paper series (Working paper No. 4). Australian Mekong Resource Centre, University of Sydney, Australia, 1-70. Hibbert F.D., Rohling E.J., Dutton A., Williams F.H., Chutcharavan P.M., Zhao C., Tamisiea M.E., 2016. Coral indicators of past sea-level change: A global repository of U-series dated benchmarks. Quaternary Science Reviews, 145, 1-56. Doi: 10.1016/j.quascirev.2016.04.019. Hinkel J., Lincke D., Vafeidis A., Perrette M., Nicholls R.J., Tol R.S.J., Mazeion B., Fettweis X., Ionescu C., Levermann A., 2014. Coastal flood damage and adaptation costs under 21st century sea-level rise. Proceedings of the National Academy of Sciences, 111, 3292-3297. Doi: 10.1073/pnas.1222469111. Hinkel J., Nicholls R.J., Tol R.S.J., Wang Z.B., Hamilton J.M., Boot G., Vafeidis A.T., McFadden L., Ganapolski A., Klei R.J.Y., 2013. A global analysis of erosion of sandy beaches and sea level rise: An application of DIVA. Global and Planetary Change, 111, 150-158. Doi: 10.1016/j.gloplacha.2013.09.002. Huong H.T.L., Pathirana A., 2013. Urbanization and climate change impacts on future urban flooding in Can Tho city, Vietnam. Hydrol. Earth Syst. Sci., 17, 379-394. Doi: 10.5194/hess-17-379-2013. Hurlimann A., Barnett J., Fincher R., Osbaldiston N., Montreux C., Graham S., 2014. Urban planning and sustainable adaptation to sea-level rise. Landscape and Urban Planning, 126, 84-93. Doi: 10.1016/j.landurbplan.2013.12.013. IMHEN-Vietnam Institute of Meteorology, Hydrology and Environment, 2011. Climate change vulnerability and risk assessment study for Ca Mau and KienGiang provinces, Vietnam. Hanoi, Vietnam Institute of Meteorology, Hydrology and Environment (IMHEN), 250p. IMHEN-Vietnam Institute of Meteorology, Hydrology and Environment, Ca Mau PPC, 2011. Climate change impact and adaptation study in The Mekong Delta - Part A: Ca Mau Atlas. Hanoi, Vietnam: Institute of Meteorology, Hydrology and Environment (IMHEN), 48p. IPCC-Intergovernmental Panel on Climate Change, 2014. Fifth assessment report. Cambridge University Press, Cambridge, UK. Jevrejeva S., Jackson L.P., Riva R.E.M., Grinsted A., Moore J.C., 2016. Coastal sea level rise with warming above 2°C. Proceedings of the National Academy of Sciences, 113, 13342-13347. Doi: 10.1073/pnas.1605312113. Junk W.J., AN S., Finlayson C.M., Gopal B., Kvet J., Mitchell S.A., Mitsch W.J., Robarts R.D., 2013. Current state of knowledge regarding the world’s wetlands and their future under global climate change: A synthesis. Aquatic Science, 75, 151-167. Doi: 10.1007/s00027-012-0278-z. Jordan A., Rayner T., Schroeder H., Adger N., Anderson K., Bows A., Le Quéré C., Joshi M., Mander S., Vaughan N., Whitmarsh L., 2013. Going beyond two degrees? The risks and opportunities of alternative options. Climate Policy, 13, 751-769. Doi: 10.1080/14693062.2013.835705. Kelly P.M., Adger W.N., 2000. Theory and practice in assessing vulnerability to climate change and facilitating adaptation. Climatic Change, 47, 325-352. Doi: 10.1023/A:1005627828199. Kirwan M.L., Megonigal J.P., 2013. Tidal wetland stability in the face of human impacts and sea-level rice. Nature, 504, 53-60. Doi: 10.1038/nature12856. Koerth J., Vafeidis A.T., Hinkel J., Sterr H., 2013. What motivates coastal households to adapt pro actively to sea-level rise and increased flood risk? Regional Environmental Change, 13, 879-909. Doi: 10.1007/s10113-12-399-x. Kontgis K., Schneider A., Fox J;,Saksena S., Spencer J.H., Castrence M., 2014. Monitoring peri urbanization in the greater Ho Chi Minh City metropolitan area. Applied Geography, 53, 377-388. Doi: 10.1016/j.apgeogr.2014.06.029. Kopp R.E., Horton R.M., Little C.M., Mitrovica J.X., Oppenheimer M., Rasmussen D.J., Strauss B.H., Tebaldi C., 2014. Probabilistic 21st and 22nd century sea-level projections at a global network of tide-gauge sites. Earth’s Future, 2, 383-406. Doi: 10.1002/2014EF000239. Kuenzer C., Bluemel A., Gebhardt S., Quoc T., Dech S., 2011. Remote sensing of mangrove ecosystems: A review.Remote Sensing, 3, 878-928. Doi: 10.3390/rs3050878. Lacerda G.B.M., Silva C., Pimenteira C.A.P., Kopp Jr. R.V., Grumback R., Rosa L.P., de Freitas M.A.V., 2013. Guidelines for the strategic management of flood risks in industrial plant oil in the Brazilian coast: Adaptive measures to the impacts of sea level rise. Mitigation and Adaptation Strategies for Global Change, 19, 104-1062. Doi: 10.1007/s11027-013-09459-x. Lam Dao Nguyen, Pham Van Bach, Nguyen Thanh Minh, Pham Thi Mai Thy, Hoang Phi Hung, 2011. Change detection of land use and river bank in Mekong Delta, Vietnam using time series remotely sensed data. Journal of Resources and Ecology, 2, 370-374. Doi: 10.3969/j.issn.1674-764x.2011.04.011. Lang N.T., Ky B.X., Kobayashi H., Buu B.C., 2004. Development of salt tolerant varieties in the Mekong delta. JIRCAS Project, Can Tho University, Can Tho, Vietnam, 152. Le Cozannet G., Rohmer J., Cazenave A., Idier D., Van de Wal R., de Winter R., Pedreros R., Balouin Y., Vinchon C., Oliveros C., 2015. Evaluating uncertainties of future marine flooding occurrence as sea-level rises. Environmental Modelling and Software, 73, 44-56. Doi: 10.1016/j.envsoft.2015.07.021. Le Cozannet G., Manceau J.-C., Rohmer J., 2017. Bounding probabilistic sea-level projections with the framework of the possible theory. Environmental Letters Research, 12, 12-14. Doi.org/10.1088/1748-9326/aa5528.Chikamoto Y., 2014. Recent Walker circulation strengthening and Pacific cooling amplified by Atlantic warming. Nature Climate Change, 4, 888-892. Doi: 10.1038/nclimate2330. Lovelock C.E., Cahoon D.R., Friess D.A., Gutenspergen G.R., Krauss K.W., Reef R., Rogers K., Saunders M.L., Sidik F., Swales A., Saintilan N., Le Xuan Tuyen, Tran Triet, 2015. The vulnerability of Indo-Pacific mangrove forests to sea-level rise. Nature, 526, 559-563. Doi: 10.1038/nature15538. MA Millennium Ecosystem Assessment, 2005. Ecosystems and human well-being: Current state and trends. Island Press, Washington DC, 266p. Masterson J.P., Fienen M.N., Thieler E.R., Gesch D.B., Gutierrez B.T., Plant N.G., 2014. Effects of sea level rise on barrier island groundwater system dynamics - ecohydrological implications. Ecohydrology, 7, 1064-1071. Doi: 10.1002/eco.1442. McGanahan G., Balk D., Anderson B., 2007. The rising tide: Assessing the risks of climate changes and human settlements in low elevation coastal zones.Environment and urbanization, 19, 17-37. Doi: 10.1177/095624780707960. McIvor A., Möller I., Spencer T., Spalding M., 2012. Reduction of wind and swell waves by mangroves. The Nature Conservancy and Wetlands International, 1-27. Merryn T., Pidgeon N., Whitmarsh L., Ballenger R., 2016. Expert judgements of sea-level rise at the local scale. Journal of Risk Research, 19, 664-685. Doi.org/10.1080/13669877.2015.1043568. Monioudi I.N., Velegrakis A.F., Chatzipavlis A.E., Rigos A., Karambas T., Vousdoukas M.I., Hasiotis T., Koukourouvli N., Peduzzi P., Manoutsoglou E., Poulos S.E., Collins M.B., 2017. Assessment of island beach erosion due to sea level rise: The case of the Aegean archipelago (Eastern Mediterranean). Nat. Hazards Earth Syst. Sci., 17, 449-466. Doi: 10.5194/nhess-17-449-2017. MONRE - Ministry of Natural Resources and Environment, 2016. Scenarios of climate change and sea level rise for Vietnam. Publishing House of Environmental Resources and Maps Vietnam, Hanoi, 188p. Montz B.E., Tobin G.A., Hagelman III R.R., 2017. Natural hazards. Explanation and integration. The Guilford Press, NY, 445p. Morgan L.K., Werner A.D., 2014. Water intrusion vulnerability for freshwater lenses near islands. Journal of Hydrology, 508, 322-327. Doi: 10.1016/j.jhydrol.2013.11.002. Muis S., Güneralp B., Jongman B., Aerts J.C.H.J., Ward P.J., 2015. Science of the Total Environment, 538, 445-457. Doi: 10.1016/j.scitotenv.2015.08.068. Murray N.J., Clemens R.S., Phinn S.R., Possingham H.P., Fuller R.A., 2014. Tracking the rapid loss of tidal wetlands in the Yellow Sea. Frontiers in Ecology and Environment, 12, 267-272. Doi: 10.1890/130260. Neumann B., Vafeidis A.T., Zimmermann J., Nicholls R.J., 2015a. Future coastal population growth and exposure to sea-level rise and coastal flooding. A global assessment. Plos One, 10, 1-22. Doi: 10.1371/journal.pone.0118571. Nguyen A. Duoc, Savenije H. H., 2006. Salt intrusion in multi-channel estuaries: a case study in the Mekong Delta, Vietnam. Hydrology and Earth System Sciences Discussions, European Geosciences Union, 10, 743-754. Doi: 10.5194/hess-10-743-2006. Nguyen An Thinh, Nguyen Ngoc Thanh, Luong Thi Tuyen, Luc Hens, 2017. Tourism and beach erosion: Valuing the damage of beach erosion for tourism in the Hoi An, World Heritage site. Journal of Environment, Development and Sustainability. Nguyen An Thinh, Luc Hens (Eds.), 2018. Human ecology of climate change associated disasters in Vietnam: Risks for nature and humans in lowland and upland areas. Springer Verlag, Berlin.Nguyen An Thinh, Vu Anh Dung, Vu Van Phai, Nguyen Ngoc Thanh, Pham Minh Tam, Nguyen Thi Thuy Hang, Le Trinh Hai, Nguyen Viet Thanh, Hoang Khac Lich, Vu Duc Thanh, Nguyen Song Tung, Luong Thi Tuyen, Trinh Phuong Ngoc, Luc Hens, 2017. Human ecological effects of tropical storms in the coastal area of Ky Anh (Ha Tinh, Vietnam). Environ Dev Sustain, 19, 745-767. Doi: 10.1007/s/10668-016-9761-3. Nguyen Van Hoang, 2017. Potential for desalinization of brackish groundwater aquifer under a background of rising sea level via salt-intrusion prevention river gates in the coastal area of the Red River delta, Vietnam. Environment, Development and Sustainability. Nguyen Tho, Vromant N., Nguyen Thanh Hung, Hens L., 2008. Soil salinity and sodicity in a shrimp farming coastal area of the Mekong Delta, Vietnam. Environmental Geology, 54, 1739-1746. Doi: 10.1007/s00254-007-0951-z. Nguyen Thang T.X., Woodroffe C.D., 2016. Assessing relative vulnerability to sea-level rise in the western part of the Mekong River delta. Sustainability Science, 11, 645-659. Doi: 10.1007/s11625-015-0336-2. Nicholls N.N., Hoozemans F.M.J., Marchand M., Analyzing flood risk and wetland losses due to the global sea-level rise: Regional and global analyses.Global Environmental Change, 9, S69-S87. Doi: 10.1016/s0959-3780(99)00019-9. Phan Minh Thu, 2006. Application of remote sensing and GIS tools for recognizing changes of mangrove forests in Ca Mau province. In Proceedings of the International Symposium on Geoinformatics for Spatial Infrastructure Development in Earth and Allied Sciences, Ho Chi Minh City, Vietnam, 9-11 November, 1-17. Reise K., 2017. Facing the third dimension in coastal flatlands.Global sea level rise and the need for coastal transformations. Gaia, 26, 89-93. Renaud F.G., Le Thi Thu Huong, Lindener C., Vo Thi Guong, Sebesvari Z., 2015. Resilience and shifts in agro-ecosystems facing increasing sea-level rise and salinity intrusion in Ben Tre province, Mekong Delta. Climatic Change, 133, 69-84. Doi: 10.1007/s10584-014-1113-4. Serra P., Pons X., Sauri D., 2008. Land cover and land use in a Mediterranean landscape. Applied Geography, 28, 189-209. Shearman P., Bryan J., Walsh J.P., 2013.Trends in deltaic change over three decades in the Asia-Pacific Region. Journal of Coastal Research, 29, 1169-1183. Doi: 10.2112/JCOASTRES-D-12-00120.1. SIWRR-Southern Institute of Water Resources Research, 2016. Annual Report. Ministry of Agriculture and Rural Development, Ho Chi Minh City, 1-19. Slangen A.B.A., Katsman C.A., Van de Wal R.S.W., Vermeersen L.L.A., Riva R.E.M., 2012. Towards regional projections of twenty-first century sea-level change based on IPCC RES scenarios. Climate Dynamics, 38, 1191-1209. Doi: 10.1007/s00382-011-1057-6. Spencer T., Schuerch M., Nicholls R.J., Hinkel J., Lincke D., Vafeidis A.T., Reef R., McFadden L., Brown S., 2016. Global coastal wetland change under sea-level rise and related stresses: The DIVA wetland change model. Global and Planetary Change, 139, 15-30. Doi:10.1016/j.gloplacha.2015.12.018. Stammer D., Cazenave A., Ponte R.M., Tamisiea M.E., 2013. Causes of contemporary regional sea level changes. Annual Review of Marine Science, 5, 21-46. Doi: 10.1146/annurev-marine-121211-172406. Tett P., Mee L., 2015. Scenarios explored with Delphi. In: Coastal zones ecosystems services. Eds., Springer, Berlin, Germany, 127-144. Tran Hong Hanh, 2017. Land use dynamics, its drivers and consequences in the Ca Mau province, Mekong delta, Vietnam. PhD dissertation, 191p. VUBPRESS Brussels University Press, ISBN 9789057186226, Brussels, Belgium. Tran Thuc, Nguyen Van Thang, Huynh Thi Lan Huong, Mai Van Khiem, Nguyen Xuan Hien, Doan Ha Phong, 2016. Climate change and sea level rise scenarios for Vietnam. Ministry of Natural resources and Environment. Hanoi, Vietnam. Tran Hong Hanh, Tran Thuc, Kervyn M., 2015. Dynamics of land cover/land use changes in the Mekong Delta, 1973-2011: A remote sensing analysis of the Tran Van Thoi District, Ca Mau province, Vietnam. Remote Sensing, 7, 2899-2925. Doi: 10.1007/s00254-007-0951-z Van Lavieren H., Spalding M., Alongi D., Kainuma M., Clüsener-Godt M., Adeel Z., 2012. Securing the future of Mangroves. The United Nations University, Okinawa, Japan, 53, 1-56. Water Resources Directorate. Ministry of Agriculture and Rural Development, 2016. Available online: http://www.tongcucthuyloi.gov.vn/Tin-tuc-Su-kien/Tin-tuc-su-kien-tong-hop/catid/12/item/2670/xam-nhap-man-vung-dong-bang-song-cuu-long--2015---2016---han-han-o-mien-trung--tay-nguyen-va-giai-phap-khac-phuc. Last accessed on: 30/9/2016. Webster P.J., Holland G.J., Curry J.A., Chang H.-R., 2005. Changes in tropical cyclone number, duration, and intensity in a warming environment. Science, 309, 1844-1846. Doi: 10.1126/science.1116448. Were K.O., Dick O.B., Singh B.R., 2013. Remotely sensing the spatial and temporal land cover changes in Eastern Mau forest reserve and Lake Nakuru drainage Basin, Kenya. Applied Geography, 41, 75-86. Williams G.A., Helmuth B., Russel B.D., Dong W.-Y., Thiyagarajan V., Seuront L., 2016. Meeting the climate change challenge: Pressing issues in southern China an SE Asian coastal ecosystems. Regional Studies in Marine Science, 8, 373-381. Doi: 10.1016/j.rsma.2016.07.002. Woodroffe C.D., Rogers K., McKee K.L., Lovdelock C.E., Mendelssohn I.A., Saintilan N., 2016. Mangrove sedimentation and response to relative sea-level rise. Annual Review of Marine Science, 8, 243-266. Doi: 10.1146/annurev-marine-122414-034025.

Abstract Background: Zanubrutinib (zanu) is a selective next-generation Bruton tyrosine kinase (BTK) inhibitor designed to have high specificity for BTK and minimize off-target effects (Guo, J Med Chem 2019;62:7923-40). In a phase 1/2 study, zanu demonstrated complete and sustained BTK occupancy in both peripheral blood mononuclear cells and lymph nodes and was associated with durable clinical responses in patients (pts) with CLL/SLL (Tam, Blood 2019;134:851-9). Here, we present interim results for the phase 3 SEQUOIA (BGB-3111-304; NCT03336333) trial, which evaluated the efficacy and safety of zanu vs BR in TN pts with CLL/SLL. Methods: SEQUOIA is an open-label, global phase 3 study that randomized TN pts with CLL/SLL without del(17p) to receive zanu 160 mg twice daily until progressive disease or unacceptable toxicity, or bendamustine 90 mg/m 2 on day 1 and 2 and rituximab 375 mg/m 2 in cycle 1, 500 mg/m 2 in cycles 2-6 for 6 × 28-day cycles. Adult pts with CLL/SLL who met International Workshop on CLL (iwCLL) criteria for treatment (Hallek, Blood 2008;111:5446-56) were eligible if they were either ≥65 y or unsuitable for treatment with fludarabine, cyclophosphamide and rituximab. Central verification of del(17p) status by fluorescence in situ hybridization was required. Pts were stratified by age (&lt;65 y vs ≥65 y), Binet Stage (C vs A/B), IGHV mutational status, and geographic region. The primary endpoint was independent review committee (IRC)-assessed progression-free survival (PFS) for zanu vs BR. Secondary endpoints included PFS by investigator assessment (INV), overall response rate (ORR; by IRC and INV), overall survival (OS), and safety. Responses for CLL and SLL were assessed per modified iwCLL criteria (Hallek, Blood 2008;111:5446-56; J Clin Oncol 2012;30:2820-2) and Lugano criteria (Cheson, J Clin Oncol 2014;32:3059-68), respectively. Adverse events (AEs) were recorded until disease progression to support safety evaluation over an equivalent time period. Results: From 31 Oct 2017-22 Jul 2019, 479 pts without del(17p) were randomized to zanu (n=241) and BR (n=238). Treatment groups were well balanced for demographic and disease characteristics (zanu vs BR): median age, 70.0 y vs 70.0 y; unmutated IGHV, 53.4% (125/234) vs 52.4% (121/231); and del(11q), 17.8% vs 19.3%. At median follow-up (26.2 mo), PFS by IRC was significantly prolonged with zanu vs BR (HR 0.42, 95% CI 0.28-0.63, 1-sided and 2-sided P&lt;0.0001; Figure); similar results were observed by INV (HR 0.42, 95% CI 0.27-0.66, 1-sided P&lt;0.0001, 2-sided P=0.0001). Treatment benefit for zanu was observed across subgroups for age, Binet stage, bulky disease, and del(11q) status. Treatment benefit was also observed for pts with unmutated IGHV (HR 0.24, 1-sided and 2-sided P&lt;0.0001), but not for mutated IGHV (HR 0.67, 1-sided P=0.0929). Estimated 24-mo PFS (IRC) for zanu vs BR was 85.5% (95% CI 80.1%- 89.6%) vs 69.5% (95% CI 62.4%-75.5%). ORR by IRC for zanu vs BR was 94.6% (95% CI 91.0%-97.1%) vs 85.3% (95% CI 80.1%-89.5%). Complete response rate was 6.6% with zanu and 15.1% with BR. ORR by INV for zanu vs BR was 97.5% (95% CI 94.7%-99.1%) vs 88.7% (95% CI 83.9%-92.4%) Estimated 24-mo OS for zanu vs BR was 94.3% (95% CI 90.4%-96.7%) and 94.6% (95% CI 90.6%-96.9%). The most common AEs are shown in the Table. AEs of interest occurring during the full reporting period (pooled terms, zanu vs BR) included atrial fibrillation (any grade [gr]: 3.3% vs 2.6%), bleeding (any gr/gr≥3: 45.0%/3.8% vs 11.0%/1.8%), hypertension (any gr: 14.2% vs 10.6%), infection (any gr/gr≥3: 62.1%/16.3% vs 55.9%/18.9%), and neutropenia (any gr/gr≥3: 15.8%/11.7% vs 56.8%/51.1%). Treatment discontinuation due to AEs occurred in 20 pts (8.3%) receiving zanu vs 31 pts (13.7%) receiving BR; 85.5% of pts receiving zanu remain on treatment. AEs leading to death occurred in 11 pts (4.6%) receiving zanu vs 12 pts (5.3%) receiving BR. No sudden deaths were reported. Conclusions: In this global registrational trial, zanu demonstrated statistically significant improvement in PFS compared to BR as assessed by IRC. Superiority was also observed in PFS by INV as well as ORR by both IRC and INV. Zanu was generally well tolerated, with low rates of atrial fibrillation consistent with those observed in the phase 3 ASPEN (Tam, Blood 2020;136:2038-2050) and ALPINE studies (Hillmen, EHA 2021 #LB1900). These data support the potential utility of zanu in the frontline management of pts with TN CLL/SLL. Figure 1 Figure 1. Disclosures Tam: AbbVie: Consultancy, Honoraria, Research Funding; BeiGene: Consultancy, Honoraria; Janssen: Consultancy, Honoraria, Research Funding; Pharmacyclics: Honoraria; Novartis: Honoraria; Loxo: Consultancy; Roche: Consultancy, Honoraria. Giannopoulos: Polish Myeloma Consortium, Next Generation Hematology Association: Membership on an entity's Board of Directors or advisory committees; Sandoz: Consultancy, Honoraria; Pfizer: Honoraria; Teva: Honoraria; TG Therapeutics: Research Funding; Abbvie: Consultancy, Honoraria, Research Funding; Amgen: Consultancy, Honoraria, Research Funding; Astra-Zeneca: Consultancy, Honoraria, Research Funding; Bei-Gene: Consultancy, Honoraria, Research Funding; Janssen: Consultancy, Honoraria, Research Funding; Sanofi-Genzyme: Consultancy, Honoraria, Research Funding; Novartis: Consultancy, Honoraria, Research Funding; Takeda: Consultancy, Honoraria, Research Funding; Roche: Consultancy, Honoraria, Research Funding; Karyopharm: Consultancy, Honoraria, Research Funding; GSK: Consultancy, Honoraria, Research Funding; Gilead: Honoraria, Research Funding. Jurczak: Astra Zeneca: Membership on an entity's Board of Directors or advisory committees, Research Funding; Abbvie: Research Funding; Bayer: Research Funding; BeiGene: Membership on an entity's Board of Directors or advisory committees, Research Funding; Celtrion: Research Funding; Celgene: Research Funding; Debbiopharm: Research Funding; Janssen: Membership on an entity's Board of Directors or advisory committees, Research Funding; Loxo Oncology: Membership on an entity's Board of Directors or advisory committees; Sandoz: Membership on an entity's Board of Directors or advisory committees; Roche: Membership on an entity's Board of Directors or advisory committees, Research Funding; Epizyme: Research Funding; Incyte: Research Funding; Merck: Research Funding; Takeda: Research Funding; TG Therapeutics: Research Funding. Šimkovič: Janssen, Gilead, Roche, AstraZeneca, and AbbVie: Other: consultancy fees, advisory board participation fees, travel grants, and honoraria; University Hospital Hradec Kralove: Current Employment; AbbVie: Consultancy, Current equity holder in publicly-traded company, Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: Travel, Accommodations, Expenses; AstraZeneca: Consultancy, Membership on an entity's Board of Directors or advisory committees; Janssen-Cilag: Consultancy, Honoraria, Other: Travel, Accommodations, Expenses; Merck: Current equity holder in publicly-traded company; Eli Lilly: Current equity holder in publicly-traded company; J&J: Current equity holder in publicly-traded company; Gilead: Other: Travel, Accommodations, Expenses. Shadman: Abbvie, Genentech, AstraZeneca, Sound Biologics, Pharmacyclics, Beigene, Bristol Myers Squibb, Morphosys, TG Therapeutics, Innate Pharma, Kite Pharma, Adaptive Biotechnologies, Epizyme, Eli Lilly, Adaptimmune , Mustang Bio and Atara Biotherapeutics: Consultancy; Mustang Bio, Celgene, Bristol Myers Squibb, Pharmacyclics, Gilead, Genentech, Abbvie, TG Therapeutics, Beigene, AstraZeneca, Sunesis, Atara Biotherapeutics, GenMab: Research Funding. Österborg: BeiGene: Research Funding; Gilead: Research Funding. Laurenti: Janssen: Consultancy, Honoraria; AstraZeneca: Consultancy, Honoraria; Gilead: Honoraria; Roche: Honoraria, Research Funding; AbbVie: Consultancy, Honoraria, Research Funding; BeiGene: Honoraria. Walker: BeiGene: Consultancy; Acerta: Consultancy. Opat: Abbvie: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding; Astra Zeneca: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding; Janssen: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding; Roche: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding; BeiGene: Membership on an entity's Board of Directors or advisory committees, Research Funding; Gilead: Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding; Pharmacyclics: Research Funding; Sandoz: Research Funding; Takeda: Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding; Celgene: Honoraria, Membership on an entity's Board of Directors or advisory committees; CSL Behring: Honoraria, Membership on an entity's Board of Directors or advisory committees; Merck: Honoraria, Membership on an entity's Board of Directors or advisory committees; Monash Health: Current Employment. Chan: AbbVie: Membership on an entity's Board of Directors or advisory committees; Eusa: Membership on an entity's Board of Directors or advisory committees; Janssen: Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; GSK: Membership on an entity's Board of Directors or advisory committees; Amgen: Other: Travel, Accommodations, Expenses; Celgene: Other: Travel, Accommodations, Expenses; Roche: Speakers Bureau. Ciepluch: Copernicus Wojewodzkie Centrum Onkologii: Current Employment. Greil: Novartis: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: Travel, Accommodations, Expenses, Research Funding; AstraZeneca: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: Travel, Accommodations, Expenses, Research Funding; AbbVie: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: Travel, Accommodations, Expenses, Research Funding; Sandoz: Honoraria, Research Funding; Amgen: Honoraria, Other: Travel, Accommodations, Expenses, Research Funding; Roche: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: Travel, Accommodations, Expenses, Research Funding; BMS: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: Travel, Accommodations, Expenses, Research Funding; Takeda: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding; Celgene: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: Travel, Accommodations, Expenses, Research Funding; Merck: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding; Sanofi: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees; Sankyo: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: Travel, Accommodations, Expenses, Research Funding; Daiichi: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: Travel, Accommodations, Expenses, Research Funding; Janssen: Consultancy, Membership on an entity's Board of Directors or advisory committees, Other: Travel, Accommodations, Expenses; MSD: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: Travel, Accommodations, Expenses, Research Funding; Gilead: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: Travel, Accommodations, Expenses, Research Funding. Trněný: AbbVie: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: Travel, Accommodations, Expenses; Portola: Honoraria, Membership on an entity's Board of Directors or advisory committees; MorphoSys: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees; Novartis: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees; Roche: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: Travel, Accommodations, Expenses; 1st Faculty of Medicine, Charles University, General Hospital in Prague: Current Employment; Takeda: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: Travel, Accommodations, Expenses; Celgene: Consultancy; Amgen: Consultancy, Honoraria; Bristol-Myers Squibb: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: Travel, Accommodations, Expenses; Gilead Sciences: Consultancy, Honoraria, Other: Travel, Accommodations, Expenses; Incyte: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees; Janssen: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: Travel, Accommodations, Expenses; AstraZeneca: Honoraria. Brander: Verastem: Consultancy; ArQule: Research Funding; Genentech: Consultancy, Research Funding; TG Therapeutics: Consultancy, Research Funding; Juno Therapeutics/Celgene/Bristol Myers Squibb: Research Funding; MEI Pharma: Research Funding; Novartis: Research Funding; LOXO: Research Funding; Ascentage: Research Funding; AstraZeneca: Research Funding; BeiGene: Research Funding; DTRM: Research Funding; AbbVie: Consultancy, Other: informCLL registry steering committee, Research Funding; Pfizer: Consultancy, Other: Biosimilars outcomes research panel; NCCN: Other: panel member; ArQule/Merck: Consultancy; Pharmacyclics LLC, an AbbVie Company: Consultancy, Research Funding. Flinn: Loxo: Other: All research funding payments made to Sarah Cannon Research Institute, Research Funding; Juno Therapeutics: Consultancy, Other: All consultancy and research funding payments made to Sarah Cannon Research Institute, Research Funding; Nurix Therapeutics: Consultancy, Other: All consultancy payments made to Sarah Cannon Research Institute; IGM Biosciences: Other: All research funding payments made to Sarah Cannon Research Institute, Research Funding; Forma Therapeutics: Other: All research funding payments made to Sarah Cannon Research Institute, Research Funding; Forty Seven: Other: All research funding payments made to Sarah Cannon Research Institute, Research Funding; MorphoSys: Consultancy, Other: All consultancy and research funding payments made to Sarah Cannon Research Institute, Research Funding; Roche: Consultancy, Other: All consultancy and research funding payments made to Sarah Cannon Research Institute, Research Funding; Janssen: Consultancy, Other: All consultancy and research funding payments made to Sarah Cannon Research Institute, Research Funding; Novartis: Consultancy, Other: All consultancy and research funding payments made to Sarah Cannon Research Institute, Research Funding; Takeda: Consultancy, Other: All consultancy and research funding payments made to Sarah Cannon Research Institute, Research Funding; Great Point Partners: Consultancy, Other: All consultancy payments made to Sarah Cannon Research Institute; Genentech: Consultancy, Other: All consultancy and research funding payments made to Sarah Cannon Research Institute, Research Funding; AstraZeneca: Consultancy, Other: All consultancy and research funding payments made to Sarah Cannon Research Institute, Research Funding; AbbVie: Consultancy, Other: All Consultancy and Research Funding payments made to Sarah Cannon Research Institute, Research Funding; Gilead Sciences: Consultancy, Other: All consultancy and research funding payments made to Sarah Cannon Research Institute, Research Funding; Celgene: Other: All research funding payments made to Sarah Cannon Research Institute, Research Funding; Curis: Other: All research funding payments made to Sarah Cannon Research Institute, Research Funding; Infinity Pharmaceuticals: Other: All research funding payments made to Sarah Cannon Research Institute, Research Funding; Karyopharm Therapeutics: Other: All research funding payments made to Sarah Cannon Research Institute, Research Funding; Kite, a Gilead Company: Consultancy, Other: All consultancy and research funding payments made to Sarah Cannon Research Institute, Research Funding; Incyte: Other: All research funding payments made to Sarah Cannon Research Institute, Research Funding; Merck: Other: All research funding payments made to Sarah Cannon Research Institute, Research Funding; BeiGene: Consultancy, Other: All consultancy and research funding payments made to Sarah Cannon Research Institute, Research Funding; Calithera Biosciences: Other: All research funding payments made to Sarah Cannon Research Institute, Research Funding; Seagen: Consultancy, Other: All consultancy and research funding payments made to Sarah Cannon Research Institute, Research Funding; TG Therapeutics: Consultancy, Other: All consultancy and research funding payments made to Sarah Cannon Research Institute, Research Funding; Iksuda Therapeutics: Consultancy, Other: All consultancy payments made to Sarah Cannon Research Institute; Constellation Pharmaceuticals: Other: All research funding payments made to Sarah Cannon Research Institute, Research Funding; Pharmacyclics LLC, an AbbVie Company: Consultancy, Other: All consultancy and research funding payments made to Sarah Cannon Research Institute, Research Funding; ArQule: Other: All research funding payments made to Sarah Cannon Research Institute, Research Funding; Unum Therapeutics: Consultancy, Other: All consultancy and research funding payments made to Sarah Cannon Research Institute, Research Funding; Agios: Other: All research funding payments made to Sarah Cannon Research Institute, Research Funding; Verastem: Consultancy, Other: All consultancy and research funding payments made to Sarah Cannon Research Institute, Research Funding; Acerta Pharma: Other: All research funding payments made to Sarah Cannon Research Institute, Research Funding; Yingli Pharmaceuticals: Consultancy, Other: All consultancy payments made to Sarah Cannon Research Institute; Trillium Therapeutics: Other: All research funding payments made to Sarah Cannon Research Institute, Research Funding; Teva: Other: All research funding payments made to Sarah Cannon Research Institute, Research Funding; Rhizen Pharmaceuticals: Other: All research funding payments made to Sarah Cannon Research Institute, Research Funding; Portola Pharmaceuticals: Other: All research funding payments made to Sarah Cannon Research Institute, Research Funding; Pfizer: Other: All research funding payments made to Sarah Cannon Research Institute, Research Funding; Triphase Research & Development Corp.: Other: All research funding payments made to Sarah Cannon Research Institute, Research Funding; Century Therapeutics: Consultancy, Other: All consultancy payments made to Sarah Cannon Research Institute; Hutchison MediPharma: Consultancy, Other: All consultancy payments made to Sarah Cannon Research Institute; Vincerx Pharma: Consultancy, Other: All consultancy payments made to Sarah Cannon Research Institute; Sarah Cannon Research Institute: Current Employment; Servier Pharmaceuticals: Consultancy, Other: All consultancy payments made to Sarah Cannon Research Institute; Yingli Pharmaceuticals: Consultancy, Other: All consultancy payments made to Sarah Cannon Research Institute; Seagen: Consultancy, Other: All consultancy payments made to Sarah Cannon Research Institute; Servier Pharmaceuticals: Consultancy, Other: All consultancy payments made to Sarah Cannon Research Institute; Unum Therapeutics: Consultancy, Other: All consultancy payments made to Sarah Cannon Research Institute, Research Funding; Johnson & Johnson: Current holder of individual stocks in a privately-held company; Seattle Genetics: Research Funding. Verner: Janssen-Cilag Pty Ltd: Research Funding. Brown: Janssen: Consultancy; MEI Pharma: Consultancy; Rigel: Consultancy; Bristol-Myers Squib/Juno/Celegene: Consultancy; Novartis: Consultancy; Invectys: Other: Data Safety Monitoring Committee Service; TG Therapeutics: Research Funding; Abbvie: Consultancy; Acerta/Astra-Zeneca: Consultancy; Beigene: Consultancy; Catapult: Consultancy; Loxo/Lilly: Research Funding; Sun: Research Funding; Nextcea: Consultancy; Gilead: Research Funding; SecuraBio: Research Funding; Eli Lilly and Company: Consultancy; Genentech/Roche: Consultancy; Pfizer: Consultancy; Morphosys AG: Consultancy. Kahl: AbbVie, Adaptive, ADCT, AstraZeneca, Bayer, BeiGene, Bristol-Myers Squibb, Celgene, Genentech, Incyte, Janssen, Karyopharm, Kite, MEI, Pharmacyclics, Roche, TG Therapeutics, and Teva: Consultancy; AbbVie, Acerta, ADCT, AstraZeneca, BeiGene, Genentech: Research Funding. Ghia: Sunesis: Research Funding; Roche: Consultancy, Honoraria; Janssen: Consultancy, Honoraria, Research Funding; Gilead: Consultancy, Research Funding; Celgene/Juno/BMS: Consultancy, Honoraria; BeiGene: Consultancy, Honoraria; ArQule/MSD: Consultancy, Honoraria; AstraZeneca: Consultancy, Honoraria, Research Funding; Acerta/AstraZeneca: Consultancy, Honoraria, Research Funding; AbbVie: Consultancy, Honoraria, Research Funding. Tian: BeiGene: Current Employment; AbbVie: Ended employment in the past 24 months. Marimpietri: BeiGene USA: Current Employment, Current equity holder in publicly-traded company, Divested equity in a private or publicly-traded company in the past 24 months. Paik: BeiGene USA, Inc.: Current Employment, Current equity holder in publicly-traded company. Cohen: BeiGene: Current Employment, Current equity holder in publicly-traded company, Other: Travel, Accommodations, Expenses. Huang: BeiGene: Current Employment, Current equity holder in publicly-traded company, Current holder of individual stocks in a privately-held company, Current holder of stock options in a privately-held company, Divested equity in a private or publicly-traded company in the past 24 months, Other: Travel, Accommodations, Expenses; Protara Therapeutics: Current holder of individual stocks in a privately-held company, Membership on an entity's Board of Directors or advisory committees, Other: TRAVEL, ACCOMMODATIONS, EXPENSES (paid by any for-profit health care company). Robak: Biogen, Abbvie, Octapharma, Janssen: Honoraria, Other: Advisory board; AstraZeneca, Abbvie, Janssen, Octapharma, Gilead,Oncopeptides AB, Pharmacyclics, Pfizer, GlaxoSmithKline, Biogen: Research Funding; Medical University of Lodz: Current Employment. Hillmen: Pharmacyclics: Honoraria, Research Funding; Roche: Research Funding; Gilead: Research Funding; AstraZeneca: Honoraria; SOBI: Honoraria; BeiGene: Honoraria; AbbVie: Honoraria, Other: Travel, Accommodations, Expenses, Research Funding; Janssen: Honoraria, Other: Travel, Accommodations, Expenses, Research Funding. OffLabel Disclosure: Zanubrutinib is an investigational agent and has not been approved for TN CLL/SLL without del(17p) in the US

Uncertainty exists re risk:benefit of proximal intestinal exclusion with EB, a novel endoscopic duodenal jejunal liner device for obesity, both with and without diabetes. In view of this, during 2017, an independent, secure, on line registry was established under the auspices of the Association of British Clinical Diabetologists, for the collection of safety and efficacy data worldwide. As of December 2021, data had been entered on 10patients {age 52.1 ± 10.3 year, 53% male, 87% diabetes, BMI 41.1 ± 8.9 kg/m2} and showed many benefits (Table 1) . There were 43 (4.2%) SAEs and 139 (13.9%) less serious AEs (Table 2) . All SAE patients made a full recovery and most derived significant benefit. The benefits of EB therapy are likely to reduce the complications of diabetes. This international data from the EB registry suggests that the likely benefits of EB, far outweigh the risks Disclosure R.E.J. Ryder: None. J.P. Teare: None. A. Ruban: None. M. Haluzik: Advisory Panel; Boehringer Ingelheim International GmbH, Novo Nordisk A/S, Sanofi. Speaker's Bureau; Abbott Diabetes, AstraZeneca, Lilly Diabetes, Novartis AG. L. Munro: None. H. Frydenberg: None. J.J. McMaster: None. S. Fishman: None. R.V. Cohen: Advisory Panel; GI Dynamics. Research Support; Johnson & Johnson, Medtronic. C.M. Aboud: None. G.J. Holtmann: Research Support; AbbVie Inc., Allergan, Arena Pharmaceuticals, Inc., Bayer, Bristol Myers, Datapharm Australia Pty Ltd Commonwealth Laboratories, Pty Limited, Eli Lilly Australia Pty Limited, F.Hoffmann-La Roche Limited, Falk Foundation, Falk GmbH and Co Kg, GI Therapies Pty Ltd, Gilead Sciences Pty Limited, MedImmune Ltd Celgene Pty Limited, Mylan, Nestle Pty Ltd, Prometheus Laboratories, Quintiles Pty Limited, Servatus, Takeda Development Center Asia, Pty Ltd, Vital Food Processors Ltd. C. de Jonge: None. J. Greve: Advisory Panel; GI Dynamics. Other Relationship; Bariatric Solutions International, Ethicon, Inc. J.C. Mason: None. H. Sourij: Advisory Panel; AstraZeneca, Bayer AG, Boehringer Ingelheim International GmbH, Daiichi Sankyo, Eli Lilly and Company, Merck Sharp & Dohme Corp., Novo Nordisk. Research Support; Boehringer Ingelheim International GmbH, Sanofi. Speaker's Bureau; Amgen Inc., AstraZeneca, Boehringer Ingelheim International GmbH, Eli Lilly and Company, Merck Sharp & Dohme Corp., Novartis AG, Novo Nordisk. R. Drummond: Research Support; Fractyl Health, Inc. Speaker's Bureau; AstraZeneca, Bristol-Myers Squibb Company. B. McGowan: Advisory Panel; Johnson & Johnson, Lilly, Novo Nordisk. Research Support; Novo Nordisk. Speaker's Bureau; AstraZeneca, Novo Nordisk. Stock/Shareholder; Reset Health. S.A. Amiel: Advisory Panel; Medtronic, Novo Nordisk. Other Relationship; Sanofi. M. Yadagiri: None. P. Sen Gupta: None. K. Laubner: None. J. Seufert: Advisory Panel; Abbott, Sanofi-Aventis Deutschland GmbH. Research Support; Boehringer Ingelheim International GmbH. Speaker's Bureau; Abbott Diabetes, AstraZeneca, Bayer AG, Boehringer Ingelheim International GmbH, Lilly, Novo Nordisk, Sanofi-Aventis Deutschland GmbH. Funding Association of British Clinical Diabetologists

Professional soccer with high training loads is defined with weekly competition. The purpose of this study was to compare external training load data of GPS derived variables that preceded a home versus away match. Twenty-two weeks of a national league meet schedule were analyzed, which included 11 home and 11 away matches. Twelve professional soccer players (age, 28.6 ± 2.7 years; height, 182.1 ± 8.6 cm; BMI, 22.6 ± 0.7 kg/m2) participated in this study. All matches were monitored using GPSPORTS systems Pty Ltd. The following variables were selected: total duration of the matches and training sessions, high-speed running distance (18–23 km h−1), sprint distance (>23 km h−1), maximal speed, body load, metabolic power, accelerations Zone1 (<2 m s−2) (AccZ1), accelerations Zone2 (2 –4 m s−2) (AccZ2), accelerations Zone3 (>4 m s−2) (AccZ3), decelerations Zone1 (<−2 m s−2) (DecZ1), decelerations Zone2 (−2 to −4 m s−2) (DecZ2) and decelerations Zone3 (>−4 m s−2) (DecZ3). The results indicated that metabolic power showed higher values at home than away matches [ p = 0.047, ES = 0.53, (−0.28, 1.34)]. Furthermore, there was a higher value in accumulated external training load that preceded away matches for high-speed running and lower value [ p < 0.001, ES = −0.95 (−1.79, −0.10)] for DecZ1 than home matches. In conclusion, external load variables had a higher value in home matches. However, the results showed that high-speed running was higher in away matches, which could be the discretion of the coaches to prepare players for different conditions on the opponent’s field.

ABSTRACT Mycoplasma genitalium is a common sexually transmitted infection with a propensity to acquire resistance to commonly used antimicrobial therapies. Bacterial load has been linked to patient symptoms and the success of treatment. In this study, we demonstrate methodology to estimate load from routine diagnostic assays using the ResistancePlus MG test (SpeeDx Pty Ltd., Australia). The method gave comparable quantitation to an M. genitalium-specific 16S rRNA quantitative PCR (qPCR; Spearman r = 0.94) for the samples analyzed (n = 499, including urine and swab types as detailed below) and was, therefore, employed to analyze typical load levels for samples in a diagnostic laboratory (total of 1,012 tests). When stratified by sample type, female urine (median, 826 genomes/ml) had the lowest load. This was significantly lower than median loads for all other sample types (male urine [6.91 × 103 genomes/ml], anal swabs [5.50 × 103], cervical swabs [8.15 × 103], endocervical swabs [3.97 × 103], and vaginal swabs [6.95 × 103]) (P < 0.0001). There were no significant differences in load estimates between the other sample types. Reproducibility of load estimates conducted on the same samples was high (r > 0.85). In conclusion, this methodology to provide load estimates for M. genitalium can be easily integrated into routine diagnostic laboratory workflow. Given the association between organism load, symptoms, and treatment success, load assessment has future diagnostic potential.

Abstract Background Central blood pressure (cBP) is a better predictor of the damage caused by hypertension in comparison with peripheral blood pressure (pBP). Although challenging to measure, numerous devices are trying to reliably estimate cBP non-invasively. Pulse wave velocity (PWV) is another important independent cardiovascular risk factor. Aim We sought to deploy a new validation method using a high-fidelity pressure wire as the invasive gold standard measurement for sphygmomanometer devices estimating cBP. Moreover, we invasively calculated the PWV to investigate its relationship to the non-invasively estimated cBP. Methods In 50 patients requiring a cardiac catheterization, we measured the blood pressure in the ascending aorta (AAo) with a fluid-filled (FF) guiding catheter (NaCl 0,9%). We compared these values with the results derived simultaneously with a novel sphygmomanometer that estimates cBP from the analysis of brachial artery suprasystolic pressure waves, based on the pressure-wave propagation of a water-hammer acoustic model. This was measured on the left arm with the BP+ device from USCOM Pty Ltd (Sydney, NSW, Australia) while the catheterization was performed via the right radial artery. On 14 of these patients so far, we placed a 0.014" high-fidelity pressure wire in the AAo to measure cBP, when it was clinically indicated to evaluate one or more coronary stenosis by Fractional Flow Reserve (FFR). Ultimately, the wire was pulled back into the humeral artery (HUM). PWV was then calculated from the length of the pullback and the time delay between AAo and HUM pulses by gating to the R-wave of the ECG for both measurements, using MatLab software. Results Bland-Altman analysis of the sphygmomanometrically estimated cBPsys and the measured one by a FFR wire (left on figure) demonstrates less scatter than with the FF catheter (right). The mean difference with the sphygmomanometrically derived cBPsys was −1.2±4.7 mmHg (CI95%: −3.8; 1.8) for the FFR wire and 6.0±9.8 mmHg (CI95%: 3.2; 8.9) for the FF catheter. Central diastolic and mean BP were both overestimated by the sphygmomanometer, with respectively −7.8±6.8 mmHg (CI95%: −11.4; −4.2) and −5.5±6.1 mmHg (CI95%: −8.6; −2.3) compared to the FFR wire and −10.3±6.7 mmHg (CI95%: −12.2; −8.3) and −5.5±6.5 (CI95% : −7.3; −3.6) for the FF catheter. The average PWV was 7.0±1.4 m/s. No significant relationship of PWV and cBP was identified (p=0.189). The PWV was 0.8 m/s lower in patients with only one cardiovascular risk factor versus more than one, but without reaching statistical significance. cBPsys measured. A. FFR; B. FluidF vs BP+ Conclusions Using a FFR wire in the AAo as a high-fidelity pressure reference, we demonstrated that cBPsys derived from this new sphygmomanometer was accurate, with a non-significant bias (<5mmHg) and high precision (standard deviation <8mmHg) as recommended, criteria not met using the FF guiding catheter measurements. PWV measurements were also easily obtained from the FFR wire method.

Introduction. Among these viruses, the most harmful are viruses that are part of the wood furrow complex (Rugose wood complex), namely: wood furrow Rupestris - Rupestris stem pitting (RSPaV); Grapevine virus B (GVB); Grapevine virus A (GVA) - Grapevine virus A (GVA); pitted wood LN 33 - LN 33 stem grooving. These viruses are part of the European Community certification system and must be tested for the presence of these viruses in the production of seedlings. Grape viruses cause great damage to vineyards in the south of Ukraine, especially viruses of the wood complex of the furrow complex (Rugose wood complex) (eng. - RWC). The purpose of the research was to identify the presence of symptoms of viruses of this complex on vineyards in Odessa region and their identification. Methods. To conduct these studies, phytosanitary examination for the presence of wood furrow complex viruses was used, and real-time polymerase chain reaction (RT- -PCR) was used to identify viruses. Materials and methods research. The work used phytosanitary survey of vineyards in Ovidiopol, Bolgrad and Izmail districts of Odessa region, with a total area of 500 hectares. Samples with and without symptoms of virus infection were taken for real-time PCR diagnosis with hybridization-fluorescence detection (Real time PCR). To identify viruses of the RWC complex, the selection, storage and preparation of samples of grape plants was performed according to ISO 16578: 2013. Samples for RT-PCR were prepared according to the method of the authors, leaves or scrapes of woody shoots, in the amount of 100 mg, placed in a homogenizer (Tube-mill control, IKA, China) carefully ground, poured 2 ml of extraction GGB) buffer: Na2CO3 - 1.59 g / l, NaHCO3 - 2.93 g / l, 2% PVP-40, 0.2% BSA, 0.5 g / l Tween-20, 10 g / l Na2S2O5 ( pH 9.0) and incubated at 95 ºC for 10 minutes in the thermostat "Dry block" TDB-120 (Biosan, Latvia). After that, the samples were kept in the refrigerator for 3 hours at +4 ºC. Isolation of RNA viruses was performed according to the method, namely: 2 μl of the sample was added to 23 μl of the reaction mixture (H2O - 12.0 μl; 10 × PCR buffer - 2.5 μl; sucrose + cresol - 2.5 μl; 4 mm dNTP - 1.25 μl (1.76 mm -2.84 μl), DTT (dithiothreitol) - 1.24 μl, pr1 (10 pmol) - 1.25 μl, pr2 (10 pmol) - 1.25 μl, Taq polymerase (2.5 u / µl) (Pfu DNA, Fermentas, Lithuania) - 0.25 μl, revertase (200 u / µl) (RevertAidTM M-MuLV, Fermentas, Lithuania) - 0.04 μl, Mg2 + (50mM) - 0.75 μl, covered with a layer of oil for PCR and performed RT-PCR. RT-PCR in real time was performed using forward and reverse primers, fluorescently labeled DNA probes, the reaction mixture in the amount of 20 μl (H2O - 8.5 μl; 10 × PCR buffer - 2.5 μl; sucrose + cresol - 2.5 μl, 4 mm dNTP - 2.5 μl (1.76 mm - 2.84 μl), DTT - 1.24 μl, pr1 - 0.5 μm, pr2 - 0.5 μm, fluorescent probe - 0 , 1 μM, Taq polymerase (2.5 u / µl) (Pfu DNA, Fermentas, Lithuania) - 0.25 μl, revertase (200 u / µl) (RevertAidTM M-MuLV, Fermentas, Lithuania) - 0.04 μg; Mg2 + - 3.0 mm and 5 μl of NС, or PС, or internal control, or test sample (at the bottom of the tube). Concentrations of forward, reverse primers, fluorescent DNA probes were selected empirically. used a negative control sample (NCS) - 1xPLR buffer and a positive control sample (PCR) - biomaterial from the test system for ELISA (Agritest, Italy). NC from grape mitochondria. The following primers and labeled probes (Fermentas, Lithuania) were used to identify RT-PCR viruses in real time according to]: for grape wood furrow complex A (GVA) virus: GVA-77 f - CGACCGAAATATGTACCTGAATACTC - direct; GVA-192 r1 - TTTGCTAGCTTTAGGACCTACTATATCTACCT - reverse; GVA-192 r2 - CTTGCTAGCcTTAGGtCCTACTATATCTACCT - reverse; GVA-104 p - CTTCGGGTACATCGCCTTGGTCG - probe. To the virus B of the grape wood furrow complex (GVB): GVB-92 f1 - CTAGGAGTGCGGCTAAACGAA - direct; GVB-95 f2 - GGAGTGCGGCCAAACGA - direct; GVB-202 r1 - CCTTAACCTCGTCCTGTGATATGGT - reverse; GVB-119p2 - ACCGTTACGGCCGTTGTTACTGTTGTGGTAG - probe Reverse transcription and amplification included the following cycles: at 50 ° C for 2 minutes, 95 ° C for 15 minutes and 45 cycles of 95 ° C for 15 sec. and 57 ° C - 1 min. Amplification was performed in a programmable thermal cycler Rotor-Gene 6000 (Corbett Research Pty Ltd., Australia). Accounting for analysis results, calculation of threshold cycles was performed using Rotor-Gene 6000 Series Software 1.7. The sample was considered positive, in the analysis of which there is an increase in the fluorescent signal on one of the color channels of the amplifier. Results. As a result of optimizing the conditions of real-time RT-PCR, a successful concentration of MgCl2 was selected for the highest fluorescence signal intensity and it was found that the fluorescent signal curve was more optimal at MgCl2 concentration in the range 3.0 - 2.5 mm. As a result of the conducted researches only the virus B of a complex of furrowing of grapes was identified, other viruses were not revealed As a result of phytosanitary inspection of vineyards of Bolgrad, Izmiil and Ovidiopol districts of Odessa region, symptoms of viral damage to grape plants were revealed. For the first time, grape viruses were identified by a modified RT- PCR method, and diagnostic conditions were selected. Conclusions and prospects. As a result of phytosanitary inspection, grape viruses belonging to the furrow complex were found. The lesions of grape bushes by viruses of the wood furrow complex on the vineyards of the Bolgrad district of Odessa region were detected and identified. During the diagnosis, the PCR parameters were optimized, namely, the annealing temperature and magnesium concentration were tested. The obtained data will allow timely detection of viruses of the grape furrow complex, which can lead to a significant reduction in yield and prevent their spread. As a result of phytosanitary inspection of vineyards of Ovidiopol, Bolgrad and Izmail districts of Odessa region, 2 grape bushes with symptoms of viral disease of the grape furrow complex were found. For the first time in Ukraine, the method of real-time polymerase chain reaction with hybridization-fluorescence detection was used to diagnose viral disease, and the reaction conditions were selected and optimized. As a result of identification of the causative agent of the wood furrow complex by the RT-RF-PCR method, it was established that the vines were affected by the B complex virus (GVB).

Along with all the other baggage the British brought with them to Port Jackson in 1788 were laws of ownership that were totally foreign to the original inhabitants. The particular law I'll consider here is that of copyright. The result of a few hundred years of evolution, moulded by the common law and acts of Parliament, copyright protects the intellectual property of writers and artists (Saunders). It has three requirements: originality, material form and identifiable author. However, superimposed on the creative practices of the original inhabitants of Australia, copyright has proved a dismal failure. Its inability to continue its evolution means that it does not serve Indigenous Australians, whose creative practices do not fit neatly within its confines. The notions of 'rights' or 'ownership' inherent in current copyright law do not reflect, and are therefore unable to protect, Indigenous intellectual property. The limits of protection are summed up by Janke et al: '[c]ommercial interests are protected … rather than interests pertaining to cultural integrity … [r]ights are valid for a limited period … whereas under Indigenous laws, they exist in perpetuity. Individual notions of ownership are recognised, rather than the Indigenous concept of communal ownership' (Janke 1997). Practical effects of these limitations are the loss of copyright of stories written down or electronically recorded by outsiders, and the absence of special consideration for, or protection of, secret or sacred material (Janke 1997). Mansell notes that Aboriginal intellectual property rights are poorly protected by current laws be they copyright, patent, plant breeders, design laws or trademarks where 'the creative customs and practices of Aborigines' are different to those of whites, who 'emphasise the individual and provide the mechanisms for the commercialisation of an individual's activity. The traditional base of Aboriginal art forms was not created with this in mind' (Mansell 196). Indigenous cultures have their own systems for the protection of intellectual property which are predicated not on the protection of commercial advantage but on the meaning and cultural integrity of the work of art (Janke 1996 15; 1998a 4). Some of these so-called works of art are, in fact, 'law bearers'; these 'Indigenous traditional cultural productions are … legal titles to clan land' (Morris 6). Ignoring this meaning of cultural productions is a little like your bank manager framing your mortgage document or rental agreement for its aesthetic qualities, and evicting you from your house. While copyright law does acknowledge legally-defined entities like corporations or government departments as copyright holders, it is too limited in its definitions to recognise the complex familial relationships and reciprocal responsibilities of Aboriginal society. Under Indigenous laws 'individuals are differentiated in their awareness of elements of the local culture and in the way they make use of those elements depending on such things as their sex, their moiety or skin group, and their initiatory status' (Johnson 10). Given the complex nature of Indigenous attitudes to rights in and ownership of intellectual property, those concerned with questions of fairness in the administration of copyright law must take a new perspective. While copyright law appears, in the main, to have been unable to deal with a system of law which pre-dates it by thousands of years, there have recently been some tentative steps towards a recognition of Indigenous concerns. Golvan, acknowledging that much work needs to be done 'to ensure that the legal system is meaningful to Aboriginal people', sees some aspects of the judgement in the Carpets Case1 which 'show a strong determination to seek to unite Western copyright principles with the need to deal with issues of indigenous cultural harm' (Golvan 10). And, in Foster v Mountford 1976 (discussed below), Justice Muirhead noted that 'revelation of the secrets [contained in the offending book] … may undermine the social and religious stability of [the] hard-pressed community' (quoted in McDonald 24). These examples show some willingness on the part of the courts to take into account matters which fall outside of common law. While there has as yet been very little litigation regarding copyright ownership of written works, there is no reason to assume that this situation will continue. The first case of infringement of Aboriginal copyright to surface in the media occurred in 1966, when David Malangi's painting 'The Hunter' was adapted without permission as part of the design for the new one-dollar note (Johnson 13). Ten years later, the Pitjantjatjara Council was involved in litigation with Dr Mountford, 'an anthropologist who had been given information by the Pitjantjatjara people … in 1940 … about tribal sites and objects, communal legends, secrets, paintings, engravings, drawings and totemic geography' (McDonald 23). Interestingly, this particular case relied not on copyright law but on a breach of confidence as 'the material … was not protected by copyright, being material in which copyright either did not subsist, or in which copyright had expired' (23). This is a good example of the lack of protection afforded by copyright law to intellectual property of religious and spiritual significance.2 At first glance, the implications of the 1992 Mabo land rights case for publishing in Australia today might seem remote. However, some of the implications of this historic case hold the potential for a new approach to intellectual property rights which may actually serve the interests of Indigenous artists and writers. The importance to intellectual property rights of the Mabo decision lies in the fact that 'the Court held that … local law remains in place except to the extent that it may be in conflict with British law, and until it is over-ruled by the colonisers' 3 (McDonald 26). This meant that not only the myth of terra nullius was repudiated, but with it any notion that Australia was 'either a wild and lawless place or a legal blank slate. Indigenous customary law … was thereby given both recognition and validity' (26). Gray goes further than this, and states in relation to native title and Aboriginal art: 'the two in fact are quite inseparable if not exactly the same' (Gray 12). This statement strongly emphasises Morris' concerns expressed above, regarding the diminution of authority of 'cultural productions' when they are perceived as merely artistic objects. Pearson, in discussing Mabo, talks of native title as the 'recognition space' 4 between common law and Aboriginal law (Pearson 154). He points out that Aboriginal law exists, is practised is in fact a 'social reality', and adds that 'it is fictitious to assume that Aboriginal law is extinguished where the common law is unable to recognise that law' 5 (155). Recently the Australian Society of Authors (Heiss) prepared two discussion papers and a checklist for non-Indigenous writers who want to write about Indigenous culture. One of the papers, 'Australian Copyright vs Indigenous Intellectual and Cultural Property Rights', reiterates the point that the Copyright Act 1968 'as it stands is unsuited to protecting Indigenous culture'. It briefly discusses the desirability of the sharing of copyright between the Indigenous storyteller or informant and their non-Indigenous collaborator an issue I will examine in greater depth in my thesis on cross-cultural editing. A problematic practice, shared copyright deals with 'ownership' in a way that satisfies white or western conceptions but may compromise the Indigenous sense of (Indigenous) communal title to the work. The importance of effective copyright law for Indigenous Australians goes beyond the earning of royalties or the commercial 'ownership' of creative work: it refers to the protection of their cultural heritage (Heiss). One solution suggested by Janke is an amendment to 'the Copyright Act to provide moral rights (rights of attribution, no false attribution and cultural integrity)' (in Heiss). Another possible, though longer term solution, may lie in the way common law itself develops. It has evolved over time, albeit slowly, to suit the needs of the particular environment economic, technological, cultural or other in which it has to operate. As Ginsberg remarks in the context of the introduction of moral rights law to two common law countries, the US and Australia, regarding the gradual adoption of moral rights: 'a Common Law approach to moral rights … slowly builds up to the general principle from gritty examples worked out fact-by-fact. This accretion method is familiar to both our countries' legal approaches' (Ginsberg 34). This same accretion method could be used to change copyright law so that it more adequately protects Indigenous intellectual property. Whatever solution is reached, at present the copyright laws are colour-blind when presented with the complex and alien nature of Indigenous cultural practice. In the interests of reconciliation, natural justice and the integrity of Indigenous culture, reform cannot come too soon. NOTES 1. Milpurrurru v Indofurn Pty Ltd, 1995; an Australian company copied and adapted various Indigenous works of art and had them woven into carpets in Vietnam, and imported into Australia. Permission to use the designs was never sought. An award of almost $200,000 was made to the 8 artists involved, and the offending carpets were withdrawn from sale. By 1996, Indofurn had been wound up and the director declared bankrupt: the artists have not received a cent. (Janke 1998b 9). 2. Fortunately for the Pitjantjatjara elders, the court held that Mountford's book did constitute a breach of confidence. 3. 'The Court held that the rights of Indigenous inhabitants of a colony are the same as the rights of a conquered nation: local law remains in place except to the extent that it may be in conflict with British law, and until it is over-ruled by the colonisers' (McDonald 26). 4. 'Native title is therefore the space between the two systems, where there is recognition. Native title is, for want of a better formulation the recognition space between the common law and the Aboriginal law which now afforded recognition in particular circumstances' (Pearson 154). 5. However, some cases subsequent to Mabo place limitations upon the recognition of Indigenous traditional law. Justice Mason in Coe v Commonwealth of Australia (1993, at 115) stated that 'Mabo … is at odds with the notion … that [Indigenous Australians] are entitled to any rights and interest other than those created or recognised by the law of the Commonwealth, the [relevant] State… and the common law' (McDonald 2627). References Coe v Commonwealth of Australia (1993) 68 ALJR 110 Ginsberg, J. (1992). Moral Rights in a Common Law System. Moral Rights in a Copyright System. P. Anderson and D. Saunders. Brisbane, Qld: Institute for Cultural Policy Studies, Griffith University. Golvan, C. (1996). 'Aboriginal Art and Copyright.' Culture and Policy 7(3): 512. Gray, S. (1996). 'Black Enough? Urban and non-traditional Aboriginal art and proposed legislative protection for Aboriginal art.' Culture and Policy 7(3): 29-44 Heiss, A. (2001). Australian Copyright vs Indigenous Intellectual and Cultural Property Rights, Australian Society of Authors. < http://www.asauthors.org/resources> Accessed 15.08.01. Janke, T. (1996). 'Protecting Australian indigenous arts and cultural expression.' Culture and Policy 7(3): 1327. Janke, T. (1998a). Editorial. Queensland Community Arts Network News 1: 45. Janke, T. (1998b). Federal Court awards record damages to Aboriginal artists. Queensland Community Arts Network News 1: 89. Janke, T., Frankel, M. & Company, Solicitors (1997). Proposals For The Recognition and Protection of Indigenous Cultural and Intellectual Property, AIATSIS for the Indigenous Cultural and Intellectual Property Project. <http://www.icip.lawnet.com.au/> Accessed 25.4.98. Johnson, V. (1996). Copyrites: Aboriginal art in the age of reproductive technologies. Sydney, NSW: NIAAA & Macquarie University. Mansell, M. (1997). Barricading our last frontier Aboriginal cultural and intellectual propery rights. Our land is Our Life: Land rights past, present and future. G. Yunupingu. St Lucia, Qld, UQP: 195209. Milpurrurru v Indofurn Pty Ltd (1995) 30 IPR 209. Morris, C. (1998). The Responsibility of Maintaining the Oldest Continuous Culture in the World. Queensland Community Arts Network News 1: 67. Pearson, N. (1997). The Concept of Native Title at Common Law. Our Land is Our Life: Land rights past, present and future. G. Yunupingu. St Lucia, Qld, UQP: 150162. Saunders, D. (1992). Early Modern Law of Copyright in England: Statutes, courts and book cultures. Authorship and Copyright. D. Saunders. London, Routledge: 3574. Links http://www.icip.lawnet.com.au/ http://www.asauthors.org/resources Citation reference for this article MLA Style McDonnell, Margaret. "The Colour of Copyright" M/C: A Journal of Media and Culture 5.3 (2002). [your date of access] < http://www.media-culture.org.au/0207/copyright.php>. Chicago Style McDonnell, Margaret, "The Colour of Copyright" M/C: A Journal of Media and Culture 5, no. 3 (2002), < http://www.media-culture.org.au/0207/copyright.php> ([your date of access]). APA Style McDonnell, Margaret. (2002) The Colour of Copyright. M/C: A Journal of Media and Culture 5(3). < http://www.media-culture.org.au/0207/copyright.php> ([your date of access]).

This article reflects on part of a three-year battle over the redevelopment of an iconic Melbourne music venue, the Palace-Metro Nightclub (the Palace), involving the tactical use of Facebook Page data at trial. We were invited by the Save the Palace group, Melbourne City Council and the National Trust of Australia to provide Facebook Page data analysis as evidence of the social value of the venue at an appeals trial heard at the Victorian Civil Administration Tribunal (VCAT) in 2016. We take a reflexive ethnographic approach here to explore the data production, collection and analysis processes as these represent and constitute a “data public”.Although the developers won the appeal and were able to re-develop the site, the court accepted the validity of social media data as evidence of the building’s social value (Jinshan Investment Group Pty Ltd v Melbourne CC [2016] VCAT 626, 117; see also Victorian Planning Reports). Through the case, we elaborate on the concept of data publics by considering the “affordising” (Pollock) processes at play when extracting, analysing and visualising social media data. Affordising refers to the designed, deliberate and incidental effects of datafication and highlights the need to attend to the capacities for data collection and processing as they produce particular analytical outcomes. These processes foreground the compositional character of data publics, and the unevenness of data literacies (McCosker “Data Literacies”; Gray et al.) as a factor of the interpersonal and institutional capacity to read and mobilise data for social outcomes.We begin by reconsidering the often-assumed connection between social media data and their publics. Taking onboard theoretical accounts of publics as problem-oriented (Dewey) and dynamically constituted (Kelty), we conceptualise data publics through the key elements of a) consequentiality, b) sufficient connection over time, c) affective or emotional qualities of connection and interaction with the events. We note that while social data analytics may be a powerful tool for public protest, it equally affords use against public interests and introduces risks in relation to a lack of transparency, access or adequate data literacy.Urban Protest and Data Publics There are many examples globally of the use of social media to engage publics in battles over urban development or similar issues (e.g. Fredericks and Foth). Some have asked how social media might be better used by neighborhood organisations to mobilise protest and save historic buildings, cultural landmarks or urban sites (Johnson and Halegoua). And we can only note here the wealth of research literature on social movements, protest and social media. To emphasise Gerbaudo’s point, drawing on Mattoni, we “need to account for how exactly the use of these media reshapes the ‘repertoire of communication’ of contemporary movements and affects the experience of participants” (2). For us, this also means better understanding the role that social data plays in both aiding and reshaping urban protest or arming third sector groups with evidence useful in social institutions such as the courts.New modes of digital engagement enable forms of distributed digital citizenship, which Meikle sees as the creative political relationships that form through exercising rights and responsibilities. Associated with these practices is the transition from sanctioned, simple discursive forms of social protest in petitions, to new indicators of social engagement in more nuanced social media data and the more interactive forms of online petition platforms like change.org or GetUp (Halpin et al.). These technical forms code publics in specific ways that have implications for contemporary protest action. That is, they provide the operational systems and instructions that shape social actions and relationships for protest purposes (McCosker and Milne).All protest and social movements are underwritten by explicit or implicit concepts of participatory publics as these are shaped, enhanced, or threatened by communication technologies. But participatory protest publics are uneven, and as Kelty asks: “What about all the people who are neither protesters nor Twitter users? In the broadest possible sense this ‘General Public’ cannot be said to exist as an actual entity, but only as a kind of virtual entity” (27). Kelty is pointing to the porous boundary between a general public and an organised public, or formal enterprise, as a reminder that we cannot take for granted representations of a public, or the public as a given, in relation to Like or follower data for instance.If carefully gauged, the concept of data publics can be useful. To start with, the notions of publics and publicness are notoriously slippery. Baym and boyd explore the differences between these two terms, and the way social media reconfigures what “public” is. Does a Comment or a Like on a Facebook Page connect an individual sufficiently to an issues-public? As far back as the 1930s, John Dewey was seeking a pragmatic approach to similar questions regarding human association and the pluralistic space of “the public”. For Dewey, “the machine age has so enormously expanded, multiplied, intensified and complicated the scope of the indirect consequences [of human association] that the resultant public cannot identify itself” (157). To what extent, then, can we use data to constitute a public in relation to social protest in the age of data analytics?There are numerous well formulated approaches to studying publics in relation to social media and social networks. Social network analysis (SNA) determines publics, or communities, through links, ties and clustering, by measuring and mapping those connections and to an extent assuming that they constitute some form of sociality. Networked publics (Ito, 6) are understood as an outcome of social media platforms and practices in the use of new digital media authoring and distribution tools or platforms and the particular actions, relationships or modes of communication they afford, to use James Gibson’s sense of that term. “Publics can be reactors, (re)makers and (re)distributors, engaging in shared culture and knowledge through discourse and social exchange as well as through acts of media reception” (Ito 6). Hashtags, for example, facilitate connectivity and visibility and aid in the formation and “coordination of ad hoc issue publics” (Bruns and Burgess 3). Gray et al., following Ruppert, argue that “data publics are constituted by dynamic, heterogeneous arrangements of actors mobilised around data infrastructures, sometimes figuring as part of them, sometimes emerging as their effect”. The individuals of data publics are neither subjugated by the logics and metrics of digital platforms and data structures, nor simply sovereign agents empowered by the expressive potential of aggregated data (Gray et al.).Data publics are more than just aggregates of individual data points or connections. They are inherently unstable, dynamic (despite static analysis and visualisations), or vibrant, and ephemeral. We emphasise three key elements of active data publics. First, to be more than an aggregate of individual items, a data public needs to be consequential (in Dewey’s sense of issues or problem-oriented). Second, sufficient connection is visible over time. Third, affective or emotional activity is apparent in relation to events that lend coherence to the public and its prevailing sentiment. To these, we add critical attention to the affordising processes – or the deliberate and incidental effects of datafication and analysis, in the capacities for data collection and processing in order to produce particular analytical outcomes, and the data literacies these require. We return to the latter after elaborating on the Save the Palace case.Visualising Publics: Highlighting Engagement and IntensityThe Palace theatre was built in 1912 and served as a venue for theatre, cinema, live performance, musical acts and as a nightclub. In 2014 the Heritage Council decided not to include the Palace on Victoria’s heritage register and hence opened the door for developers, but Melbourne City Council and the National Trust of Australia opposed the redevelopment on the grounds of the building’s social significance as a music venue. Similarly, the Save the Palace group saw the proposed redevelopment as affecting the capacity of Melbourne CBD to host medium size live performances, and therefore impacting deeply on the social fabric of the local music scene. The Save the Palace group, chaired by Rebecca Leslie and Michael Raymond, maintained a 36,000+ strong Facebook Page and mobilised local members through regular public street protests, and participated in court proceedings in 2015 and February 2016 with Melbourne City Council and National Trust Australia. Joining the protesters in the lead up to the 2016 appeals trial, we aimed to use social media engagement data to measure, analyse and present evidence of the extent and intensity of a sustained protest public. The evidence we submitted had to satisfy VCAT’s need to establish the social value of the building and the significance of its redevelopment, and to explain: a) how social media works; b) the meaning of the number of Facebook Likes on the Save The Palace Page and the timing of those Likes, highlighting how the reach and Likes pick up at significant events; and c) whether or not a representative sample of Comments are supportive of the group and the Palace Theatre (McCosker “Statement”). As noted in the case (Jinshan, 117), where courts have traditionally relied on one simple measure for contemporary social value – the petition – our aim was to make use of the richer measures available through social media data, to better represent sustained engagement with the issues over time.Visualising a protest public in this way raises two significant problems for a workable concept of data publics. The first involves the “affordising” (Pollock) work of both the platform and our data analysis. This concerns the role played by data access and platform affordances for data capture, along with methodological choices made to best realise or draw out the affordances of the data for our purposes. The second concerns the issue of digital and data literacies in both the social acts that help to constitute a data public in the first place, and the capacity to read and write public data to represent those activities meaningfully. That is, Facebook and our analysis constitutes a data public in certain ways that includes potentially opaque decisions or processes. And citizens (protesters or casual Facebook commenters alike) along with social institutions (like the courts) have certain uneven capacity to effectively produce or read public protest-oriented data. The risk here, which we return to in the final section, lies in the potential for misrepresentation of publics through data, exclusions of access and ownership of data, and the uneven digital literacies at each stage of data production, analysis and sensemaking.Facebook captures data about individuals in intricate detail. Its data capture strategies are geared toward targeting for the purposes of marketing, although only a small subset of the data is publicly available through the Facebook Application Programming Interface (API), which is a kind of data “gateway”. The visible page data tells only part of the story. The total Page Likes in February 2016 was 36,828, representing a sizeable number of followers, mainly located in Melbourne but including 45 countries in total and 38 different languages. We extracted a data set of 268,211 engagements with the Page between February 2013 and August 2015. This included 45,393 post Likes and 9,139 Comments. Our strategy was to demarcate a structurally defined “community” (in the SNA sense of that term as delineating clusters of people, activities and links within a broader network), by visualising the interactions of Facebook users with Posts over time, and then examine elements of intensity of engagement. In other words, we “affordised” the network data using SNA techniques to most clearly convey the social value of the networked public.We used a combination of API access and Facebook’s native Insights data and analytics to extract use-data from that Page between June 2013 and December 2015. Analysis of a two-mode or bipartite network consisting of users and Posts was compiled using vosonSML, a package in the R programming language created at Australian National University (Graham and Ackland) and visualised with Gephi software. In this network, the nodes (or vertices) represent Facebook users and Facebook Posts submitted on the Page, and ties (or edges) between nodes represent whether a user has commented on and/or liked a post. For example, a user U might have liked Post A and commented on Post B. Additionally, a weight value is assigned for the Comments ties, indicating how many times a user commented on a particular post (note that users can only like Posts once). We took these actions as demonstrating sufficient connection over time in relation to an issue of common concern.Figure 1: Network visualisation of activity on the Save the Palace Facebook Page, June 2013 to December 2015. The colour of the nodes denotes which ‘community’ cluster they belong to (computed via the Infomap algorithm) and nodes are sized by out-degree (number of Likes/Comments made by users to Posts). The graph layout is computed via the Force Atlas 2 algorithm.Community detection was performed on the network using the Infomap algorithm (Rosvall and Bergstrom), which is suited to large-scale weighted and directed networks (Henman et al.). This analysis reveals two large and two smaller clusters or groups represented by colour differences (Fig. 1). Broadly, this suggests the presence of several clusters amongst a sustained network engaging with the page over the three years. Beyond this, a range of other colours denoting smaller clusters indicates a diversity of activity and actors co-participating in the network as part of a broader community.The positioning of nodes within the network is not random – the visualisation is generated by the Force Atlas 2 algorithm (Jacomy et al.) that spatially sorts the nodes through processes of attraction and repulsion according to the observed patterns of connectivity. As we would expect, the two-dimensional spatial arrangement of nodes conforms to the community clustering, helping us to visualise the network in the form of a networked public, and build a narrative interpretation of “what is going on” in this online social space.Social value for VCAT was loosely defined as a sense of connection, sentiment and attachment to the venue. While we could illustrate the extent of the active connections of those engaging with the Page, the network map does not in itself reveal much about the sentiment, or the emotional attachment to the Save the Palace cause. This kind of affect can be understood as “the energy that drives, neutralizes, or entraps networked publics” (Papacharissi 7), and its measure presents a particular challenge, but also interest, for understanding a data public. It is often measured through sentiment analysis of content, but we targeted reach and engagement events – particular moments that indicated intense interaction with the Page and associated events.Figure 2: Save the Palace Facebook Page: Organic post reach November—December 2014The affective connection and orientation could be demonstrated through two dimensions of post “reach”: average reach across the lifespan of the Page, and specific “reach-events”. Average reach illustrates the sustained engagement with the Page over time. Average un-paid reach for Posts with links (primarily news and legal updates), was 12,015 or 33% of the total follower base – a figure well above the standard for Community Page reach at that time. Reach-events indicated particular points of intensity and illustrates the Page’s ability to resonate publicly. Figure 2 points to one such event in November 2015, when news circulated that the developers were defying stop-work orders and demolishing parts of The Palace. The 100k reach indicated intense and widespread activity – Likes, Shares, Comments – in a short timeframe. We examined Comment activity in relation to specific reach events to qualify this reach event and illustrate the sense of outrage directed toward the developers, and expressions of solidarity toward those attempting to stop the redevelopment. Affordising Data Publics and the Transformative Work of AnalyticsEach stage of deriving evidence of social value through Page data, from building public visibility and online activity to analysis and presentation at VCAT, was affected by the affordising work of the protesters involved (particularly the Page Admins), civil society groups, platform features and data structures and our choices in analysis and presentation. The notion of affordising is useful here because, as Pollock defines the term, it draws attention to the transformative work of metrics, analytics, platform features and other devices that re-package social activity through modes of datafication and analysis. The Save the Palace group mobilised in a particular way so as to channel their activities, make them visible and archival, to capture the resonant effects of their public protest through a platform that would best make that public visible to itself. The growth of the interest in the Facebook Page feeds back on itself reflexively as more people encounter it and participate. Contrary to critiques of “clicktivism”, these acts combine digital-material events and activities that were to become consequential for the public protest – such as the engagement activities around the November 2015 event described in Figure 2.In addition, presenting the research in court introduced particular hurdles, in finding “the meaningful data” appropriate to the needs of the case, “visualizing social data for social purposes”, and the need to be “evocative as well as accurate” (Donath, 16). The visualisation and presentation of the data needed to afford a valid and meaningful expression of the social significance the Palace. Which layout algorithm to use? What scale do we want to use? Which community detection algorithm and colour scheme for nodes? These choices involve challenges regarding legibility of visualisations of public data (McCosker and Wilken; Kennedy et al.).The transformative actions at play in these tactics of public data analysis can inform other instances of data-driven protest or social participation, but also leave room for misuse. The interests of developers, for example, could equally be served by monitoring protesters’ actions through the same data, or by targeting disagreement or ambiguity in the data. Similarly, moves by Facebook to restrict access to Page data will disproportionately affect those without the means to pay for access. These tactics call for further work in ethical principles of open data, standardisation and data literacies for the courts and those who would benefit from use of their own public data in this way.ConclusionsWe have argued through the case of the Save the Palace protest that in order to make use of public social media data to define a data public, multiple levels of data literacy, access and affordising are required. Rather than assuming that public data simply constitutes a data public, we have emphasised: a) the consequentiality of the movement; b) sufficient connection over time; and c) affective or emotional qualities of connection and interaction with public events. This includes the activities of the core members of the Save the Palace protest group, and the tens of thousands who engaged in some way with the Page. It also involves Facebook’s data affordances as these allow for the extraction of public data, alongside our choices in analysis and visualisation, and the court’s capacity and openness to accept all of this as indicative of the social value (connections, sentiment, attachment) it sought for the case. The Senior Member and Member presiding over the case had little knowledge of Facebook or other social media platforms, did not use them, and hence themselves had limited capacity to recognise the social and cultural nuances of activities that took place through the Facebook Page. This does not exclude the use of the data but made it more difficult to present a picture of the relevance and consequence of the data for understanding the social value evident in the contested building. While the court’s acceptance of the analysis as evidence is a significant starting point, further work is required to ensure openness, standardisation and ethical treatment of public data within public institutions like the courts. ReferencesBruns, A., and J. Burgess. “The Use of Twitter Hashtags in the Formation of Ad Hoc Publics.” 6th European Consortium for Political Research General Conference, University of Iceland, Reykjavík, 25-27 August 2011. 1 Aug. 2018 <http://eprints.qut.edu.au/46515/>.Baym, N.K., and d. boyd. “Socially Mediated Publicness: An Introduction.” Journal of Broadcasting & Electronic Media 56.3 (2012): 320-329.Dewey, J. The Public and Its Problems: An Essay in Political Inquiry. Athens, Ohio: Swallow P, 2016 [1927].Donath, J. The Social Machine: Designs for Living Online. Cambridge: MIT P, 2014.Fredericks, J., and M. Foth. “Augmenting Public Participation: Enhancing Planning Outcomes through the Use of Social Media and Web 2.0.” Australian Planner 50.3 (2013): 244-256.Gerbaudo, P. Tweets and the Streets: Social Media and Contemporary Activism. New York: Pluto P, 2012.Gibson, J.J. The Ecological Approach to Visual Perception. Boston: Houghton Mifflin Harcourt, 1979.Graham, T., and R. Ackland. “SocialMediaLab: Tools for Collecting Social Media Data and Generating Networks for Analysis.” CRAN (The Comprehensive R Archive Network). 2018. 1 Aug. 2018 <https://cran.r- project.org/web/packages/SocialMediaLab/SocialMediaLab.pdf>.Gray J., C. Gerlitz, and L. Bounegru. “Data Infrastructure Literacy.” Big Data & Society 5.2 (2018). 1 Aug. 2018 <https://doi.org/10.1177/2053951718786316>.Halpin, T., A. Vromen, M. Vaughan, and M. Raissi. “Online Petitioning and Politics: The Development of Change.org in Australia.” Australian Journal of Political Science (2018). 1 Aug. 2018 <https://doi.org/10.1080/10361146.2018.1499010>.Henman, P., R. Ackland, and T. Graham. “Community Structure in e-Government Hyperlink Networks.” Proceedings of the 14th European Conference on e-Government (ECEG ’14), 12-13 June 2014, Brasov, Romania.Ito, M. “Introduction.” Networked Publics. Ed. K. Varnelis. Cambridge, MA.: MIT P, 2008. 1-14.Jacomy M., T. Venturini, S. Heymann, and M. Bastian. “ForceAtlas2, a Continuous Graph Layout Algorithm for Handy Network Visualization Designed for the Gephi Software.” PLoS ONE 9.6 (2014): e98679. 1 Aug. 2018 <https://doi.org/10.1371/journal.pone.0098679>.Jinshan Investment Group Pty Ltd v Melbourne CC [2016] VCAT 626, 117. 2016. 1 Aug. 2018 <https://bit.ly/2JGRnde>.Johnson, B., and G. Halegoua. “Can Social Media Save a Neighbourhood Organization?” Planning, Practice & Research 30.3 (2015): 248-269.Kennedy, H., R.L. Hill, G. Aiello, and W. Allen. “The Work That Visualisation Conventions Do.” Information, Communication & Society, 19.6 (2016): 715-735.Mattoni, A. Media Practices and Protest Politics: How Precarious Workers Mobilise. Burlington, VT: Ashgate, 2012.McCosker, A. “Data Literacies for the Postdemographic Social Media Self.” First Monday 22.10 (2017). 1 Aug. 2018 <http://firstmonday.org/ojs/index.php/fm/article/view/7307/6550>.McCosker, A. “Statement of Evidence: Palace Theatre Facebook Page Analysis.” Submitted to the Victorian Civil Administration Tribunal, 7 Dec. 2015. 1 Aug. 2018 <https://www.academia.edu/37130238/Evidence_Statement_Save_the_Palace_Facebook_Page_Analysis_VCAT_2015_>.McCosker, A., and M. Esther. "Coding Labour." Cultural Studies Review 20.1 (2014): 4-29.McCosker, A., and R. Wilken. “Rethinking ‘Big Data’ as Visual Knowledge: The Sublime and the Diagrammatic in Data Visualisation.” Visual Studies 29.2 (2014): 155-164.Meikle, G. Social Media: Communication, Sharing and Visibility. New York: Routledge, 2016.Papacharissi, Z. Affective Publics: Sentiment, Technology, and Politics. Oxford: Oxford UP, 2015.Pollock, N. “Ranking Devices: The Socio-Materiality of Ratings.” Materiality and Organizing: Social Interaction in a Technological World. Eds. P.M. Leonardi, Bonnie A. Nardi, and J. Kallinikos. Oxford: Oxford UP, 2012. 91-114.Rosvall, M., and C.T. Bergstrom. “Maps of Random Walks on Complex Networks Reveal Community Structure.” Proceedings of the National Academy of Sciences of the United States of America 105.4 (2008): 1118-1123.Ruppert E. “Doing the Transparent State: Open Government Data as Performance Indicators.” A World of Indicators: The Making of Governmental Knowledge through Quantification. Eds. R. Rottenburg S.E. Merry, S.J. Park, et al. Cambridge: Cambridge UP, 2015. 1–18.Smith, N., and T. Graham. “Mapping the Anti-Vaccination Movement on Facebook.” Information, Communication & Society (2017). 1 Aug. 2018 <https://doi.org/10.1080/1369118X.2017.1418406>.Victorian Planning Reports. “Editorial Comment.” VCAT 3.16 (2016). 1 Aug. 2018 <https://www.vprs.com.au/394-past-editorials/vcat/1595-vcat-volume-3-no-16>.

Introduction Ireland did not have a tradition of printed cookbooks prior to the 20th century. As a consequence, Irish culinary manuscripts from before this period are an important primary source for historians. This paper makes the case that the manuscripts are a unique way of accessing voices that have quotidian concerns seldom heard above the dominant narratives of conquest, colonisation and famine (Higgins; Dawson). Three manuscripts are examined to see how they contribute to an understanding of Irish social and culinary history. The Irish banking crisis of 2008 is a reminder that comments such as the one in the title of this paper may be more then a casual remark, indicating rather an underlying anxiety. Equally important is the evidence in the manuscripts that Ireland had a domestic culinary tradition sited within the culinary traditions of the British Isles. The terms “vernacular”, representing localised needs and traditions, and “polite”, representing stylistic features incorporated for aesthetic reasons, are more usually applied in the architectural world. As terms, they reflect in a politically neutral way the culinary divide witnessed in the manuscripts under discussion here. Two of the three manuscripts are anonymous, but all are written from the perspective of a well-provisioned house. The class background is elite and as such these manuscripts are not representative of the vernacular, which in culinary terms is likely to be a tradition recorded orally (Gold). The first manuscript (NLI, Tervoe) and second manuscript (NLI, Limerick) show the levels of impact of French culinary influence through their recipes for “cullis”. The Limerick manuscript also opens the discussion to wider social concerns. The third manuscript (NLI, Baker) is unusual in that the author, Mrs. Baker, goes to great lengths to record the provenance of the recipes and as such the collection affords a glimpse into the private “polite” world of the landed gentry in Ireland with its multiplicity of familial and societal connections. Cookbooks and Cuisine in Ireland in the 19th Century During the course of the 18th century, there were 136 new cookery book titles and 287 reprints published in Britain (Lehmann, Housewife 383). From the start of the 18th to the end of the 19th century only three cookbooks of Irish, or Anglo-Irish, authorship have been identified. The Lady’s Companion: or Accomplish’d Director In the whole Art of Cookery was published in 1767 by John Mitchell in Skinner-Row, under the pseudonym “Ceres,” while the Countess of Caledon’s Cheap Receipts and Hints on Cookery: Collected for Distribution Amongst the Irish Peasantry was printed in Armagh by J. M. Watters for private circulation in 1847. The modern sounding Dinners at Home, published in London in 1878 under the pseudonym “Short”, appears to be of Irish authorship, a review in The Irish Times describing it as being written by a “Dublin lady”, the inference being that she was known to the reviewer (Farmer). English Copyright Law was extended to Ireland in July 1801 after the Act of Union between Great Britain and Ireland in 1800 (Ferguson). Prior to this, many titles were pirated in Ireland, a cause of confusion alluded to by Lehmann when she comments regarding the Ceres book that it “does not appear to be simply a Dublin-printed edition of an English book” (Housewife 403). This attribution is based on the dedication in the preface: “To The Ladies of Dublin.” From her statement that she had a “great deal of experience in business of this kind”, one may conclude that Ceres had worked as a housekeeper or cook. Cheap Receipts and Hints on Cookery was the second of two books by Catherine Alexander, Countess of Caledon. While many commentators were offering advice to Irish people on how to alleviate their poverty, in Friendly Advice to Irish Mothers on Training their Children, Alexander was unusual in addressing her book specifically to its intended audience (Bourke). In this cookbook, the tone is of a practical didactic nature, the philosophy that of enablement. Given the paucity of printed material, manuscripts provide the main primary source regarding the existence of an indigenous culinary tradition. Attitudes regarding this tradition lie along the spectrum exemplified by the comments of an Irish journalist, Kevin Myers, and an eminent Irish historian, Louis Cullen. Myers describes Irish cuisine as a “travesty” and claims that the cuisine of “Old Ireland, in texture and in flavour, generally resembles the cinders after the suttee of a very large, but not very tasty widow”, Cullen makes the case that Irish cuisine is “one of the most interesting culinary traditions in Europe” (141). It is not proposed to investigate the ideological standpoints behind the various comments on Irish food. Indeed, the use of the term “Irish” in this context is fraught with difficulty and it should be noted that in the three manuscripts proposed here, the cuisine is that of the gentry class and representative of a particular stratum of society more accurately described as belonging to the Anglo-Irish tradition. It is also questionable how the authors of the three manuscripts discussed would have described themselves in terms of nationality. The anxiety surrounding this issue of identity is abating as scholarship has moved from viewing the cultural artifacts and buildings inherited from this class, not as symbols of an alien heritage, but rather as part of the narrative of a complex country (Rees). The antagonistic attitude towards this heritage could be seen as reaching its apogee in the late 1950s when the then Government minister, Kevin Boland, greeted the decision to demolish a row of Georgian houses in Dublin with jubilation, saying that they stood for everything that he despised, and describing the Georgian Society, who had campaigned for their preservation, as “the preserve of the idle rich and belted earls” (Foster 160). Mac Con Iomaire notes that there has been no comprehensive study of the history of Irish food, and the implications this has for opinions held, drawing attention to the lack of recognition that a “parallel Anglo-Irish cuisine existed among the Protestant elite” (43). To this must be added the observation that Myrtle Allen, the doyenne of the Irish culinary world, made when she observed that while we have an Irish identity in food, “we belong to a geographical and culinary group with Wales, England, and Scotland as all counties share their traditions with their next door neighbour” (1983). Three Irish Culinary Manuscripts The three manuscripts discussed here are held in the National Library of Ireland (NLI). The manuscript known as Tervoe has 402 folio pages with a 22-page index. The National Library purchased the manuscript at auction in December 2011. Although unattributed, it is believed to come from Tervoe House in County Limerick (O’Daly). Built in 1776 by Colonel W.T. Monsell (b.1754), the Monsell family lived there until 1951 (see, Fig. 1). The house was demolished in 1953 (Bence-Jones). William Monsell, 1st Lord Emly (1812–94) could be described as the most distinguished of the family. Raised in an atmosphere of devotion to the Union (with Great Britain), loyalty to the Church of Ireland, and adherence to the Tory Party, he converted in 1850 to the Roman Catholic religion, under the influence of Cardinal Newman and the Oxford Movement, changing his political allegiance from Tory to Whig. It is believed that this change took place as a result of the events surrounding the Great Irish Famine of 1845–50 (Potter). The Tervoe manuscript is catalogued as 18th century, and as the house was built in the last quarter of the century, it would be reasonable to surmise that its conception coincided with that period. It is a handsome volume with original green vellum binding, which has been conserved. Fig. 1. Tervoe House, home of the Monsell family. In terms of culinary prowess, the scope of the Tervoe manuscript is extensive. For the purpose of this discussion, one recipe is of particular interest. The recipe, To make a Cullis for Flesh Soups, instructs the reader to take the fat off four pounds of the best beef, roast the beef, pound it to a paste with crusts of bread and the carcasses of partridges or other fowl “that you have by you” (NLI, Tervoe). This mixture should then be moistened with best gravy, and strong broth, and seasoned with pepper, thyme, cloves, and lemon, then sieved for use with the soup. In 1747 Hannah Glasse published The Art of Cookery, Made Plain and Easy. The 1983 facsimile edition explains the term “cullis” as an Anglicisation of the French word coulis, “a preparation for thickening soups and stews” (182). The coulis was one of the essential components of the nouvelle cuisine of the 18th century. This movement sought to separate itself from “the conspicuous consumption of profusion” to one where the impression created was one of refinement and elegance (Lehmann, Housewife 210). Reactions in England to this French culinary innovation were strong, if not strident. Glasse derides French “tricks”, along with French cooks, and the coulis was singled out for particular opprobrium. In reality, Glasse bestrides both sides of the divide by giving the much-hated recipe and commenting on it. She provides another example of this in her recipe for The French Way of Dressing Partridges to which she adds the comment: “this dish I do not recommend; for I think it an odd jumble of thrash, by that time the Cullis, the Essence of Ham, and all other Ingredients are reckoned, the Partridges will come to a fine penny; but such Receipts as this, is what you have in most Books of Cookery yet printed” (53). When Daniel Defoe in The Complete English Tradesman of 1726 criticised French tradesmen for spending so much on the facades of their shops that they were unable to offer their customers a varied stock within, we can see the antipathy spilling over into other creative fields (Craske). As a critical strategy, it is not dissimilar to Glasse when she comments “now compute the expense, and see if this dish cannot be dressed full as well without this expense” at the end of a recipe for the supposedly despised Cullis for all Sorts of Ragoo (53). Food had become part of the defining image of Britain as an aggressively Protestant culture in opposition to Catholic France (Lehmann Politics 75). The author of the Tervoe manuscript makes no comment about the dish other than “A Cullis is a mixture of things, strained off.” This is in marked contrast to the second manuscript (NLI, Limerick). The author of this anonymous manuscript, from which the title of this paper is taken, is considerably perplexed by the term cullis, despite the manuscript dating 1811 (Fig. 2). Of Limerick provenance also, but considerably more modest in binding and scope, the manuscript was added to for twenty years, entries terminating around 1831. The recipe for Beef Stake (sic) Pie is an exact transcription of a recipe in John Simpson’s A Complete System of Cookery, published in 1806, and reads Cut some beef steaks thin, butter a pan (or as Lord Buckingham’s cook, from whom these rects are taken, calls it a soutis pan, ? [sic] (what does he mean, is it a saucepan) [sic] sprinkle the pan with pepper and salt, shallots thyme and parsley, put the beef steaks in and the pan on the fire for a few minutes then put them to cool, when quite cold put them in the fire, scrape all the herbs in over the fire and ornament as you please, it will take an hour and half, when done take the top off and put in some coulis (what is that?) [sic]. Fig. 2. Beef Stake Pie (NLI, Limerick). Courtesy of the National Library of Ireland. Simpson was cook to Lord Buckingham for at least a year in 1796, and may indeed have travelled to Ireland with the Duke who had several connections there. A feature of this manuscript are the number of Cholera remedies that it contains, including the “Rect for the cholera sent by Dr Shanfer from Warsaw to the Brussels Government”. Cholera had reached Germany by 1830, and England by 1831. By March 1832, it had struck Belfast and Dublin, the following month being noted in Cork, in the south of the country. Lasting a year, the epidemic claimed 50,000 lives in Ireland (Fenning). On 29 April 1832, the diarist Amhlaoibh Ó Súilleabháin notes, “we had a meeting today to keep the cholera from Callan. May God help us” (De Bhaldraithe 132). By 18 June, the cholera is “wrecking destruction in Ennis, Limerick and Tullamore” (135) and on 26 November, “Seed being sown. The end of the month wet and windy. The cholera came to Callan at the beginning of the month. Twenty people went down with it and it left the town then” (139). This situation was obviously of great concern and this is registered in the manuscript. Another concern is that highlighted by the recommendation that “this receipt is as good as the bank. It has been obligingly given to Mrs Hawkesworth by the chief book keeper at the Bank of Ireland” (NLI, Limerick). The Bank of Ireland commenced business at St. Mary’s Abbey in Dublin in June 1783, having been established under the protection of the Irish Parliament as a chartered rather then a central bank. As such, it supplied a currency of solidity. The charter establishing the bank, however, contained a prohibitory clause preventing (until 1824 when it was repealed) more then six persons forming themselves into a company to carry on the business of banking. This led to the formation, especially outside Dublin, of many “small private banks whose failure was the cause of immense wretchedness to all classes of the population” (Gilbert 19). The collapse that caused the most distress was that of the Ffrench bank in 1814, founded eleven years previously by the family of Lord Ffrench, one of the leading Catholic peers, based in Connacht in the west of Ireland. The bank issued notes in exchange for Bank of Ireland notes. Loans from Irish banks were in the form of paper money which were essentially printed promises to pay the amount stated and these notes were used in ordinary transactions. So great was the confidence in the Ffrench bank that their notes were held by the public in preference to Bank of Ireland notes, most particularly in Connacht. On 27 June 1814, there was a run on the bank leading to collapse. The devastation spread through society, from business through tenant farmers to the great estates, and notably so in Galway. Lord Ffrench shot himself in despair (Tennison). Williams and Finn, founded in Kilkenny in 1805, entered bankruptcy proceedings in 1816, and the last private bank outside Dublin, Delacours in Mallow, failed in 1835 (Barrow). The issue of bank failure is commented on by writers of the period, notably so in Dickens, Thackery, and Gaskill, and Edgeworth in Ireland. Following on the Ffrench collapse, notes from the Bank of Ireland were accorded increased respect, reflected in the comment in this recipe. The receipt in question is one for making White Currant Wine, with the unusual addition of a slice of bacon suspended from the bunghole when the wine is turned, for the purpose of enriching it. The recipe was provided to “Mrs Hawkesworth by the chief book keeper of the bank” (NLI, Limerick). In 1812, a John Hawkesworth, agent to Lord CastleCoote, was living at Forest Lodge, Mountrath, County Laois (Ennis Chronicle). The Coote family, although settling in County Laois in the seventeenth century, had strong connections with Limerick through a descendent of the younger brother of the first Earl of Mountrath (Landed Estates). The last manuscript for discussion is the manuscript book of Mrs Abraham Whyte Baker of Ballytobin House, County Kilkenny, 1810 (NLI, Baker). Ballytobin, or more correctly Ballaghtobin, is a townland in the barony of Kells, four miles from the previously mentioned Callan. The land was confiscated from the Tobin family during the Cromwellian campaign in Ireland of 1649–52, and was reputedly purchased by a Captain Baker, to establish what became the estate of Ballaghtobin (Fig. 3) To this day, it is a functioning estate, remaining in the family, twice passing down through the female line. In its heyday, there were two acres of walled gardens from which the house would have drawn for its own provisions (Ballaghtobin). Fig. 3. Ballaghtobin 2013. At the time of writing the manuscript, Mrs. Sophia Baker was widowed and living at Ballaghtobin with her son and daughter-in-law, Charity who was “no beauty, but tall, slight” (Herbert 414). On the succession of her husband to the estate, Charity became mistress of Ballaghtobin, leaving Sophia with time on what were her obviously very capable hands (Nevin). Sophia Baker was the daughter of Sir John Blunden of Castle Blunden and Lucinda Cuffe, daughter of the first Baron Desart. Sophia was also first cousin of the diarist Dorothea Herbert, whose mother was Lucinda’s sister, Martha. Sophia Baker and Dorothea Herbert have left for posterity a record of life in the landed gentry class in rural Georgian Ireland, Dorothea describing Mrs. Baker as “full of life and spirits” (Herbert 70). Their close relationship allows the two manuscripts to converse with each other in a unique way. Mrs. Baker’s detailing of the provenance of her recipes goes beyond the norm, so that what she has left us is not just a remarkable work of culinary history but also a palimpsest of her family and social circle. Among the people she references are: “my grandmother”; Dorothea Beresford, half sister to the Earl of Tyrone, who lived in the nearby Curraghmore House; Lady Tyrone; and Aunt Howth, the sister of Dorothea Beresford, married to William St Lawrence, Lord Howth, and described by Johnathan Swift as “his blue eyed nymph” (195). Other attributions include Lady Anne Fitzgerald, wife of Maurice Fitzgerald, 16th knight of Kerry, Sir William Parsons, Major Labilen, and a Mrs. Beaufort (Fig. 4). Fig. 4. Mrs. Beauforts Rect. (NLI, Baker). Courtesy of the National Library of Ireland. That this Mrs. Beaufort was the wife of Daniel Augustus Beaufort, mother of the hydrographer Sir Francis Beaufort, may be deduced from the succeeding recipe supplied by a Mrs. Waller. Mrs. Beaufort’s maiden name was Waller. Fanny Beaufort, the elder sister of Sir Francis, was Richard Edgeworth’s fourth wife and close friend and confidante of his daughter Maria, the novelist. There are also entries for “Miss Herbert” and “Aunt Herbert.” While the Baker manuscript is of interest for the fact that it intersects the worlds of the novelist Maria Edgeworth and the diarist Dorothea Herbert, and for the societal references that it documents, it is also a fine collection of recipes that date back to the mid-18th century. An example of this is a recipe for Sligo pickled salmon that Mrs. Baker, nee Blunden, refers to in an index that she gives to a second volume. Unfortunately this second volume is not known to be extant. This recipe features in a Blunden family manuscript of 1760 as referred to in Anelecta Hibernica (McLysaght). The recipe has also appeared in Cookery and Cures of Old Kilkenny (St. Canices’s 24). Unlike the Tervoe and Limerick manuscripts, Mrs. Baker is unconcerned with recipes for “cullis”. Conclusion The three manuscripts that have been examined here are from the period before the famine of 1845–50, known as An Gorta Mór, translated as “the big hunger”. The famine preceding this, Bliain an Áir (the year of carnage) in 1740–1 was caused by extremely cold and rainy weather that wiped out the harvest (Ó Gráda 15). This earlier famine, almost forgotten today, was more severe than the subsequent one, causing the death of an eight of the population of the island over one and a half years (McBride). These manuscripts are written in living memory of both events. Within the world that they inhabit, it may appear there is little said about hunger or social conditions beyond the walls of their estates. Subjected to closer analysis, however, it is evident that they are loquacious in their own unique way, and make an important contribution to the narrative of cookbooks. Through the three manuscripts discussed here, we find evidence of the culinary hegemony of France and how practitioners in Ireland commented on this in comparatively neutral fashion. An awareness of cholera and bank collapses have been communicated in a singular fashion, while a conversation between diarist and culinary networker has allowed a glimpse into the world of the landed gentry in Ireland during the Georgian period. References Allen, M. “Statement by Myrtle Allen at the opening of Ballymaloe Cookery School.” 14 Nov. 1983. Ballaghtobin. “The Grounds”. nd. 13 Mar. 2013. ‹http://www.ballaghtobin.com/gardens.html›. Barrow, G.L. “Some Dublin Private Banks.” Dublin Historical Record 25.2 (1972): 38–53. Bence-Jones, M. A Guide to Irish Country Houses. London: Constable, 1988. Bourke, A. Ed. Field Day Anthology of Irish Writing Vol V. Cork: Cork UP, 2002. Craske, M. “Design and the Competitive Spirit in Early and Mid 18th Century England”, Journal of Design History 12.3 (1999): 187–216. Cullen, L. The Emergence of Modern Ireland. London: Batsford, 1981. Dawson, Graham. “Trauma, Memory, Politics. The Irish Troubles.” Trauma: Life Stories of Survivors. Ed. Kim Lacy Rogers, Selma Leydesdorff and Graham Dawson. New Jersey: Transaction P, 2004. De Bhaldraithe,T. Ed. Cín Lae Amhlaoibh. Cork: Mercier P, 1979. Ennis Chronicle. 12–23 Feb 1812. 10 Feb. 2013 ‹http://astheywere.blogspot.ie/2012/12/ennis-chronicle-1812-feb-23-feb-12.html› Farmar, A. E-mail correspondence between Farmar and Dr M. Mac Con Iomaire, 26 Jan. 2011. Fenning, H. “The Cholera Epidemic in Ireland 1832–3: Priests, Ministers, Doctors”. Archivium Hibernicum 57 (2003): 77–125. Ferguson, F. “The Industrialisation of Irish Book Production 1790-1900.” The Oxford History of the Irish Book, Vol. IV The Irish Book in English 1800-1891. Ed. J. Murphy. Oxford: Oxford UP, 2011. Foster, R.F. Luck and the Irish: A Brief History of Change from 1970. Oxford: Oxford UP, 2008. Gilbert, James William. The History of Banking in Ireland. London: Longman, Rees, Orme, Brown, Green, and Longman, 1836. Glasse, Hannah. The Art of Cookery Made Plain and Easy by a Lady: Facsimile Edition. Devon: Prospect, 1983. Gold, C. Danish Cookbooks. Seattle: U of Washington P, 2007. Herbert, D. Retrospections of an Outcast or the Life of Dorothea Herbert. London: Gerald Howe, 1929. Higgins, Michael D. “Remarks by President Michael D. Higgins reflecting on the Gorta Mór: the Great famine of Ireland.” Famine Commemoration, Boston, 12 May 2012. 18 Feb. 2013 ‹http://www.president.ie/speeches/ › Landed Estates Database, National University of Galway, Moore Institute for Research, 10 Feb. 2013 ‹http://landedestates.nuigalway.ie/LandedEstates/jsp/family-show.jsp?id=633.› Lehmann, G. The British Housewife: Cookery books, cooking and society in eighteenth-century Britain. Totnes: Prospect, 1993. ---. “Politics in the Kitchen.” 18th Century Life 23.2 (1999): 71–83. Mac Con Iomaire, M. “The Emergence, Development and Influence of French Haute Cuisine on Public Dining in Dublin Restaurants 1900-2000: An Oral History”. Vol. 2. PhD thesis. Dublin Institute of Technology. 2009. 8 Mar. 2013 ‹http://arrow.dit.ie/tourdoc/12›. McBride, Ian. Eighteenth Century Ireland: The Isle of Slaves. Dublin: Gill and Macmillan, 2009. McLysaght, E.A. Anelecta Hibernica 15. Dublin: Irish Manuscripts Commission, 1944. Myers, K. “Dinner is served ... But in Our Culinary Dessert it may be Korean.” The Irish Independent 30 Jun. 2006. Nevin, M. “A County Kilkenny Georgian Household Notebook.” Journal of the Royal Society of Antiquaries of Ireland 109 (1979): 5–18. (NLI) National Library of Ireland. Baker. 19th century manuscript. MS 34,952. ---. Limerick. 19th century manuscript. MS 42,105. ---. Tervoe. 18th century manuscript. MS 42,134. Ó Gráda, C. Famine: A Short History. New Jersey: Princeton UP, 2009. O’Daly, C. E-mail correspondence between Colette O’Daly, Assistant Keeper, Dept. of Manuscripts, National Library of Ireland and Dorothy Cashman. 8 Dec. 2011. Potter, M. William Monsell of Tervoe 1812-1894. Dublin: Irish Academic P, 2009. Rees, Catherine. “Irish Anxiety, Identity and Narrative in the Plays of McDonagh and Jones.” Redefinitions of Irish Identity: A Postnationalist Approach. Eds. Irene Gilsenan Nordin and Carmen Zamorano Llena. Bern: Peter Lang, 2010. St. Canice’s. Cookery and Cures of Old Kilkenny. Kilkenny: Boethius P, 1983. Swift, J. The Works of the Rev Dr J Swift Vol. XIX Dublin: Faulkner, 1772. 8 Feb. 2013. ‹http://www.google.ie/search?tbm=bks&hl=en&q=works+of+jonathan+swift+Vol+XIX+&btnG=› Tennison, C.M. “The Old Dublin Bankers.” Journal of the Cork Historical and Archeological Society 1.2 (1895): 36–9.

Introduction Many destinations promote culinary encounters. Foods and beverages, and especially how these will taste in situ, are being marketed as niche travel motivators and used in destination brand building across the globe. While initial usage of the term culinary tourism focused on experiencing exotic cultures of foreign destinations by sampling unfamiliar food and drinks, the term has expanded to embrace a range of leisure travel experiences where the aim is to locate and taste local specialities as part of a pleasurable, and hopefully notable, culinary encounter (Wolf). Long’s foundational work was central in developing the idea of culinary tourism as an active endeavor, suggesting that via consumption, individuals construct unique experiences. Ignatov and Smith’s literature review-inspired definition confirms the nature of activity as participatory, and adds consuming food production skills—from observing agriculture and local processors to visiting food markets and attending cooking schools—to culinary purchases. Despite importing almost all of its foodstuffs and beverages, including some of its water, Singapore is an acknowledged global leader in culinary tourism. Horng and Tsai note that culinary tourism conceptually implies that a transferal of “local or special knowledge and information that represent local culture and identities” (41) occurs via these experiences. This article adds the act of reading to these participatory activities and suggests that, because food writing forms an important component of Singapore’s suite of culinary tourism offerings, taste contributes to the cultural experience offered to both visitors and locals. While Singapore foodways have attracted significant scholarship (see, for instance, work by Bishop; Duruz; Huat & Rajah; Tarulevicz, Eating), Singapore food writing, like many artefacts of popular culture, has attracted less notice. Yet, this writing is an increasingly visible component of cultural production of, and about, Singapore, and performs a range of functions for locals, tourists and visitors before they arrive. Although many languages are spoken in Singapore, English is the national language (Alsagoff) and this study focuses on food writing in English. Background Tourism comprises a major part of Singapore’s economy, with recent figures detailing that food and beverage sales contribute over 10 per cent of this revenue, with spend on culinary tours and cookery classes, home wares such as tea-sets and cookbooks, food magazines and food memoirs additional to this (Singapore Government). This may be related to the fact that Singapore not only promotes food as a tourist attraction, but also actively promotes itself as an exceptional culinary destination. The Singapore Tourism Board (STB) includes food in its general information brochures and websites, and its print, television and cinema commercials (Huat and Rajah). It also mounts information-rich campaigns both abroad and inside Singapore. The 2007 ‘Singapore Seasons’ campaign, for instance, promoted Singaporean cuisine alongside films, design, books and other cultural products in London, New York and Beijing. Touring cities identified as key tourist markets in 2011, the ‘Singapore Takeout’ pop-up restaurant brought the taste of Singaporean foods into closer focus. Singaporean chefs worked with high profile locals in its kitchen in a custom-fabricated shipping container to create and demonstrate Singaporean dishes, attracting public and media interest. In country, the STB similarly actively promotes the tastes of Singaporean foods, hosting the annual World Gourmet Summit (Chaney and Ryan) and Pacific Food Expo, both attracting international culinary professionals to work alongside local leaders. The Singapore Food Festival each July is marketed to both locals and visitors. In these ways, the STB, as well as providing events for visitors, is actively urging Singaporeans to proud of their food culture and heritage, so that each Singaporean becomes a proactive ambassador of their cuisine. Singapore Food Writing Popular print guidebooks and online guides to Singapore pay significantly more attention to Singaporean food than they do for many other destinations. Sections on food in such publications discuss at relative length the taste of Singaporean food (always delicious) as well as how varied, authentic, hygienic and suited-to-all-budgets it is. These texts also recommend hawker stalls and food courts alongside cafés and restaurants (Henderson et al.), and a range of other culinary experiences such as city and farm food tours and cookery classes. This writing describes not only what can be seen or learned during these experiences, but also what foods can be sampled, and how these might taste. This focus on taste is reflected in the printed materials that greet the in-bound tourist at the airport. On a visit in October 2013, arrival banners featuring mouth-watering images of local specialities such as chicken rice and chilli crab marked the route from arrival to immigration and baggage collection. Even advertising for a bank was illustrated with photographs of luscious-looking fruits. The free maps and guidebooks available featured food-focused tours and restaurant locations, and there were also substantial free booklets dedicated solely to discussing local delicacies and their flavours, plus recommended locations to sample them. A website and free mobile app were available that contain practical information about dishes, ingredients, cookery methods, and places to eat, as well as historical and cultural information. These resources are also freely distributed to many hotels and popular tourist destinations. Alongside organising food walks, bus tours and cookery classes, the STB also recommends the work of a number of Singaporean food writers—principally prominent Singapore food bloggers, reviewers and a number of memoirists—as authentic guides to what are described as unique Singaporean flavours. The strategies at the heart of this promotion are linking advertising to useful information. At a number of food centres, for instance, STB information panels provide details about both specific dishes and Singapore’s food culture more generally (Henderson et al.). This focus is apparent at many tourist destinations, many of which are also popular local attractions. In historic Fort Canning Park, for instance, there is a recreation of Raffles’ experimental garden, established in 1822, where he grew the nutmeg, clove and other plants that were intended to form the foundation for spice plantations but were largely unsuccessful (Reisz). Today, information panels not only indicate the food plants’ names and how to grow them, but also their culinary and medicinal uses, recipes featuring them and the related food memories of famous Singaporeans. The Singapore Botanic Gardens similarly houses the Ginger Garden displaying several hundred species of ginger and information, and an Eco(-nomic/logical) Garden featuring many food plants and their stories. In Chinatown, panels mounted outside prominent heritage brands (often still quite small shops) add content to the shopping experience. A number of museums profile Singapore’s food culture in more depth. The National Museum of Singapore has a permanent Living History gallery that focuses on Singapore’s street food from the 1950s to 1970s. This display includes food-related artefacts, interactive aromatic displays of spices, films of dishes being made and eaten, and oral histories about food vendors, all supported by text panels and booklets. Here food is used to convey messages about the value of Singapore’s ethnic diversity and cross-cultural exchanges. Versions of some of these dishes can then be sampled in the museum café (Time Out Singapore). The Peranakan Museum—which profiles the unique hybrid culture of the descendants of the Chinese and South Indian traders who married local Malay women—shares this focus, with reconstructed kitchens and dining rooms, exhibits of cooking and eating utensils and displays on food’s ceremonial role in weddings and funerals all supported with significant textual information. The Chinatown Heritage Centre not only recreates food preparation areas as a vivid indicator of poor Chinese immigrants’ living conditions, but also houses The National Restaurant of Singapore, which translates this research directly into meals that recreate the heritage kopi tiam (traditional coffee shop) cuisine of Singapore in the 1930s, purposefully bringing taste into the service of education, as its descriptive menu states, “educationally delighting the palate” (Chinatown Heritage Centre). These museums recognise that shopping is a core tourist activity in Singapore (Chang; Yeung et al.). Their gift- and bookshops cater to the culinary tourist by featuring quality culinary products for sale (including, for instance, teapots and cups, teas, spices and traditional sweets, and other foods) many of which are accompanied by informative tags or brochures. At the centre of these curated, purchasable collections are a range written materials: culinary magazines, cookbooks, food histories and memoirs, as well as postcards and stationery printed with recipes. Food Magazines Locally produced food magazines cater to a range of readerships and serve to extend the culinary experience both in, and outside, Singapore. These include high-end gourmet, luxury lifestyle publications like venerable monthly Wine & Dine: The Art of Good Living, which, in in print for almost thirty years, targets an affluent readership (Wine & Dine). The magazine runs features on local dining, gourmet products and trends, as well as international epicurean locations and products. Beautifully illustrated recipes also feature, as the magazine declares, “we’ve recognised that sharing more recipes should be in the DNA of Wine & Dine’s editorial” (Wine & Dine). Appetite magazine, launched in 2006, targets the “new and emerging generation of gourmets—foodies with a discerning and cosmopolitan outlook, broad horizons and a insatiable appetite” (Edipresse Asia) and is reminiscent in much of its styling of New Zealand’s award-winning Cuisine magazine. Its focus is to present a fresh approach to both cooking at home and dining out, as readers are invited to “Whip up the perfect soufflé or feast with us at the finest restaurants in Singapore and around the region” (Edipresse Asia). Chefs from leading local restaurants are interviewed, and the voices of “fellow foodies and industry watchers” offer an “insider track” on food-related news: “what’s good and what’s new” (Edipresse Asia). In between these publications sits Epicure: Life’s Refinements, which features local dishes, chefs, and restaurants as well as an overseas travel section and a food memories column by a featured author. Locally available ingredients are also highlighted, such as abalone (Cheng) and an interesting range of mushrooms (Epicure). While there is a focus on an epicurean experience, this is presented slightly more casually than in Wine & Dine. Food & Travel focuses more on home cookery, but each issue also includes reviews of Singapore restaurants. The bimonthly bilingual (Chinese and English) Gourmet Living features recipes alongside a notable focus on food culture—with food history columns, restaurant reviews and profiles of celebrated chefs. An extensive range of imported international food magazines are also available, with those from nearby Malaysia and Indonesia regularly including articles on Singapore. Cookbooks These magazines all include reviews of cookery books including Singaporean examples – and some feature other food writing such as food histories, memoirs and blogs. These reviews draw attention to how many Singaporean cookbooks include a focus on food history alongside recipes. Cookery teacher Yee Soo Leong’s 1976 Singaporean Cooking was an early example of cookbook as heritage preservation. This 1976 book takes an unusual view of ‘Singaporean’ flavours. Beginning with sweet foods—Nonya/Singaporean and western cakes, biscuits, pies, pastries, bread, desserts and icings—it also focuses on both Singaporean and Western dishes. This text is also unusual as there are only 6 lines of direct authorial address in the author’s acknowledgements section. Expatriate food writer Wendy Hutton’s Singapore Food, first published in 1979, reprinted many times after and revised in 2007, has long been recognised as one of the most authoritative titles on Singapore’s food heritage. Providing an socio-historical map of Singapore’s culinary traditions, some one third of the first edition was devoted to information about Singaporean multi-cultural food history, including detailed profiles of a number of home cooks alongside its recipes. Published in 1980, Kenneth Mitchell’s A Taste of Singapore is clearly aimed at a foreign readership, noting the variety of foods available due to the racial origins of its inhabitants. The more modest, but equally educational in intent, Hawkers Flavour: A Guide to Hawkers Gourmet in Malaysia and Singapore (in its fourth printing in 1998) contains a detailed introductory essay outlining local food culture, favourite foods and drinks and times these might be served, festivals and festive foods, Indian, Indian Muslim, Chinese, Nyonya (Chinese-Malay), Malay and Halal foods and customs, followed with a selection of recipes from each. More contemporary examples of such information-rich cookbooks, such as those published in the frequently reprinted Periplus Mini Cookbook series, are sold at tourist attractions. Each of these modestly priced, 64-page, mouthwateringly illustrated booklets offer framing information, such as about a specific food culture as in the Nonya kitchen in Nonya Favourites (Boi), and explanatory glossaries of ingredients, as in Homestyle Malay Cooking (Jelani). Most recipes include a boxed paragraph detailing cookery or ingredient information that adds cultural nuance, as well as trying to describe tastes that the (obviously foreign) intended reader may not have encountered. Malaysian-born Violet Oon, who has been called the Julia Child of Singapore (Bergman), writes for both local and visiting readers. The FOOD Paper, published monthly for a decade from January 1987 was, she has stated, then “Singapore’s only monthly publication dedicated to the CSF—Certified Singapore Foodie” (Oon, Violet Oon Cooks 7). Under its auspices, Oon promoted her version of Singaporean cuisine to both locals and visitors, as well as running cookery classes and culinary events, hosting her own television cooking series on the Singapore Broadcasting Corporation, and touring internationally for the STB as a ‘Singapore Food Ambassador’ (Ahmad; Kraal). Taking this representation of flavor further, Oon has also produced a branded range of curry powders, spices, and biscuits, and set up a number of food outlets. Her first cookbook, World Peranakan Cookbook, was published in 1978. Her Singapore: 101 Meals of 1986 was commissioned by the STB, then known as the Singapore Tourist Promotion Board. Violet Oon Cooks, a compilation of recipes from The FOOD Paper, published in 1992, attracted a range of major international as well as Singaporean food sponsors, and her Timeless Recipes, published in 1997, similarly aimed to show how manufactured products could be incorporated into classic Singaporean dishes cooked at home. In 1998, Oon produced A Singapore Family Cookbook featuring 100 dishes. Many were from Nonya cuisine and her following books continued to focus on preserving heritage Singaporean recipes, as do a number of other nationally-cuisine focused collections such as Joyceline Tully and Christopher Tan’s Heritage Feasts: A Collection of Singapore Family Recipes. Sylvia Tan’s Singapore Heritage Food: Yesterday’s Recipes for Today’s Cooks, published in 2004, provides “a tentative account of Singapore’s food history” (5). It does this by mapping the various taste profiles of six thematically-arranged chronologically-overlapping sections, from the heritage of British colonialism, to the uptake of American and Russia foods in the Snackbar era of the 1960s and the use of convenience flavoring ingredients such as curry pastes, sauces, dried and frozen supermarket products from the 1970s. Other Volumes Other food-themed volumes focus on specific historical periods. Cecilia Leong-Salobir’s Food Culture in Colonial Asia: A Taste of Empire discusses the “unique hybrid” (1) cuisine of British expatriates in Singapore from 1858 to 1963. In 2009, the National Museum of Singapore produced the moving Wong Hong Suen’s Wartime Kitchen: Food and Eating in Singapore 1942–1950. This details the resilience and adaptability of both diners and cooks during the Japanese Occupation and in post-war Singapore, when shortages stimulated creativity. There is a centenary history of the Cold Storage company which shipped frozen foods all over south east Asia (Boon) and location-based studies such as Annette Tan’s Savour Chinatown: Stories Memories & Recipes. Tan interviewed hawkers, chefs and restaurant owners, working from this information to write both the book’s recipes and reflect on Chinatown’s culinary history. Food culture also features in (although it is not the main focus) more general book-length studies such as educational texts such as Chew Yen Fook’s The Magic of Singapore and Melanie Guile’s Culture in Singapore (2000). Works that navigate both spaces (of Singaporean culture more generally and its foodways) such Lily Kong’s Singapore Hawker Centres: People, Places, Food, provide an consistent narrative of food in Singapore, stressing its multicultural flavours that can be enjoyed from eateries ranging from hawker stalls to high-end restaurants that, interestingly, that agrees with that promulgated in the food writing discussed above. Food Memoirs and Blogs Many of these narratives include personal material, drawing on the author’s own food experiences and taste memories. This approach is fully developed in the food memoir, a growing sub-genre of Singapore food writing. While memoirs by expatriate Singaporeans such as Cheryl Lu-Lien Tan’s A Tiger in the Kitchen: A Memoir of Food and Family, produced by major publisher Hyperion in New York, has attracted considerable international attention, it presents a story of Singapore cuisine that agrees with such locally produced texts as television chef and food writer Terry Tan’s Stir-fried and Not Shaken: A Nostalgic Trip Down Singapore’s Memory Lane and the food memoir of the Singaporean chef credited with introducing fine Malay dining to Singapore, Aziza Ali’s Sambal Days, Kampong Cuisine, published in Singapore in 2013 with the support of the National Heritage Board. All these memoirs are currently available in Singapore in both bookshops and a number of museums and other attractions. While underscoring the historical and cultural value of these foods, all describe the unique flavours of Singaporean cuisine and its deliciousness. A number of prominent Singapore food bloggers are featured in general guidebooks and promoted by the STB as useful resources to dining out in Singapore. One of the most prominent of these is Leslie Tay, a medical doctor and “passionate foodie” (Knipp) whose awardwinning ieatŸishootŸipost is currently attracting some 90,000 unique visitors every month and has had over 20,000 million hits since its launch in 2006. An online diary of Tay’s visits to hundreds of Singaporean hawker stalls, it includes descriptions and photographs of meals consumed, creating accumulative oral culinary histories of these dishes and those who prepared them. These narratives have been reorganised and reshaped in Tay’s first book The End of Char Kway Teow and Other Hawker Mysteries, where each chapter tells the story of one particular dish, including recommended hawker stalls where it can be enjoyed. Ladyironchef.com is a popular food and travel site that began as a blog in 2007. An edited collection of reviews of eateries and travel information, many by the editor himself, the site features lists of, for example, the best cafes (LadyIronChef “Best Cafes”), eateries at the airport (LadyIronChef “Guide to Dining”), and hawker stalls (Lim). While attesting to the cultural value of these foods, many articles also discuss flavour, as in Lim’s musings on: ‘how good can chicken on rice taste? … The glistening grains of rice perfumed by fresh chicken stock and a whiff of ginger is so good you can even eat it on its own’. Conclusion Recent Singapore food publishing reflects this focus on taste. Tay’s publisher, Epigram, growing Singaporean food list includes the recently released Heritage Cookbooks Series. This highlights specialist Singaporean recipes and cookery techniques, with the stated aim of preserving tastes and foodways that continue to influence Singaporean food culture today. Volumes published to date on Peranakan, South Indian, Cantonese, Eurasian, and Teochew (from the Chaoshan region in the east of China’s Guangdong province) cuisines offer both cultural and practical guides to the quintessential dishes and flavours of each cuisine, featuring simple family dishes alongside more elaborate special occasion meals. In common with the food writing discussed above, the books in this series, although dealing with very different styles of cookery, contribute to an overall impression of the taste of Singapore food that is highly consistent and extremely persuasive. This food writing narrates that Singapore has a delicious as well as distinctive and interesting food culture that plays a significant role in Singaporean life both currently and historically. It also posits that this food culture is, at the same time, easily accessible and also worthy of detailed consideration and discussion. In this way, this food writing makes a contribution to both local and visitors’ appreciation of Singaporean food culture. References Ahmad, Nureza. “Violet Oon.” Singapore Infopedia: An Electronic Encyclopedia on Singapore’s History, Culture, People and Events (2004). 22 Nov. 2013 ‹http://infopedia.nl.sg/articles/SIP_459_2005-01-14.html?s=Violet%20Oon›.Ali, Aziza. Sambal Days, Kampong Cuisine. Singapore: Ate Ideas, 2013. Alsagoff, Lubna. “English in Singapore: Culture, capital and identity in linguistic variation”. World Englishes 29.3 (2010): 336–48.Bergman, Justin. “Restaurant Report: Violet Oon’s Kitchen in Singapore.” New York Times (13 March 2013). 21 Nov. 2013 ‹http://www.nytimes.com/2013/03/17/travel/violet-oons-kitchen-singapore-restaurant-report.html?_r=0›. Bishop, Peter. “Eating in the Contact Zone: Singapore Foodscape and Cosmopolitan Timespace.” Continuum: Journal of Media & Cultural Studies 25.5 (2011): 637–652. Boi, Lee Geok. Nonya Favourites. Singapore: Periplus Editions, 2001. Boon, Goh Chor. Serving Singapore: A Hundred Years of Cold Storage 1903-2003. Singapore: Cold Storage Pty. Ltd., 2003. Chaney, Stephen, and Chris Ryan. “Analyzing the Evolution of Singapore’s World Gourmet Summit: An Example of Gastronomic Tourism.” International Journal of Hospitality Management 31.2 (2012): 309–18. Chang, T. C. “Local Uniqueness in the Global Village: Heritage Tourism in Singapore.” The Professional Geographer 51.1 (1999): 91–103. Cheng, Tiong Li. “Royal Repast.” Epicure: Life’s Refinements January (2012): 94–6. Chinatown Heritage Centre. National Restaurant of Singapore. (12 Nov. 2012). 21 Nov. 2013 ‹http://www.yoursingapore.com›.Duruz, Jean. “Living in Singapore, Travelling to Hong Kong, Remembering Australia …: Intersections of Food and Place.” Journal of Australian Studies 87 (2006): 101–15. -----. “From Malacca to Adelaide: Fragments Towards a Biography of Cooking, Yearning and Laksa.” Food and Foodways in Asia: Resource, Tradition and Cooking. Eds. Sidney C.H. Cheung, and Tan Chee-Beng. London: Routledge, 2007: 183–200. -----. “Tastes of Hybrid Belonging: Following the Laksa Trail in Katong, Singapore.” Continuum: Journal of Media & Cultural Studies 25.5 (2011): 605–18. Edipresse Asia Appetite (2013). 22 Nov. 2013 ‹http://www.edipresseasia.com/magazines.php?MagID=SGAPPETITE›. Epicure. “Mushroom Goodness.” Epicure: Life’s Refinements January (2012): 72–4. Epicure: Life’s Refinements. (2013) 1 Jan. 2014 ‹http://www.epicureasia.com›. Food & Travel. Singapore: Regent Media. 1 Jan. 2014 ‹http://www.regentmedia.sg/publications_food&travel.shtml›. Fook, Chew Yen. The Magic of Singapore. London: New Holland, 2000. Guile, Melanie. Culture in Singapore. Port Melbourne: Heinemann/Harcourt Education Australia, 2003. Hawkers Flavour: A Guide to Hawkers Gourmet in Malaysia and Singapore. Kuala Lumpur: S. Abdul Majeed & Co., 1998. Henderson, Joan C., Ong Si Yun, Priscilla Poon, and Xu Biwei. “Hawker Centres as Tourist Attractions: The Case of Singapore.” International Journal of Hospitality Management 31.3 (2012): 849–55. Horng, Jeou-Shyan, and Chen-Tsang (Simon) Tsai. “Culinary Tourism Strategic Development: An Asia‐Pacific Perspective.” International Journal of Tourism Research 14 (2011): 40–55. Huat, Chua Beng, and Ananda Rajah. “Hybridity, Ethnicity and Food in Singapore.” Changing Chinese Foodways in Asia. Eds. David Y. H. Wu, and Chee Beng Tan. Hong Kong: The Chinese University of Hong Kong, Hong Kong, 2001: 161–98. Hutton, Wendy. Singapore Food. Singapore: Martin Cavendish, 1989/2007. Ignatov, Elena, and Stephen Smith. “Segmenting Canadian Culinary Tourists.” Current Issues in Tourism 9.3 (2006): 235–55. Jelani, Rohani. Homestyle Malay Cooking. Singapore: Periplus Editions, 2003. Knipp, Peter A. “Foreword: An Amazing Labour of Love.” The End of Char Kway Teow and Other Hawker Mysteries. Leslie Tay. Singapore: Epigram Books, 2010. viii–ix. Kong, Lily. Singapore Hawker Centres: People, Places, Food. Singapore: National Environment Agency, 2007 Kraal, David. “One and Only Violet Oon.” The Straits Times 20 January (1999). 1 Nov 2012 ‹http://www.straitstimes.com› LadyIronChef. “Best Cafes in Singapore.” ladyironchef.com (31 Mar. 2011). 21 Feb. 2014 ‹http://www.ladyironchef.com/2011/03/best-cafes-singapore› -----. “Guide to Dining at Changi Airport: 20 Places to Eat.” ladyironchef.com (10 Mar. 2014) 10 Mar. 2014 ‹http://www.ladyironchef.com/author/ladyironchef› Leong-Salobir, Cecilia. Food Culture in Colonial Asia: A Taste of Empire. Abingdon UK: Routledge, 2011. Lim, Sarah. “10 of the Best Singapore Hawker Food.” (14 Oct. 2013). 21 Feb. 2014 ‹http://www.ladyironchef.com/2013/10/best-singapore-hawker-food›. Long, Lucy M. “Culinary Tourism: A Folkloristic Perspective of Eating and Otherness.” Southern Folklore 55.2 (1998): 181–204. Mitchell, Kenneth, ed. A Taste of Singapore. Hong Kong: Four Corners Publishing Co. (Far East) Ltd. in association with South China Morning Post, 1980. Oon, Violet. World Peranakan Cookbook. Singapore: Times Periodicals, 1978. -----. Singapore: 101 Meals. Singapore: Singapore Tourist Promotion Board, 1986. -----. Violet Oon Cooks. Singapore: Ultra Violet, 1992. -----. Timeless Recipes. Singapore: International Enterprise Singapore, 1997. -----. A Singapore Family Cookbook. Singapore: Pen International, 1998. Reisz, Emma. “City as Garden: Shared Space in the Urban Botanic Gardens of Singapore and Malaysia, 1786–2000.” Postcolonial Urbanism: Southeast Asian Cities and Global Processes. Eds. Ryan Bishop, John Phillips, and Yeo Wei Wei. New York: Routledge, 2003: 123–48. Singapore Government. Singapore Annual Report on Tourism Statistics. Singapore: Singapore Government, 2012. Suen, Wong Hong. Wartime Kitchen: Food and Eating in Singapore 1942-1950. Singapore: Editions Didier Millet & National Museum of Singapore, 2009. Tan, Annette. Savour Chinatown: Stories, Memories & Recipes. Singapore: Ate Ideas, 2012. Tan, Cheryl Lu-Lien. A Tiger in the Kitchen: A Memoir of Food and Family. New York: Hyperion, 2011. Tan, Sylvia. Singapore Heritage Food: Yesterday’s Recipes for Today’s Cooks. Singapore: Landmark Books, 2004. Tan, Terry. Stir-Fried and Not Shaken: A Nostalgic Trip Down Singapore’s Memory Lane. Singapore: Monsoon, 2009. Tarulevicz, Nicole. Eating Her Curries and Kway: A Cultural History of Food in Singapore. Champaign, IL: U of Illinois P, 2013. Tay, Leslie. ieat·ishoot·ipost [blog] (2013) 21 Nov. 2013 ‹http://www.ieatishootipost.sg›. ---. The End of Char Kway Teow and Other Hawker Mysteries. Singapore: Epigram Books, 2010. Time Out Singapore. “Food for Thought (National Museum).” Time Out Singapore 8 July (2013). 11 Nov. 2013 ‹http://www.timeoutsingapore.com/restaurants/asian/food-for-thought-national-museum›. Tully, Joyceline, and Tan, Christopher. Heritage Feasts: A Collection of Singapore Family Recipes. Singapore: Miele/Ate Media, 2010. Wine & Dine: The Art of Good Living (Nov. 2013). 19 Nov. 2013 ‹http://www.wineanddine.com.sg›. Wine & Dine. “About Us: The Living Legacy.” Wine & Dine (Nov. 2013). 19 Nov. 2013 ‹http://www.wineanddine.com.sg/about-us› Wolf, E. “Culinary Tourism: A Tasty Economic Proposition.” (2002) 23 Nov. 2011 ‹http://www.culinary tourism.org›.Yeong, Yee Soo. Singapore Cooking. Singapore: Eastern Universities P, c.1976. Yeung, Sylvester, James Wong, and Edmond Ko. “Preferred Shopping Destination: Hong Kong Versus Singapore.” International Journal of Tourism Research 6.2 (2004): 85–96. Acknowledgements Research to complete this article was supported by Central Queensland University, Australia, under its Outside Studies Program (OSPRO) and Learning and Teaching Education Research Centre (LTERC). An earlier version of part of this article was presented at the 2nd Australasian Regional Food Networks and Cultures Conference, in the Barossa Valley in South Australia, Australia, 11–14 November 2012. The delegates of that conference and expert reviewers of this article offered some excellent suggestions regarding strengthening this article and their advice was much appreciated. All errors are, of course, my own.

IntroductionI spent five days on the Arizona Utah border, photographing Monument Valley and the surrounding areas as part of a group of eight undertaking a landscape photography workshop under the direction of a Navajo guide. Observing where our guide was taking us, and watching and talking to other tourist photographers, I was reminded of John Urry’s concept of the “tourist gaze” and the idea that tourists see destinations in terms of the promotional images they are familiar with (Urry 1). It seemed that tourists re-created images drawn from the popular imaginary, inserting themselves into familiar narratives of place. The goal of the research was to look specifically at the tourist gaze, that is, the way that tourists see view destinations and then represent that vision in their images. Circle of Representation Urry explained the tourist gaze as a particular way of seeing the world as a series of images created by the tourism industry; images which were then consumed or collected through tourist photography. He saw this as constituting a “closed circle of representation” where the images employed by the tourism industry to attract tourists to particular destinations were reproduced in tourists’ own holiday snaps, and as more tourists sought out these locations, they were increasingly used to represent the destination. Susan Sontag saw travel employed as “a strategy for accumulating photographs” (9) suggesting that the images were the culmination of the journey. Urry also saw the end point of tourism as travellers to a destination “demonstrating that they have really been there by showing their version of the images that they had seen originally before they set off” (140).Talking to the guide, my group, and other tourists about the images we were recording, and reviewing images tagged Monument Valley on Instagram revealed that digital and network technologies had altered tourists’ photographic practices. Tourist impressions of destinations come from a wide range of popular culture sources. They have, even on smartphones, fairly sophisticated tools for creating images; and they have diverse networks for distributing their images. Increasingly, the images that tourists see as representative of Monument Valley came from popular culture and social media, and not simply from tourism promotions. People are posting their travel images online, and are in turn looking to posts from others in their search for travel information (Akehurst 55). The current circle of representation in tourist photography is not simply a process of capturing promotional imagery, but an interaction between tourists that draws upon films, television, and other popular culture forms. Tourist photographs are less a matter of “consuming places” (Urry 259) and more an identity performance through which they create ongoing personal narratives of place by inserting themselves into pre-existing stories about the destination and circulating the new narratives.Jenkins analysed brochures on Australia available to potential tourists in Vancouver, Canada, and determined that the key photographic images used to promote Australia were Uluru and the Sydney Opera House, followed by sandy beaches alongside tropical blue waters. Interviews with Canadian backpackers travelling around Australia, and an examination of the images these backpackers took with the disposable cameras they were given, found a correlation between the brochure images and the personal photographs. Jenkins concluded that the results supported Urry’s theory of a closed circle of representation, in that the images from the brochures were “tracked down and recaptured, and the resulting photographs displayed upon return home by the backpackers as evidence of the trip” (Jenkins 324).Garrod randomly selected 25 tourists along the seafront of Aberystwyth, Wales, and gave them a single-use camera, a brief socio-demographic questionnaire, a photo log, and a reply-paid envelope in which they could return these items. The tourists were asked to take 12 photos and log the reason they took each photograph and what they tried to capture in terms of their visit to Aberystwyth. Nine females and four males returned their cameras, providing 164 photographs, which were compared with 70 postcards depicting Aberystwyth. While an initial comparison revealed similarities in the content of tourist photographs and the picture postcards of the town, Garrod’s analysis revealed two main differences: postcards featured wide angle or panoramic views, while tourist photos tended to be close up or detail shots and postcards included natural features, particularly bodies of water, while tourist photographs were more often of buildings and man-made structures. Garrod concluded that the relationship between tourism industry images and tourist photographs “might be more subtle and complex than simply for the two protagonists in the relationship to mimic one other” (356).MethodIdentifying a tourist’s motivation for taking a particular photograph, the source of inspiration for the image, and the details of what the photographer was attempting to capture involves the consideration of a range of variables, many of which cannot be controlled. The ability of the photographer and the sophistication of their equipment will have an impact on the type of images captured; for example this may explain the absence of panoramas in Aberystwyth tourist photos. The length of the stay and the level of familiarity with the location may also have an impact; on a first visit a tourist may look for the major landmarks and on subsequent visits photograph the smaller details. The personal history of the tourist, the meaning the location has for them, their reasons for visiting and their mood at the time, will all influence their selection of photo subjects. Giving tourists a camera and then asking them to photograph the destination may influence the choice of subject and the care taken with composition, however this does ensure a direct link between the tourist opinions gathered and the images analysed. An approach that depends on seeing the images taken independently by the tourists who were interviewed has logistical problems that significantly reduce sample size.Fourteen randomly selected tourists at the visitors centre in Monument Valley, a random sampling of 500 Instagram images hash tagged Monument Valley, and photographs taken by seven photographers in the author’s group were studied by the author. The tourists were asked what they wanted to take photographs of while in Monument Valley, and why of those particular subjects. The images taken by these tourists were not available for analysis for logistical reasons, and 500 Instagram images tagged #MonumentValley were collected as generally representative of tourist images. Members of the photography workshop group were all serious amateur photographers with digital SLR cameras, interchangeable lenses, and tripods. Motivations, decisions and the evaluation of images were discussed with this group, and their images reviewed in terms of the extent to which the image was felt to be representative of the location.Monument ValleyMonument Valley can be considered a mythic space in that it is a real place that has taken on mythic meanings that go beyond physical characteristics and lived experiences (Slotkin 11). Located on the Navajo Tribal Park on the Arizona Utah border, it is known by the Navajo as Tse'Bii'Ndzisgaii or “Valley of the Rocks.” Monument Valley is emblematic of the Wild West, the frontier beyond which civilization vanishes, a mythology originally derived from the Western Films of director John Ford. Ford's film, Stagecoach, was shot in Monument Valley and Ford returned nine times to shoot Westerns here, even when films (such as The Searchers, set in Texas) were not set in Arizona or Utah. The spectacular desert scenery with its towering rock formations combine epic grandeur with brutal conditions, providing an appropriate backdrop for dramatic oppositions: civilization versus barbarity, community versus wilderness, freedom versus domestication. The mythological meanings attached to Monument Valley were extended in the films, novels, television programs, and advertising that followed. Footage of Monument Valley is used to represent a blend of freedom and danger in 2001: A Space Odyssey, Easy Rider, Thelma & Louise, Marlborough and Chevrolet advertising, the television series Airwolf and episodes of Doctor Who. Monument Valley was the culmination of Forrest Gump's exhaustive run, and the setting for music videos by Kanye West, Madonna and Michael Jackson, each drawing on the themes of alienation and the displacement of the hero. While Westerns are on one level uniquely American, they are consistent with widely known romantic myths and stories, and the universal narratives evoked by Monument Valley have appeal far outside the USA. The iconic images of Monument Valley have been circulated well beyond tourist informational material, permeating a breadth of popular culture forms.Photographing the ValleyPhotography is intrinsically linked with tourism, fulfilling a number of roles. Travel can have as its purpose the collection of images, and as such, photography can function to structure the travel experience, and to evaluate its success (Schroeder; Sontag). Recognisable images of the location provide evidence that travel was undertaken, places were visited, and the traveller has experienced some form of authentic or exotic experience (Chalfen 435). Sharing images is an essential part of the process. The various roles of photography are to an extent dependent on having a shared mental image of what photographs from the travel location would look like. This mental image is derived, in part, from tourism sources such as postcards, brochures, and websites, but also from popular culture, and increasingly from photographs taken by other tourists. Travel images are shared online on sites such as Trip Advisor and Virtual Tourist, as well as travel blogs and photo sharing sites like Flickr and Instagram. People who post images online are likely to look to the same sites to search for travel information from others (Akehurst 55), reinforcing specific images as representative of the place and the experience.At the beginning of our photography-based tour we were asked which locations we wanted to photograph. There was a general consensus, with people looking for vistas and panoramas, “golden hour” light on the rock formations of buttes and mesas, sunrises and sunsets with silhouetted landscape forms, and close-ups of shadow patterns and textures. Our guide added that one day had been set aside for the iconic images, which were described as the “Forest Gump” shot from Highway 163, the Mittens at sunrise, John Ford Point (as most recently seen in The Lone Ranger movie posters), and the vista from Artist’s Point or North Window. When I asked tourists at the visitor information centre the same question about the images they wanted to capture, the responses were uniform with all of them saying the view of The Mittens, which was immediately before them. Seventy-eight percent (N=11) said that they were after a general panorama with the distinctive landforms, and Highway 163 was named by 57 percent (N=8). Few gave more than these three sites. Forty-two percent (N=6) described the John Ford Point image with the Navajo rider as a goal, and the same number said they would like to take some sunrise or sunset images. Twenty-eight percent (N=4) were looking to take images of themselves or their friends and family, with the distinctive landscape as a backdrop. There was a high level of consistency between the images described by the guide as “iconic” and the photographs that tourists wished to capture.Categorising five hundred Instagram images with the hashtag Monument Valley revealed 195 pictures (39 percent) of the Mittens, 58 of which were taken at sunrise or sunset. There were 88 images (18 percent) taken of Highway 163. John Ford Point featured in 26 images (five percent) of images and Artist’s Point was the location in 20 (four percent). Seventy-nine photographs (16 percent) were of other landmarks such as the Three Sisters, Elephant Butte, and Rain God Mesa, all visible from the self-drive circuit. Landmarks which could only be visited accompanied by a Navajo guide, accounted for 48 (nine percent) of the Instagram images. There were 16 images (three percent) of people, meals, and cars without any recognisable landmarks in the frame. The remaining 28 images (five percent) were of landmarks in the Southwest, but not in Monument Valley, although they were tagged as such.As expected, the photography tour group had a fairly wide range of images, which included close-ups of rocks, images of juniper trees, and images taken in places that were accessible only with a high clearance vehicle and a Navajo guide, such as the Totem Pole and Yei Bi Chei, the Valley of the Gods, and the slickrock formations of Mystery Valley. However, in the images selected at the end of the workshop as representative of their experience of Monument Valley, all participants included the iconic images of Highway 163, the Mittens, and the Artist’s Point vista.Very few images were of the Navajo people. Tourists are requested not to photograph the Navajo unless they were at a sign-posted location where a mechanism was available for paying for the privilege. Here the Navajo posed in traditional dress, engaged in customary activities, or as foreground interest in the desert landscape. The few tourists availing themselves of these opportunities seemed self-conscious, hurriedly taking the snap and paying the fee. Gillespie explains this as the effect of the “reverse gaze” where the photographed positions the photographer “as an ignorant and superficial tourist” (349). At the time, only one of the iconic images was featured on one of the official tourist sites, with the Mittens forming the banner image on the Visit Utah Monument Valley page. The Visit Arizona Monument Valley page had a single image (of the Ear of the Wind natural arch), and the Navajo Nation Parks and Recreation Monument Valley page also had a single image, that of the Three Sisters formation.Image and MeaningThe dominant subject in both tourist and tourism industry images is the Mittens. This image is also prominent in popular culture beginning with John Ford's film Stagecoach, through to Kanye West’s Bound 2 music video. This suggests that there is a closed circle of representation in tourist photography, with visitors capturing the images they have previously seen as representative of the destination. However, there may be an additional, more prosaic, explanation. The Mittens can be photographed from the terrace at the visitors centre, from the rooms at the View Hotel, or they can be captured from the car park, meaning that tourists do not have to leave their cars to attach this image to their travel narrative. The second most photographed landscape was that of Highway 163, an image that can be taken without even having to pay the fee and enter the Navajo Park.Garrod’s study of tourist and professional images of Aberystwyth noted that tourists did not have photographs taken from the top of the hill, and while no explanation for this was given, it could be that ease of access was a consideration. While the number of visitors to America’s national parks and recreation areas is increasing each year, the amount of time each visitor spends at the attraction is in decline. The average visit to Yosemite lasts just under five hours, visitors stay for just under two hours in Saguaro National Park in Arizona, and at the Grand Canyon National Park, most visitors spend just 17 minutes looking at the magnificent landscape (Bernstein; de Graaf). In Yosemite National Park many visitors “simply rolled by slowly in their cars, taking photos out the windows” (de Graaf np). So, ease of access to locations familiar from popular culture images is a factor in tourist representations of their destinations.Our photography tour group stayed five days in Monument Valley and travelled further afield to locations only accessible with a Navajo guide, however the images selected as representative of Monument Valley were of the same easily reached landmarks. This suggests that the process around the perpetuation of iconic tourist images is more complex than simple ease of access, or first impressions.What is apparent in looking at both the Instagram images and those photographs selected as representative by the tour group, is that what is depicted is not necessarily contemporary tourist experience, but rather a way of seeing the experience in terms of personal and cultural stories. Photography involves the selection, structuring and shaping of what is to be captured (Urry 260), so that the image is as much the representation of a perception, as a snapshot of experienced reality. In a guide to photographing the southwest of the USA, Matrés regrets the greater restrictions on movement and the increased commercialisation in Monument Valley (170), which reduce the possibility of photographing under good light conditions, and of capturing images without tourist buses, sales booths, and consequent crowds. However, almost all of the photographs studied avoided these. Photographers seemed to have expended considerable effort to produce an idealised image of a Western landscape that would have been familiar to John Ford, as the photographs were not of a commercialised, crowded tourist destination. When someone paid the horseman to ride out to the end of John Ford Point, groups of tourists would walk out too, fussing over the horse, however having people in the image led to those on the photography tour rejecting the image as representative of Monument Valley. For the most part, the landscape images highlighted the isolation and remoteness, depicting the frontier beyond which civilization ceases to exist.ConclusionPhotography is one of the performances through which people establish personal realities (Crang 245), and the reality for Monument Valley tourists is that it is still a remote destination. It is in the driest and least populated part of the US, and receives only 350,000 visitors a year compared, with the five million people who visit the nearby Grand Canyon. On a prosaic level, tourist photographs verify that the location was visited (Sontag 9), so the images must be able to be readily associated with the destination. They are evidence that the tourist has experienced some form of authentic, exotic, place (Chalfen 435), and so must depict scenes that differ from the everyday landscape. They also play a role in constructing an identity based in being a particular type of tourist, so they need to contribute to the narrative constructed from a blend of mythologies, memories and experiences. The circle of representation in tourist images is still closed, though it has broadened to constitute a narrative derived from a range of sources. By capturing the iconic landmarks of Monument Valley framed to emphasise the grandeur and isolation, tourists insert themselves into a narrative that includes John Wayne and Kanye West at the edge of civilization.References2001: A Space Odyssey. Dir. Stanley Kubrick. Metro-Goldwyn-Mayer, 1968.Airwolf. Dir. Donald P. Bellisario, CBS, 1984–1986.Akehurst, Gary. “User Generated Content: The Use of Blogs for Tourism Organisations and Tourism Consumers.” Service Business 3.1 (2009): 51-61.Bernstein, Danny. “The Numbers behind National Park Visitation.” National Parks Traveller, 2010. 5 Aug. 2016 <http://www.nationalparkstraveler.com/2010/04/numbers-behind-national-park-visitation/>.Kanye West. Bound 2. Nick Knight Good Music, 2013.Chalfen, Richard M. “Photography’s Role in Tourism: Some Unexplored Relationships.” Annals of Tourism Research 6.4 (1979): 435–447Crang, Mike. “Knowing, Tourism and Practices of Vision.” Leisure/Tourism Geographies: Practices and Geographical Knowledge. Ed. David Crouch. London: Routledge, 1999. 238–56.De Graaf, John. “Finding Time for Our Parks.” Earth Island Journal, 2016. 5 Aug. 2016 <http://www.earthisland.org/journal/index.php/eij/article/finding_time_for_our_parks/>.Doctor Who. Sydney Newman, C. E. Webber, Donald Wilson. BBC One, 1963–present.Easy Rider. Dir. Dennis Hopper. Columbia Pictures, 1969.Garrod, Brian. “Understanding the Relationship between Tourism Destination Imagery and Tourist Photography.” Journal of Travel Research 47.3 (2009): 346-358Gillespie, Alex. "Tourist Photography and the Reverse Gaze." Ethos 34.3 (2006): 343-366.Jenkins, Olivia. “Photography and Travel Brochures: The Circle of Representation.” Tourism Geographies 5.3 (2003): 305-328.Matrés, Laurent. Photographing the Southwest. Alta Loma, CA: Graphie Publishers, 2006.Schroeder, Jonathan E. Visual Consumption. London: Routledge, 2002.Slotkin, Richard. The Fatal Environment: The Myth of the Frontier in the Age of Industrialization, 1800-1890. Norman, OK: University of Oklahoma Press, 1998. Sontag, Susan. On Photography. London: Penguin Books, 1977 Stagecoach. Dir. John Ford. United Artists, 1937.The Searchers. Dir. John Ford. Warner Bros, 1956.Thelma & Louise. Dir. Ridley Scott. Metro-Goldwyn-Mayer, 1991.Urry, John. The Tourist Gaze: Leisure and Travel in Contemporary Societies. London: Sage, 1992.