Journal articles on the topic '1KB'

To see the other types of publications on this topic, follow the link: 1KB.

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the top 50 journal articles for your research on the topic '1KB.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.

1

Kozłowska, Joanna, Ewa Grela, Dagmara Baczyńska, Agnieszka Grabowiecka, and Mirosław Anioł. "Novel O-alkyl Derivatives of Naringenin and Their Oximes with Antimicrobial and Anticancer Activity." Molecules 24, no. 4 (February 14, 2019): 679. http://dx.doi.org/10.3390/molecules24040679.

Full text
Abstract:
In our investigation, we concentrated on naringenin (NG)—a widely studied flavanone that occurs in citrus fruits. As a result of a reaction with a range of alkyl iodides, 7 novel O-alkyl derivatives of naringenin (7a–11a, 13a, 17a) were obtained. Another chemical modification led to 9 oximes of O-alkyl naringenin derivatives (7b–13b, 16b–17b) that were never described before. The obtained compounds were evaluated for their potential antibacterial activity against Escherichia coli, Staphylococcus aureus, and Bacillus subtilis. The results were reported as the standard minimal inhibitory concentration (MIC) values and compared with naringenin and its known O-alkyl derivatives. Compounds 4a, 10a, 12a, 14a, 4b, 10b, 11b, and 14b were described with MIC of 25 µg/mL or lower. The strongest bacteriostatic activity was observed for 7-O-butylnaringenin (12a) against S. aureus (MIC = 6.25 µg/mL). Moreover, the antitumor effect of flavonoids was examined on human colon cancer cell line HT-29. Twenty-six compounds were characterized as possessing an antiproliferative activity stronger than that of naringenin. The replacement of the carbonyl group with an oxime moiety significantly increased the anticancer properties. The IC50 values below 5 µg/mL were demonstrated for four oxime derivatives (8b, 11b, 13b and 16b).
APA, Harvard, Vancouver, ISO, and other styles
2

Schwan, Adrian L., Michael R. Roche, John F. Gallagher, and George Ferguson. "On the conformational preferences of the dehydrochlorination of α-chlorosulfoxides." Canadian Journal of Chemistry 72, no. 2 (February 1, 1994): 312–24. http://dx.doi.org/10.1139/v94-049.

Full text
Abstract:
Several acyclic α-chlorosulfoxides have been shown to undergo a γ-dehydrochlorination upon treatment with LDA. The proposed immediate products of γ-dehydrochlorination, thiirane-S-oxides, are unstable under the basic conditions and react further with the LDA; the isolated products are usually E-alkenes and (or) E-vinyl sulfoxides. Some of the proposed intermediate thiirane-S-oxides, compounds 6, 7, 8, and 18, were synthesized independently and treated with one equivalent of LDA in order to mimic the second step of the overall dehydrochlorination/ring opening sequence. The products obtained from the reactions of compounds 6 and 18 compared favourably with those products which were believed to arise from certain conformations of α-chlorosulfoxides 1kB and 1e, respectively. The addition of one equivalent of LDA to 1kA afforded a mixture containing thiirane-S-oxide 8, which is proposed as the immediate product of γ-dehydrochlorination of 1kA. The configurations of 1kB and 1hA were both shown to be threo by X-ray crystallographic studies. Those conformations which are preferred for the dehydrochlorination possess a geometry where the sulfinyl oxygen is anti to any of the substituents of the ring carbons.
APA, Harvard, Vancouver, ISO, and other styles
3

Zheng, Ling-Li, Guan Wen, Yun-Xin Yao, Xiao-Huan Li, and Feng Gao. "Design, Synthesis, and Anticancer Activity of Natural Product Hybrids With Paclitaxel Side Chain Inducing Apoptosis in Human Colon Cancer Cells." Natural Product Communications 15, no. 4 (April 2020): 1934578X2091729. http://dx.doi.org/10.1177/1934578x20917298.

Full text
Abstract:
Based on the strong activity dependence of paclitaxel (PTX; Taxol) or docetaxel (Taxotere) on the C-13 side chain, a small library of dehydroepiandrosterone, cholesterol, vitamin D2, and alkaloids talatisamine and songorine-PTX hybrids have been synthesized and evaluated for in vitro anticancer activity by MTT assay against human breast (MCF-7), colon (HCT116), lung carcinoma (A549), and renal adenocarcinoma (786-0) cancer cell lines. Most hybrids (11b, 12b, 13b, 15b, and 18b) reduced the growth of MCF-7 and 786-0 cells with low PTX sensitivity in vitro. Among the synthesized compounds, hybrid 11b was better in inhibiting the growth of the 4 cells than PTX. A relatively low IC50 value of compound 11b (8.16 ± 0.04 μM) was also examined after exposure for 48 hours. Hybrid 11b showed a proapoptotic effect in HCT116 cells evaluated by Annexin V/propidium iodide binding assay. The level of hybrid 11b leading to protective cell death in HCT116 cells was detected using western blot and not easily observed in our basic examinations.
APA, Harvard, Vancouver, ISO, and other styles
4

Hřebabecký, Hubert, Milena Masojídková, and Antonín Holý. "Synthesis of Racemic 2-Hydroxy-4- and 2-Hydroxy-5-(hydroxymethyl)cyclohexane Nucleoside Analogues." Collection of Czechoslovak Chemical Communications 67, no. 11 (2002): 1681–99. http://dx.doi.org/10.1135/cccc20021681.

Full text
Abstract:
New racemic 2-hydroxy-4- and 2-hydroxy-5-(hydroxymethyl)cyclohexane analogues of adenine (10b and 16b) and thymine nucleosides (13b and 19b) were prepared by alkylation of 1,8-diazabicyclo[5.4.0]undec-7-ene salt of adenine and/or thymine with 3-vinyl-7-oxabicyclo[4.1.0]heptane followed by cis hydroxylation with osmium(VIII) oxide and sodium chlorate, oxidation with sodium periodate, and borohydride reduction.
APA, Harvard, Vancouver, ISO, and other styles
5

Yu, Yi-Ning, Hui-Ling Yang, Li-Yan Jin, Ji-Hye Jang, Pan-Bong Ha, and Young-Hee Kim. "Design of Low-Area and Low-Power 1-kbit EEPROM." Journal of the Korean Institute of Information and Communication Engineering 15, no. 4 (April 30, 2011): 913–20. http://dx.doi.org/10.6109/jkiice.2011.15.4.913.

Full text
APA, Harvard, Vancouver, ISO, and other styles
6

Tilbrook, Rosanna H., Matthew R. Burleigh, Jean C. Costes, Samuel Gill, Louise D. Nielsen, José I. Vines, Didier Queloz, et al. "NGTS 15b, 16b, 17b, and 18b: four hot Jupiters from the Next-Generation Transit Survey." Monthly Notices of the Royal Astronomical Society 504, no. 4 (March 30, 2021): 6018–32. http://dx.doi.org/10.1093/mnras/stab815.

Full text
Abstract:
ABSTRACT We report the discovery of four new hot Jupiters with the Next-Generation Transit Survey (NGTS). NGTS-15b, NGTS-16b, NGTS-17b, and NGTS-18b are short-period (P < 5 d) planets orbiting G-type main-sequence stars, with radii and masses between 1.10 and 1.30RJ and 0.41 and 0.76MJ, respectively. By considering the host star luminosities and the planets’ small orbital separations (0.039–0.052 au), we find that all four hot Jupiters are highly irradiated and therefore occupy a region of parameter space in which planetary inflation mechanisms become effective. Comparison with statistical studies and a consideration of the planets’ high incident fluxes reveal that NGTS-16b, NGTS-17b, and NGTS-18b are indeed likely inflated, although some disparities arise upon analysis with current Bayesian inflationary models. However, the underlying relationships that govern radius inflation remain poorly understood. We postulate that the inclusion of additional hyperparameters to describe latent factors such as heavy element fraction, as well as the addition of an updated catalogue of hot Jupiters, would refine inflationary models, thus furthering our understanding of the physical processes that give rise to inflated planets.
APA, Harvard, Vancouver, ISO, and other styles
7

Kalpakchieva, R., H. G. Bohlen, W. von Oertzen, B. Gebauer, M. von Lucke-Petsch, T. N. Massey, A. N. Ostrowski, Th Stolla, M. Wilpert, and Th Wilpert. "Spectroscopy of 13B, 14B, 15B and 16B using multi-nucleon transfer reactions." European Physical Journal A 7, no. 4 (April 2000): 451–61. http://dx.doi.org/10.1007/pl00013641.

Full text
APA, Harvard, Vancouver, ISO, and other styles
8

Mohareb, Rafat Milad, and Ibram Refat Mikhail. "Synthesis of Thiazole, Thiophene, Pyran and Pyridine Derivatives Derived from 3-phenyl-1H-pyrazol-5(4H)-one with Anti-proliferative, Tyrosine Kinase and PIM-1 Kinase Inhibitions." Letters in Drug Design & Discovery 17, no. 4 (April 25, 2020): 485–501. http://dx.doi.org/10.2174/1570180816666190618105907.

Full text
Abstract:
Background: A wide range of pyrazole derivatives gained special attention due to their wide range of pharmacological activities especially the therapeutic activities. Many pharmacological drugs containing the pyrazole nucleus are known in the market. Methods: The 3-phenyl-1H-pyrazol-5(4H)-one was the key starting compound for many heterocyclic reactions to produce substituted and fused pyrazole derivatives. Results: Antiproliferative activities of the produced compounds against six cancer cell lines A549, HT-29, MKN-45, U87MG, and SMMC-7721 and H460 were measured through which compounds showed high inhibitions. The most promising compounds were tested against tyrosine kinases (c-Kit, Flt-3, VEGFR-2, EGFR, and PDGFR). Structure-Activity Relationship (SAR) was rationalized by looking at the varying structural features of the molecules. In addition, the most active compounds were selected for Pim-1 inhibition. Conclusion: Thirty-nine pyrazole derivatives were synthesized. Nine of them 8b, 9, 12b, 12d, 14b, 15b, 18d, 18f, 19b, and 21d were the most active compounds toward the selected cancer cell lines. Compounds 12b, 14b, 18d, 18f, and 21d showed high inhibitions toward the tyrosine kinases, whereas compounds 14b, 18d, and 18f were the most potent inhibitors of Pim-1.
APA, Harvard, Vancouver, ISO, and other styles
9

ZHANG, Sizhong, Weimin QIU, Hui WU, Ge ZHANG, Mingkong HUANG, Cuiying XIAO, Jun YANG, et al. "The shorter zinc finger protein ZNF230 gene message is transcribed in fertile male testes and may be related to human spermatogenesis." Biochemical Journal 359, no. 3 (October 25, 2001): 721–27. http://dx.doi.org/10.1042/bj3590721.

Full text
Abstract:
The zinc finger gene family represents one of the largest in the mammalian genome, with several of these genes reported to be involved in spermatogenesis. A newly discovered gene has been identified that is expressed abundantly in the testicular tissue of fertile men as determined by mRNA differential display. The gene encodes a C3HC4-type zinc finger protein motif (ring finger motif) consistent with a role in pre-meiotic or post-meiotic sperm development. The gene was named ZNF230 and mapped to the short arm of chromosome 11 (11p15). ZNF230 has two transcripts, of 1kb and 4.4kb in length. The shorter 1kb transcript was only detected in testicular tissue whereas the longer 4.4kb transcript was not detected in testis but was found in several other tissues. The lack of detectable ZNF230 expression in azoospermic patients by reverse transcriptase-mediated PCR analysis is interpreted to mean that this gene is involved in maintaining normal human male fertility.
APA, Harvard, Vancouver, ISO, and other styles
10

Margaritis, Lukas H. "The eggshell of Drosophila melanogaster. II. New staging characteristics and fine structural analysis of choriogenesis." Canadian Journal of Zoology 64, no. 10 (October 1, 1986): 2152–75. http://dx.doi.org/10.1139/z86-330.

Full text
Abstract:
The characteristics of the stages of choriogenesis have been identified using light and electron microscopy. Nine stages have been discerned (11A, 11B, 12A, 12B, 12C, 13A, 13B, 14A, 14B), replacing the four stages used so far (11, 12, 13, 14). Characteristics used to determine the stage of the choriogenesis include (a) the size of oocyte as compared with the whole follicle, (b) the length of the chorionic appendages, and (c) the fine structure of the chorionic layers at the main shell and at the specialized regions. Factors a and b were detected by dark-field light microscopy on living follicles, whereas factor c was studied with electron microscopy. At stage 11A the vitelline membrane has just been completed. At stage 11B the follicle cells secrete the wax layer and the respiratory appendages start to form. Stage 12A follicles secrete endochorion at the anterior pole and the appendages elongate, whereas at stage 12B the main shell follicle cells start to secrete endochorion complex. Stage 12C shows initiation of pillar formation at the main shell and 150 μm long appendages. Stage 13A is characterized by 200 μm long appendages and formation of endochorionic cavities at the main shell, through the participation of a "flocculent" material. At stage 13B the endochorionic "roof is formed, which is completed at stage 14A by the simultaneous formation of the "roof network." The last stage, 14B, exhibits 300 μm long appendages and the secretion of exochorion over the entire follicle. The above stages are accompanied by region-specific formation of specialized structures which include the respiratory appendages, the operculum, the posterior pole, the micropyle, and the collar.
APA, Harvard, Vancouver, ISO, and other styles
11

Wrackmeyera, Bernd, Sergej V. Gruener, and Alla S. Zolotareva. "Reactivity of Alkoxyethynyl(trimethyl)silane, -germane and -stannane towards Trialkylboranes. Organometallic-Substituted Enol Ethers." Zeitschrift für Naturforschung B 58, no. 11 (November 1, 2003): 1035–40. http://dx.doi.org/10.1515/znb-2003-1101.

Full text
Abstract:
Abstract Methoxyethynyl(trimethyl)silane (1a) reacts at 100°C very slowly with triethylborane (4) to give a mixture of alkenes, one of which is the 1,1-organoboration product (Z)-1-methoxy-1-trimethylsilyl- 2-diethylboryl-but-1-ene (7a). Methoxyethynyl(trimethyl)germane (2a) reacts within minutes at 60 - 70°C with 4, tripropylborane (5) and 9-ethyl-9-borabicyclo[3.3.1]nonane (6) by 1,1-organoboration in the usual regio- and stereospecific way to give the corresponding alkenes (9a - 11a). The analogous reactions of the ethoxyethynyl(trimethyl)germane (2b) require longer heating and are accompanied by decomposition of 2b. Ethoxyethynyl(trimethyl)stannane (3b) reacts with the trialkylboranes 4- 6 already below room temperature by 1,1-organoboration to give the alkenes (12b - 14b) in quantitative yield. The compound 3b also reacts with the alkenes, e.g. 9a, 13b, 14b, to give novel organometallicsubstituted dienes. All products were characterised by multinuclear magnetic resonance spectroscopy (1H, 11B, 13C, 29Si, and 119Sn NMR).
APA, Harvard, Vancouver, ISO, and other styles
12

Wu, Hao, Xianghui Liu, and Xiufeng Yao. "A Solution to Computer Infection with 1KB Folder Virus - Taking School Teaching and Office Scenarios as an Example." Advances in Education, Humanities and Social Science Research 5, no. 1 (May 9, 2023): 216. http://dx.doi.org/10.56028/aehssr.5.1.216.2023.

Full text
Abstract:
The "1KB" folder virus (Worm. Script. VBS. Autorun. be), also known as the "Storm 1" virus, is harmless but deceptive. It can hide files and folders in the USB flash drive and generate some fake "exe format" folders, mislead users to click and trigger the virus.The purpose of this paper is to analyze its emergence, reasons for existence and relevant solutions in school teaching and office computers.
APA, Harvard, Vancouver, ISO, and other styles
13

Fan, Xi, Hou Peng Chen, Qian Wang, Yi Feng Chen, Zhi Tang Song, Min Zhu, and Gao Ming Feng. "A Low-Power 1Kb PCRAM Chip with Elevated Write Performance." Applied Mechanics and Materials 543-547 (March 2014): 463–66. http://dx.doi.org/10.4028/www.scientific.net/amm.543-547.463.

Full text
Abstract:
A low-power 1Kb phase change random access memory (PCRAM) chip is designed. The chip uses 1T1R (one transistor one resistor) structure and titanium nitride (TiN) bottom electrode (BE) for reducing power consumption. Besides, the write property of the chip is improved by employing a ramp down pulse generator. The chip is fabricated in 130nm CMOS standard technology. The test result shows a 56% power reduction based on TiN BE compared with tungsten (W) BE, which predicts a new direction to realize the commercialization of PCRAM.
APA, Harvard, Vancouver, ISO, and other styles
14

Tucker, Sheryl A., William E. Acree, John C. Fetzer, and Reginald H. Mitchell. "Polycyclic Aromatic Hydrocarbon Solute Probes. Part X: Evaluation of Select Hydrogenated Pyrene, Benzo[ghi]perylene, and Naphthacene Derivatives as Possible Solvent Polarity Probes." Applied Spectroscopy 47, no. 7 (July 1993): 1040–45. http://dx.doi.org/10.1366/0003702934415200.

Full text
Abstract:
Fluorescence emission spectra are reported for 3,4,5-trihydrobenzo[cd]pyrene, 3,4-dihydrobenzo[ghi]perylene, 5,6,7,8,9,10-hexahydrobenzo[ghi]perylene, trans-10b,10c-dihydro-10b,10c-dimethylpyrene, trans-12b,12c-dihydro-12b,12c-dimethylbenzo[a]pyrene, and trans-14b,14c-dihydro-14b,14c-dimethylnaphtho[2,1,8-qra]naphthacene dissolved in organic nonelectrolyte solvents of varying polarity. Dihydrobenzo|ghi]perylene was found to exhibit probe character, as evidenced by a systematic variation in emission intensity ratio with solvent polarity. It has a dynamic range of 0.98 and a high fluorescence quantum yield and is thought to be noncarcinogenic. Also reported are mathematical expressions which correlate measured intensity ratios and solvent polarity probe behavior of dihydrobenzo[ghi]perylene, pyrene, benzo[ghi]perylene, coronene, and ovalene in 48 solvents of varying polarity.
APA, Harvard, Vancouver, ISO, and other styles
15

Babalola, T. F., T. O. Olowomofe, T. R. Omodara, and T. Y. Ogunyemi. "Antibiotic Resistance Pattern and Plasmid Profile of Bacteria Isolates from Household Water Distribution Tanks in Ado-Ekiti." Journal of Pure and Applied Microbiology 15, no. 3 (August 31, 2021): 1697–704. http://dx.doi.org/10.22207/jpam.15.3.66.

Full text
Abstract:
Water is essential to life. The existence of all forms of life is dependent on an adequate water supply. The exigent need for water supply in homes prompted the construction of water sources and water storage devices in the homes. This however does not guarantee that the water is safe to drink. If the water is safe at the source, it may be contaminated during transportation storage and drawing at home. This study was carried out to determine the microbial counts, antibiotics susceptibility and plasmid profile of bacteria isolates from household water distribution tanks in the Ado-Ekiti metropolis. The total bacteria and coliform counts were determined using the pour plating technique. The antibiotic susceptibility pattern of the isolates was determined using the disc diffusion technique while the plasmid profile of the isolates was determined using the alkaline lysis method and agar gel electrophoresis. The mean total bacteria count of the water sample was 6.96 log10 CFU/ml, while the mean total of coliform count is 5.50 log10CFU/ml. The isolates with multiple antibiotics resistance belonged to five bacteria genera namely: Escherichia, Pseudomonas, Klebsiella, Enterobacter and Proteus. The plasmid analysis showed that four of the resistant strains had multiple plasmids, Enterobacter aerogens had 3 plasmids (1kb, 1.5kb and 2kb), Pseudomonas aeruginosa and Klebsiella aerogens had two plasmids (1kb, 1.5kb) respectively while Proteus vulgaris and Escherichia coli had no plasmid.
APA, Harvard, Vancouver, ISO, and other styles
16

Samatova, E. V., A. E. Druy, G. A. Tsaur, and L. G. Boronina. "SEROTYPING OF STREPTOCOCCUS PNEUMONIAE STRAINS, ISOLATED FROM CHILDREN IN URAL REGION WITH THE USE OF MULTIPLEX PCR." Epidemiology and Infectious Diseases 17, no. 5 (October 15, 2012): 26–30. http://dx.doi.org/10.17816/eid40701.

Full text
Abstract:
This article presents results of the multiplex PCR investigation of the serotypes distribution of S. pneumoniae strains circulating in Ekaterinburg and the Sverdlovsk region. This study was performed in children with invasive, noninvasive pneumococcal infections and carriers. 118 strains of pneumococci typed out of 129 ones (91.5%) referred to the 15 serotypes: 6A, 6B (20,8%); 23F (13,9%); 19F (11,5%); 8, 9V, 9A, 11F, 11A, 11B, 11C, 11D, 12F, 15A, 33F (11,5%); 3 (10%) 2, 15F, 17F, 22F, 23B (3,9%); 18B, 18C (3.9%), 19A (3,2%); 7F, 19B, 19C, 23A (3,2%); 5,10A (1.6%), 20 (1.6%), 14 (1, 6%); 9L, 9N, 15B, 15C (1,6%); 18F (1,6%); 18A (1.6%). Coincidence rate of serotypes S. pneumoniae, isolated from children with chronic infectious and inflammatory diseases of the lung with serotypes included into the content of the conjugate vaccines is: 7-valent - 69.3%, 10-valent - 98.2%, 11 - and 13-valent - 100%.
APA, Harvard, Vancouver, ISO, and other styles
17

Collins, DJ, and JD Cullen. "The Structure and Function of Estrogens. IX. Synthesis of the trans Isomer of 5,5,10b-Trimethyl-4b,5,6,10b,11,12-hexahydrochrysene-2,8-diol." Australian Journal of Chemistry 41, no. 5 (1988): 735. http://dx.doi.org/10.1071/ch9880735.

Full text
Abstract:
Alkylation of ketene methyl trimethylsilyl acetal (10) with 1ξ-acetoxy- 6-methoxy-2-(p- methoxyphenyl )-2-methyl-1,2,3,4-tetrahydronaphthalene (9) in the presence of zinc iodide gave 84% of methyl (1′RS,2′RS)-2- [6′-methoxy-2′-(p-methoxyphenyl )-2?-methyl-1′,2′,3′,4′- tetrahydronaphthalen-1′-yl] ethanoate (11a). Cyclization of the derived acid (11b) with methanesulfonic acid gave 89% of 2,8-dimethoxy-10b-methyl-cis-4b,10b,11,12-tetrahydrochrysen-6(5H)-one (12a), Clemmensen reduction of which afforded 52% of 2,8-dimethoxy-4b-methyl-cis- 4b,5,6,10b,11,12-hexahydrochrysene (12b). Oxidation of (12b) with dichlorodicyanobenzoquinone gave 70% of the conjugated enone (4), which upon hydrogenation over 10% palladium/charcoal gave a 5:1 ratio of 2,8-dimethoxy-10b-methyl-trans-4b,10b,11,12-tetrahydrochrysen-6(5H)-one (14) and the cis isomer (12a). Exhaustive methylation of the trans ketone (14) yielded 49% of 2,8-dimethoxy-5,5,10b-trimethyl-trans-4b,10b,11,12-tetrahydrochrysen-6(5H)-one (16), which upon Clemmensen reduction followed by O- demethylation afforded 5,5,10b-trimethyl-trans-4b,5,6,10b,11,12-hexahydrochrysene-2,8-diol(2).
APA, Harvard, Vancouver, ISO, and other styles
18

Chaparro, Jose X., Ronald R. Sederoff, and Dennis J. Werner. "PHYLLOGENETIC RELATIONSHIPS OF PRUNUS SPECIES IN THE AMYGDALUS SUBGENUS." HortScience 25, no. 9 (September 1990): 1159e—1159. http://dx.doi.org/10.21273/hortsci.25.9.1159e.

Full text
Abstract:
Total cellular DNA has been extracted from leaves and\or seed of Prunus dulcis, P. persica, P. mira, P. davidiana, P. persica subsp. ferganensis, and P. triloba. Chloroplast restriction fragments have been visualized by Southern blot analysis using heterologous probes from a petunia chloroplast library. Analysis of preliminary data separates the species into three groups. The first contains P. dulcis, P. mira, and P. davidiana; the second P. kansuensis, P. persica, and P. persica subsp. ferganensis; and the third P. triloba.PCR amplification using oligos for cytosolic glyceraldehyde-3-phosphate dehydrogenase yields genomic fragments approximately 1kb in size from P. dulcis and P. triloba. Sequence analysis will be performed to determine species relationships at the gene level.
APA, Harvard, Vancouver, ISO, and other styles
19

Davidson, Alex, Gonçalo Pestana, and Sofía Celi. "FrodoPIR: Simple, Scalable, Single-Server Private Information Retrieval." Proceedings on Privacy Enhancing Technologies 2023, no. 1 (January 2023): 365–83. http://dx.doi.org/10.56553/popets-2023-0022.

Full text
Abstract:
We design FrodoPIR — a highly configurable, stateful, single-server Private Information Retrieval (PIR) scheme that involves an offline phase that is completely client-independent. Coupled with small online overheads, it leads to much smaller amortized financial costs on the server-side than previous approaches. In terms of performance for a database of 1 million 1KB elements, FrodoPIR requires < 1 second for responding to a client query, has a server response size blow-up factor of < 3.6x, and financial costs are ~$1 for answering 100,000 client queries. Our experimental analysis is built upon a simple, non-optimized Rust implementation, illustrating that FrodoPIR is particularly suitable for deployments that involve large numbers of clients.
APA, Harvard, Vancouver, ISO, and other styles
20

Mohareb, Rafat M., Amr S. Abouzied, and Nermeen S. Abbas. "Synthesis and Biological Evaluation of Novel 4,5,6,7-Tetrahydrobenzo[D]-Thiazol-2- Yl Derivatives Derived from Dimedone with Anti-Tumor, C-Met, Tyrosine Kinase and Pim-1 Inhibitions." Anti-Cancer Agents in Medicinal Chemistry 19, no. 12 (December 2, 2019): 1438–53. http://dx.doi.org/10.2174/1871520619666190416102144.

Full text
Abstract:
Background: Dimedone and thiazole moieties are privileged scaffolds (acting as primary pharmacophores) in many compounds that are useful to treat several diseases, mainly tropical infectious diseases. Thiazole derivatives are a very important class of compounds due to their wide range of pharmaceutical and therapeutic activities. On the other hand, dimedone is used to synthesize many therapeutically active compounds. Therefore, the combination of both moieties through a single molecule to produce heterocyclic compounds will produce excellent anticancer agents. Objective: The present work reports the synthesis of 47 new substances belonging to two classes of compounds: Dimedone and thiazoles, with the purpose of developing new drugs that present high specificity for tumor cells and low toxicity to the organism. To achieve this goal, our strategy was to synthesize a series of 4,5,6,7-tetrahydrobenzo[d]-thiazol-2-yl derivatives using the reaction of the 2-bromodimedone with cyanothioacetamide. Methods: The reaction of 2-bromodimedone with cyanothioacetamide gave the 4,5,6,7-tetrahydrobenzo[d]- thiazol-2-yl derivative 4. The reactivity of compound 4 towards some chemical reagents was observed to produce different heterocyclic derivatives. Results: A cytotoxic screening was performed to evaluate the performance of the new derivatives in six tumor cell lines. Thirteen compounds were shown to be promising toward the tumor cell lines which were further evaluated toward five tyrosine kinases. Conclusion: The results of antitumor screening showed that many of the tested compounds were of high inhibition towards the tested cell lines. Compounds 6c, 8c, 11b, 11d, 13b, 14b, 15c, 15g, 21b, 21c, 20d and 21d were the most potent compounds toward c-Met kinase and PC-3 cell line. The most promising compounds 6c, 8c, 11b, 11d, 13b, 14b, 15c, 15g, 20c, 20d, 21b, 21c and 21d were further investigated against tyrosine kinase (c-Kit, Flt-3, VEGFR-2, EGFR, and PDGFR). Compounds 6c, 11b, 11d, 14b, 15c, and 20d were selected to examine their Pim-1 kinase inhibition activity the results revealed that compounds 11b, 11d and 15c had high activities.
APA, Harvard, Vancouver, ISO, and other styles
21

Uhrig, M. L., and O. Varela. "Michael Addition of Thiols to Sugar Enones. Synthesis of 3-Deoxy-4-Thiohexopyranosid-2-uloses as Key Precursors of 3-Deoxy- and C-2 Branched-Chain 4-Thiosugars." Australian Journal of Chemistry 55, no. 2 (2002): 155. http://dx.doi.org/10.1071/ch01200.

Full text
Abstract:
Benzyl and 2-propyl 6-O-acetyl-3,4-dideoxy-α -D-glycero-hex-3-enopyranosid-2-uloses (2) and (3) were readily prepared by the tin(IV) chloride-promoted glycosylation of glycal (1). The enone system of (2) and (3) underwent a highly diastereoselective Michael addition of thiols (ethanethiol, propane-2-thiol, and benzenemethanethiol) to afford the sulfur-containing hexopyranosid-2-ulose derivatives (4a-c) and (5a-c) in good yields. Sodium borohydride reduction of the carbonyl functionalities of (4b,c) and (5b) led to the corresponding 3-deoxy-4-thiohexopyranosides having the D-xylo (6b), (6c), and (8b) or the D-lyxo (7b), (7c), and (8c) configuration. Standard acetylation of these compounds gave the corresponding per-O-acetyl derivatives (10b), (10c), and (12b) and (11b), (11c), and (13b), useful for confirming all the previous configurational assignments by means of their 1H and 13C nuclear magnetic resonance spectra. Furthermore the 2-ulose (5b) proved to be a key intermediate for the synthesis of C-2 branched-chain 4-thiopyranosides, such as (16). The latter was synthesized by a good yielding ammonium acetate-catalysed Knoevenagel-type condensation of malononitrile with (5b).
APA, Harvard, Vancouver, ISO, and other styles
22

Sue, Kenneth, Melissa M. Cadelis, Evangelene S. Gill, Florent Rouvier, Marie-Lise Bourguet-Kondracki, Jean Michel Brunel, and Brent R. Copp. "Indole-3-Acetamido-Polyamines as Antimicrobial Agents and Antibiotic Adjuvants." Biomolecules 13, no. 8 (August 7, 2023): 1226. http://dx.doi.org/10.3390/biom13081226.

Full text
Abstract:
The widespread incidence of antimicrobial resistance necessitates the discovery of new classes of antimicrobials as well as adjuvant molecules that can restore the action of ineffective antibiotics. Herein, we report the synthesis of a new class of indole-3-acetamido-polyamine conjugates that were evaluated for antimicrobial activities against a panel of bacteria and two fungi, and for the ability to enhance the action of doxycycline against Pseudomonas aeruginosa and erythromycin against Escherichia coli. Compounds 14b, 15b, 17c, 18a, 18b, 18d, 19b, 19e, 20c and 20d exhibited strong growth inhibition of methicillin-resistant Staphylococcus aureus (MRSA) and Cryptococcus neoformans, with minimum inhibitory concentrations (MIC) typically less than 0.2 µM. Four analogues, including a 5-bromo 15c and three 5-methoxyls 16d–f, also exhibited intrinsic activity towards E. coli. Antibiotic kill curve analysis of 15c identified it to be a bactericide. While only one derivative was found to (weakly) enhance the action of erythromycin against E. coli, three examples, including 15c, were found to be strong enhancers of the antibiotic action of doxycycline against P. aeruginosa. Collectively, these results highlight the promising potential of α,ω-disubstituted indole-3-acetamido polyamine conjugates as antimicrobials and antibiotic adjuvants.
APA, Harvard, Vancouver, ISO, and other styles
23

Muneer, Mohammed, Prashant V. Kamat, and Manapurathu V. George. "Electron transfer reactions. Reaction of nitrogen heterocycles with potassium." Canadian Journal of Chemistry 68, no. 6 (June 1, 1990): 969–75. http://dx.doi.org/10.1139/v90-152.

Full text
Abstract:
The results of our studies on potassium-induced transformations of some selected nitrogen heterocycles are presented. The substrates under investigation include 2,3-diphenylindole (1a), 2,3-diphenyl-1-methylindole (1b), 1,2,3-triphenylindole (1c), 2,3,4,5-tetraphenylpyrrole (5a), 1,2,3,5-tetraphenylpyrrole (5b), 1-benzyl-2,3,5-triphenylpyrrole (5c), 2,4,5-triphenyloxazole (15a), 4,5-diphenyl-2-methyloxazole (15b), 2,4-diphenyl-5-methyloxazole (15c), and 2,4,5-triphenylimidazole (19). Treatment of 1a with potassium in THF gave 9H-dibenzo[a,c]carbazole (3a), whereas 1c gave a mixture of 9-phenyl-9H-dibenzo-[a,c]carbazole (3c) and 2,3-diphenylindole (1a). Under identical conditions, 1b gave only the cleavage product 1a. In contrast, when the reactions of 1a,c were carried out with potassium in THF saturated with oxygen, and with potassium superoxide in benzene containing 18-crown-6, a mixture of 2-benzamidobenzophenone (4a), the carbazoles 3a,c, and 1a was formed. Although no product was isolated on treatment of 5a with potassium in THF, the reaction of 5a with potassium in THF saturated with oxygen gave a mixture of tetraphenylpyrazine (7a), the benzoylaminostilbene 8a, the lactam 12a, benzamide (11a), and benzoic acid (14). Similar results were obtained in the reaction of 5a with potassium superoxide. The reaction of N-substituted pyrroles such as 5b,c with potassium gave the NH pyrrole 9b in each case, whereas the reaction of 5b,c with potassium in THF, saturated with oxygen, gave a mixture of 9b, the butanone 10b, the 1,4-dione 13b, the lactam 12b, the amides 11a–c, and benzoic acid (14). Attempted reactions of 5b,c with potassium superoxide did not give any isolable product; most of the starting material could be recovered unchanged in each case. A mixture of N-(1,2-diphenylethyl)benzamide (18a) and benzoic acid (14) was formed in the reaction of the oxazole 15a with potassium, whereas 15b,c, under analogous conditions, gave the N-vinylamides 17b,c and benzoic acid (14). In contrast, treatment of the imidazole 19 with potassium in THF did not give any product; however, when the reaction of 19 was carried out with potassium in THF saturated with oxygen, and with potassium superoxide, dibenzamide (21) was isolated, in each case.Radical ions have been invoked as intermediates in the transformation of the different substrates to the observed products. Cyclic voltammetric studies have been carried out to measure the reduction potentials of these radical anion intermediates. These radical anions have also been generated by pulse radiolysis in methanol, and their absorption spectra recorded. Keywords: nitrogen heterocycles, radical ions, potassium-induced transformations, pulse radiolysis, cyclic voltammetry.
APA, Harvard, Vancouver, ISO, and other styles
24

Nguyen Thi, Kim Dung, and Thi Lien Nguyen. "tudy on the determination of ¹⁰B/¹¹B isotope ratio in water samples by isotope dilution – inductively coupled plasma mass spectrometry (ID-ICPMS)." Nuclear Science and Technology 7, no. 3 (September 1, 2021): 8–16. http://dx.doi.org/10.53747/jnst.v7i3.99.

Full text
Abstract:
The determination of 10B/11B isotope ratio and boron concentration in various watersamples using isotope dilution technique with inductively coupled plasma mass spectrometry (ICPMS) was studied. The interferences on precision and accuracy in isotopic ratio determination by ICPMS such as memory effects, dead time, spectral overlap of 12C were investigated for the selection of optimum conditions. By the addition of certain amounts of enriched 10B into samples, the 10B/11B ratio was determined through ICP-MS signal of 10B and 11B. The detection limit for 10B and 11B was experimentally obtained as 0.26 µg/L and 0.92 µg/L, respectively. The ratios of 10B/11B in measured water samples varied in the ranged between 0.1905 and 0.2484 for different matrices. This method has been then applied for the determination of boron isotopic ratio in VVER-1000 reactor-type simulated primary coolant water and in some environmental water samples.
APA, Harvard, Vancouver, ISO, and other styles
25

Levantini, Elena, Yutaka Okuno, Pu Zhang, Steffen Koschmieder, Hanna S. Radomska, Maris Fenyus, Maureen Guiney, and Daniel G. Tenen. "3′ Distal Regulatory Elements Required for Human CD34 Expression in Transgenic Mice." Blood 106, no. 11 (November 16, 2005): 125. http://dx.doi.org/10.1182/blood.v106.11.125.125.

Full text
Abstract:
Abstract CD34 is the best-defined human hematopoietic stem cell (HSC) marker, however the regulation of its gene expression is still largely unknown. Therefore, unraveling the elements that regulate human CD34 expression would be an invaluable tool for a broad range of studies, including the establishment of models of leukemia in mice, which require targeting of the transgene to stem and/or early progenitor cells. Moreover, identification of such regulatory elements will provide important insights into the transcriptional agenda of stem and progenitor cells and most importantly will prove useful for gene therapy protocols. Studies from our laboratory demonstrated that human CD34 transgenes are expressed in murine repopulating HSCs, which resembles the expression of the CD34 gene in human hematopoiesis, thus indicating the mouse model as an excellent way to study the expression of human CD34. Using P1 derived artificial chromosome (PAC) clones encompassing the human CD34 gene to generate transgenic mice, we showed that 90kb of upstream and 26kb of downstream flanking sequences were capable of regulating human CD34 expression in murine transgenic lines. Successive deletions of this larger construct were then performed to identify the important control regions. Deletion of the 5′ region from −90kb to −18kb did not result in any loss of activity. PAC54A19, a clone extending from −18kb to +26kb, expressed RNA in various tissues in a manner similar to that of larger fragments. In contrast, deletions creating a construct spanning from −10kb to +17kb led to complete loss of expression in transgenic animals, indicating that critical distal elements are located between −18kb to −10kb and/or +17kb to +26kb. In order to facilitate identification of important regulatory elements present in the upstream (−18kb to −10 kb) and/or downstream (+17kb to +26kb) regions of human CD34, we created further deletions of PAC54A19 using rare-cutting restriction enzymes, and studied the effects of the deletions on human CD34 expression in transgenic mice. Interestingly, we did not detect any human CD34 mRNA and protein expression in bone marrow and HSCs from transgenic mice carrying a construct spanning from −18kb to +17.4kb. In contrast, we observed expression of human CD34 transcripts in the bone marrow of transgenic mice containing a PAC spanning from −12.8kb to +26kb. Furthermore, HSCs from this latter group of mice presented the human CD34 antigen on their surface, as detected by FACS. Taken together, these data are highly suggestive that critical cis regulatory element(s) required to drive human CD34 in vivo expression are located in a 8.6kb fragment placed between +17.4kb and +26kb downstream of the human CD34 gene. Our current efforts focus on identifying the element(s) within the 8.6kb 3′ region that might be required to achieve human CD34 expression in HSCs.
APA, Harvard, Vancouver, ISO, and other styles
26

Ashraf, Mohammad Arif, Sudip Biswas, Samsad Razzaque, Taslima Haque, and Zeba I. Seraj. "Cloning and Characterization of Alcohol Dehydrogenase (Adh) Promoter Region for Expression Under Submergence and Salinity Stress." Plant Tissue Culture and Biotechnology 24, no. 1 (June 23, 2014): 111–20. http://dx.doi.org/10.3329/ptcb.v24i1.19252.

Full text
Abstract:
The characterization of promoter is important for developing stress tolerant crops as well as understanding the role of promoters in regulating gene expression. The current study was initiated with an aim to characterize the Adh promoter under salinity and submergence stress in rice calli. The upstream regions (~1kb) of the Adh gene was amplified from the genomic DNA of Arabidopsis (Columbia Ecotype). The amplified product was then cloned successively into an entry and promoter-characterization binary destination vector having the reporter gene ?-glucuronidase (GUS) by applying Gateway Technology. A positive clone was confirmed by applying PCR, restriction digestion and sequencing. The construct was then transformed into Agrobacterium tumefaciens LBA4404 strain and rice calli infected with the latter. In both salt and submergence stresses, Adh could selectively express GUS gene activity up to two-fold compared to control. Plant Tissue Cult. & Biotech. 24(1): 111-120, 2014 (June) D. O. I. http://dx.doi.org/10.3329/ptcb.v24i1.19252
APA, Harvard, Vancouver, ISO, and other styles
27

Collins, DJ, and HA Jacobs. "Synthesis of 3-(4′-Methoxyphenyl)-2,2,4,4-Tetramethylpentane and Some Cyclic Analogs." Australian Journal of Chemistry 39, no. 12 (1986): 2095. http://dx.doi.org/10.1071/ch9862095.

Full text
Abstract:
Reaction of 1-methoxy-2-methyl-1-trimethylsilyloxyprop-1-ene (8) with 1-acetoxy-1-(4′-methoxyphenyl)-2,2-dimethylpropane (7b) in the presence of zinc iodide gave 84% of methyl 3-(4′methoxyphenyl)-2,2,4,4- tetramethylpentanoate (9a), which was reduced with lithium aluminium hydride to 3-(4′-methoxyphenyl)-2,2,4,4-tetramethylpentan-1-ol(12a). Hydride reduction of the derived tosylate (12b) afforded 3-(4′-methoxyphenyl )-2,2,4,4-tetramethylpentane (5b) which upon demethylation yielded the corresponding phenol (10a). In an analogous manner, 1-acetoxy-1-(4′-methoxyphenyl)-2-methylpropane (7d) was converted into 3- (4′-hydroxyphenyl)-2,2,4-trimethylpentane (10b). By a similar reaction sequence, 6-methoxy-2,2-dimethyl-3,4- dihydronaphthalen-1(2H)-one (14) was transformed into 6-hydroxy-2,2- dimethyl-1-(1′,1′-dimethylethyl)-1,2,3,4-tetrahydronaphthalene (16b). Hydrolysis of the ester (9a) and cyclization of the resulting carboxylic acid (19) by treatment with methanesulfonic acid at 20° for 18 h afforded 3-(1′, 1′-dimethylethyl)-6-methoxy-2,2-dimethyl-2,3-dihydro-1H-inden-1-one (20). Clemmensen reduction of this followed by demethylation yielded 1-(1′,1′-dimethylethyl)-2,2-dimethyl-2,3-dihydro-1H-inden-5-ol (21b). Attempts to oxidize the phenols (10a), (10b), (16b) and (21b) to the corresponding quinone methides by conventional methods failed.
APA, Harvard, Vancouver, ISO, and other styles
28

Cuartas, Crespo, Priego, Persoons, Daelemans, Camarasa, Insuasty, and Pérez-Pérez. "Design and Synthesis of New 6-Nitro and 6-Amino-3,3a,4,5-Tetrahydro-2H-Benzo[g]indazole Derivatives: Antiproliferative and Antibacterial Activity." Molecules 24, no. 23 (November 21, 2019): 4236. http://dx.doi.org/10.3390/molecules24234236.

Full text
Abstract:
New substituted benzo[g]indazoles functionalized with a 6-nitro and 6-amino groups have been synthesized by the reaction of benzylidene tetralones with hydrazine in acetic acid. The resulting conformationally-constrained compounds were evaluated for their antiproliferative activity against selected cancer cell lines. The nitro-based indazoles 11a, 11b, 12a and 12b have shown IC50 values between 5–15 μM against the lung carcinoma cell line NCI-H460. Moreover, the nitro compounds were tested for antibacterial activity where compounds 12a and 13b have shown MIC values of 250 and 62.5 μg/mL against N. gonorrhoeae with no hemolytic activity in human red blood cells (RBC).
APA, Harvard, Vancouver, ISO, and other styles
29

Webber, Beau, Matthew Johnson, Nicholas Slipek, Walker Lahr, Xiaohong Qiu, Blaine Rathmann, Miechaleen Diers, Bryce Wick, R. Scott McIvor, and Branden Moriarity. "35 Targeted non-viral integration of large cargo in primary human T cells by CRISPR/Cas9 guided homology mediated end joining." Journal for ImmunoTherapy of Cancer 8, Suppl 3 (November 2020): A36. http://dx.doi.org/10.1136/jitc-2020-sitc2020.0035.

Full text
Abstract:
BackgroundEngineered immune cells hold tremendous promise for the treatment of advanced cancers. As the scale and complexity of engineered cell therapies increase, reliance on viral vectors for clinical production limits translation of promising new therapies. Here, we present an optimized platform for CRISPR/Cas9-targeted, non-viral engineering of primary human T cells that overcomes key limitations of previous approaches, namely DNA-induced toxicity and low efficiency integration of large genetic cargos.MethodsA systematic optimization of nucleic acid delivery, editing reagent composition, and culture protocol was performed to overcome DNA toxicity. Targeted knockin (KI) at AAVS1 and TRAC was compared across multiple vector configurations with genetic cargos ranging from 1 to 3 kilobases (kb) in size. Integration efficiency was measured by flow cytometry and sequencing. Off-target editing and integration were evaluated using GUIDE-seq and targeted locus amplification (TLA), respectively. Phenotype and function of non-virally and lentivirus engineered CAR-T cells was compared using flow cytometry, cytokine profiling and cytotoxicity assays.ResultsWe identified a temporal window following T cell activation where transfection efficiency, cell-cycle-status, and cytosolic DNA sensor expression were optimal for targeted DNA integration and reduced toxicity. Within this window, we targeted a 1kb GFP reporter to the AAVS1 locus with an efficiency of ~45% using homologous recombination (HR). Efficiency was reduced to ~11% with a larger ~3kb TCR cassette targeted to the TRAC locus, consistent with previous reports.1–3 To improve large cargo integration we employed homology mediated end-joining (HMEJ) and short homology design (48bp vs. ~1kb for traditional HR).4 Using HMEJ, knockin of the 1kb GFP cassette at AAVS1 reached ~70%. Strikingly, integration of the 3kb TCR at TRAC reached ~50% using HMEJ. Additional optimization of the culture protocol doubled post-engineering survival and proliferation (up to ~35-fold expansion in 7 days). Non-virally engineered TRAC KI CAR-T cells were phenotypically and functionally equivalent to lentivirally engineered T cells in vitro. In vivo assays in xenograft models are underway and results will be presented.ConclusionsComprehensive, orthogonal optimization of parameters impacting nucleic acid delivery and DNA-toxicity in combination with novel modalities for integration achieved knockin of TCR and CAR cargo at efficiencies equivalent to that of current viral vector platforms without compromising expansion or function. Our protocol is suitable for clinical scale production under GMP conditions and offers an improved methodology over previous methods for non-viral engineering of human T cells.ReferencesRoth TL, Puig-Saus C, Yu R, Shifrut E, Carnevale J, Li PJ, Hiatt J, Saco J, Krystofinski P, Li H, Tobin V, Nguyen DN, Lee MR, Putnam AL, Ferris AL, Chen JW, Schickel J-N, Pellerin L, Carmody D, Alkorta-Aranburu G, Del Gaudio D, Matsumoto H, Morell M, Mao Y, Cho M, Quadros M, Gurumurthy CB, Smith, B, Haugwitz M, Hughes SH, Weissman JS, Schumann K., Esensten JH., May AP, Ashworth A., Kupfer G. M., Atma S., Greeley W. & Marson A. Reprogramming human T cell function and specificity with non-viral genome targeting. Naturedoi:10.1038/s41586-018-0326-5Parker Autoimmune SN, Zuckerberg Biohub C, Francisco S. & Helen U. Polymer-stabilized Cas9 nanoparticles and modified repair templates increase genome editing efficiency. Nat. Biotechnol. doi:10.1038/s41587-019-0325-6Schober K, Müller TR, Gökmen F, Grassmann S, Effenberger M, Poltorak M, Stemberger C, Schumann K, Roth TL, Marson A. & Busch DH. Orthotopic replacement of T-cell receptor α- and β-chains with preservation of near-physiological T-cell function. Nature Biomedical Engineering 3, 974–984 ( 2019).Wierson WA, Welker JM, Almeida MP, Mann CM, Webster DA, Torrie ME, Weiss TJ, Kambakam S, Vollbrecht MK, Lan M, McKeighan KC, Levey J, Ming Z, Wehmeier A, Mikelson CS, Haltom JA, Kwan KM, Chien C-B, Balciunas D, Ekker SC, Clark KJ, Webber, BR, Moriarity BS, Solin SL, Carlson DF, Dobbs DL, McGrail M & Essner J. Efficient targeted integration directed by short homology in zebrafish and mammalian cells. Elife9, ( 2020).
APA, Harvard, Vancouver, ISO, and other styles
30

Mezhevych, S. Yu, A. T. Rudchik, K. Rusek, K. W. Kemper, A. A. Rudchik, O. A. Ponkratenko, and E. I. Koshchy. "Reaction 14C(11B, 12C)13B at Elab(11B) = 45 MeV, interaction of 13B + 12C versus that of 10,11,12B + 12C." Nuclear Physics and Atomic Energy 23, no. 1 (March 25, 2022): 12–19. http://dx.doi.org/10.15407/jnpae2022.01.012.

Full text
Abstract:
New experimental data for differential cross-sections of the 14C(11B, 12C)13B reaction obtained recently at the energy Еlab(11B) = 45 MeV for the ground states of 13B and 12C were analyzed within the coupled reaction channels (CRC) method that included the 11B + 14C elastic scattering channel as well as channels for one- and two-step transfers of nucleons in the coupling scheme. The necessary 11B + 14C Woods - Saxon (WS) optical potential parameters for the entrance reaction channel were obtained from 11B elastic scattering in the previous work, while those for 12C + 13B interaction were deduced from fitting the CRC calculations to the 14C(11B, 12C)13B reaction data. Needed spectroscopic amplitudes of transferred nucleons and clusters were calculated within the translational-invariant shell model. The data are well described by the direct transfer of a proton while contributions from two-step transfers were found to be negligible. The deduced 13B + 12C WS optical potential parameters are compared with those of the 10,11,12B + 12C nuclei interactions. The effect of isotopic differences in these interactions was observed.
APA, Harvard, Vancouver, ISO, and other styles
31

Vormann, Kirsten, Helmut Dreizler, Jens Doose, and Antonio Guarnieri. "Rotational Spectrum of Aminoborane: Centrifugal Distortion Constants and Boron and Nitrogen Hyperfine Structure." Zeitschrift für Naturforschung A 46, no. 9 (September 1, 1991): 770–76. http://dx.doi.org/10.1515/zna-1991-0905.

Full text
Abstract:
AbstractThe boron and nitrogen hyperfine structure in the rotational spectra of two aminoborane isotopomers, 11 BH2NH2 and 10BH2NH2, has been investigated and the quadrupole coupling constants of boron 10B, 11B and nitrogen 14N have been determined. We get the following results for the nuclear quadrupole coupling constants: χaa(11B) = -1.684 (14) MHz, χbb(11B) = -2.212 (11) MHz, χcc(11B) = 3.896(11) MHz, χaa(10B) = -3.481 (11) MHz, χbb(10B) = -4.623 (14) MHz, χCC(10B) = 8.104 (14) MHz and xaa(14N) = 0.095 (9) MHz, χbb(14N) = 2.091 (8) MHz, χcf4 (14N)=-2.186 (8) MHz. These nitrogen quadrupole coupling constants are those of the 11BH2 NH2 isotopomer. Additionally we were able to determine two out of the three spin rotation coupling constants caa, cbb, and ccc of boron, caa(11 B = 55.2 (26) kHz, cbb(11B) = 6.62 (36) kHz, caa (10B) = 15.26 (69) kHz and cbb(10B) = 4.94 (70) kHz. The spin rotation coupling constants ccc had to be fixed to zero in both cases. Furthermore we measured the rotational spectra in the mm-wave region to determine all quartic and several sextic centrifugal distortion constants according to Watson's A and S reduction
APA, Harvard, Vancouver, ISO, and other styles
32

Mezhevych, S. Yu, A. T. Rudchik, K. Rusek, K. W. Kemper, A. A. Rudchik, O. A. Ponkratenko, and S. B. Sakuta. "Mechanisms of 14C(11B,10B)15C reaction at energy 45 МеV for ground and excited states of 10B and 15C nuclei." Nuclear Physics and Atomic Energy 21, no. 3 (September 25, 2020): 231–38. http://dx.doi.org/10.15407/jnpae2020.03.231.

Full text
Abstract:
New experimental data for differential cross-sections of the reaction 14C(11B,10B)15C at Еlab(11B) = 45 MeV were obtained for transitions to the ground and excited states of the exit reaction channel nuclei. The experimental data were analyzed within the coupled-reaction-channels method (CRC). The 14C + 11B elastic scattering channel as well as channels for one- and two-step transfers of nucleons and clusters were included in the coupling scheme. The Woods - Saxon (WS) potential was used in the CRC-calculations for the entrance reaction channel with the parameters deduced previously from the analysis of the experimental data of 11B + 14C elastic and inelastic scattering, whereas the WS potential for the exit 15C + 10B reaction channel was deduced from the fit of CRC cross-sections to the 14C(11B,10B)15C reaction experimental data. Needed for CRC-calculations spectroscopic amplitudes (factors) of the nucleons and clusters transferred in the reaction were calculated within the translational-invariant shell model. The mechanisms for one- and two-step transfers of nucleons and clusters were investigated in this reaction. The 15C + 10B potential parameters were deduced, and comparisons of the CRC reaction cross-sections calculated with the 15C + 10B and 12,13C + 10B potential parameters were performed. The differences between these CRC calculations were observed, e.g. "isotopic effects" were observed for the potentials of 10B interaction with 12,13,15C carbon isotopes.
APA, Harvard, Vancouver, ISO, and other styles
33

White, Ruby, Christophe Pellefigues, Franca Ronchese, Olivier Lamiable, and David Eccles. "Investigation of chimeric reads using the MinION." F1000Research 6 (May 5, 2017): 631. http://dx.doi.org/10.12688/f1000research.11547.1.

Full text
Abstract:
Following a nanopore sequencing run of PCR products of three amplicons less than 1kb, an abundance of reads failed quality control due to template/complement mismatch. A BLAST search demonstrated that some of the failed reads mapped to two different genes -- an unexpected observation, given that PCR was carried out separately for each amplicon. A further investigation was carried out specifically to search for chimeric reads, using separate barcodes for each amplicon and trying two different ligation methods prior to sample loading. Despite the separation of ligation products, chimeric reads formed from different amplicons were still observed in the base-called sequence.The long-read nature of nanopore sequencing presents an effective tool for the discovery and filtering of chimeric reads. We have found that at least 1.7% of reads prepared using the Nanopore LSK002 2D Ligation Kit include post-amplification chimeric elements. This finding has potential implications for other amplicon sequencing technologies, as the process is unlikely to be specific to the sample preparation used for nanopore sequencing.
APA, Harvard, Vancouver, ISO, and other styles
34

White, Ruby, Christophe Pellefigues, Franca Ronchese, Olivier Lamiable, and David Eccles. "Investigation of chimeric reads using the MinION." F1000Research 6 (August 16, 2017): 631. http://dx.doi.org/10.12688/f1000research.11547.2.

Full text
Abstract:
Following a nanopore sequencing run of PCR products of three amplicons less than 1kb, an abundance of reads failed quality control due to template/complement mismatch. A BLAST search demonstrated that some of the failed reads mapped to two different genes -- an unexpected observation, given that PCR was carried out separately for each amplicon. A further investigation was carried out specifically to search for chimeric reads, using separate barcodes for each amplicon and trying two different ligation methods prior to sample loading. Despite the separation of ligation products, chimeric reads formed from different amplicons were still observed in the base-called sequence. The long-read nature of nanopore sequencing presents an effective tool for the discovery and filtering of chimeric reads. We have found that at least 1.7% of reads prepared using the Nanopore LSK002 2D Ligation Kit include post-amplification chimeric elements. This finding has potential implications for other amplicon sequencing technologies, as the process is unlikely to be specific to the sample preparation used for nanopore sequencing.
APA, Harvard, Vancouver, ISO, and other styles
35

Chaube, Damini. "Implementation of Third Eye for Blind People Using Ultrasonic Vibrator Glove." International Journal for Research in Applied Science and Engineering Technology 12, no. 4 (April 30, 2024): 2423–27. http://dx.doi.org/10.22214/ijraset.2024.60263.

Full text
Abstract:
Abstract: The “Third Eye for Blind People Using Ultrasonic Vibrator Glove”, is designed to help the blind to overcome the lack of visual sense, by using other senses like sound and touch. It uses audio and vibration signals to notify the user about upcoming hurdle. As the distance between glove and obstacle decreases, frequency of both audio and vibration signals increases, Thus the system helps to ease the navigation process for the needy. The system uses Atmega-328 microcontroller, which is a high performance 8-bit AVR RISC-based microcontroller. It has 32KB of ISP flash memory with read-while-write capabilities, as well as 1KB EEPROM, 2KB SRAM. It also has features like, 23 general purpose I/O lines, 32 general purpose working registers and three adjustable timer/counters with compare modes. For sensing the distance. the system uses a HC-SR04, a Ultrasonic Range Finder Distance Sensor Module. The sensor module is designed to measure the distance using the principle of SONAR or RADAR, of using ultrasonic wave to determine the distance of an object.
APA, Harvard, Vancouver, ISO, and other styles
36

Storm, V., and H. Dreizler. "Boron Nuclear Quadrupole Coupling in BF(OH)2." Zeitschrift für Naturforschung A 52, no. 12 (December 1, 1997): 874–76. http://dx.doi.org/10.1515/zna-1997-1207.

Full text
Abstract:
We investigated the nuclear quadrupole coupling of the 11B and 10B nuclei in fluorodihydroxy borane, BF(OH)2. An analysis of the hyperfine splittings resulted in the coupling constants %aa = -1.414(11) MHz, %bb = - 1.206(11) MHz, %cc = 2.620(11) MHz for 11B and %aa = -2.872(67) MHz, y M = -2.525(69) MHz, %cc = 5.397(69) MHz for 10B. From these constants the ratio r of the quadrupole moments r = Q(10B)/Q(11B) = 2.051 (44) could be derived and compared to data taken from the literature
APA, Harvard, Vancouver, ISO, and other styles
37

Hřebabecký, Hubert, Martin Dračínský, and Antonín Holý. "Synthesis of Novel Carbocyclic Nucleoside Analogues Containing Bicyclo[2.2.1]hept-2-ene-2-methanol." Collection of Czechoslovak Chemical Communications 73, no. 1 (2008): 44–58. http://dx.doi.org/10.1135/cccc20080044.

Full text
Abstract:
Starting ethyl (1R*,2R*,3R*,4S*)-3-bromobicyclo[2.2.1]hept-5-ene-2-carboxylate (9) was reduced with LiAlH4and benzoylated giving [(1R*,2R*,3R*,4S*)-3-bromobicyclo[2.2.1]hept-5-en-2-yl]methyl benzoate (11). Treatment of11with NaN3and CrO3in acetic acid afforded [(1R*,2S*,3R*,4R*,5S*,6R*)-6-azido-3-bromo-5-hydroxybicyclo[2.2.1]hept-2-yl]methyl benzoate (12a) and [(1R*,2S*,3S*,4R*,5S*,6R*)-5-azido-3-bromo-6-hydroxybicyclo[2.2.1]heptan-2-yl]-methyl benzoate (12b). These key intermediates were separated and converted in five reaction steps to (1R*,2R*,3S*,4S*)-3-[(5-amino-6-chloropyrimidin-4-yl)amino]-5-(hydroxymethyl)- bicyclo[2.2.1]hept-5-en-2-ol (17a) and (1R*,2R*,3S*,4S*)-3-[(5-amino-6-chloropyrimidin-4-yl)- amino]-6-(hydroxymethyl)bicyclo[2.2.1]hept-5-en-2-ol (17b). Ring closure with triethyl orthoformate led to (1R*,2R*,3S*,4S*)-5-(chloromethyl)-3-(6-chloro-9H-purin-9-yl)bicyclo[2.2.1]hept-5-en-2-ol (18a) and (1R*,2R*,3S*,4S*)-6-(chloromethyl)-3-(6-chloro-9H-purin-9-yl)- bicyclo[2.2.1]hept-5-en-2-ol (18b) using hydrochloric acid as a catalyst or (1R*,2R*,3S*,4S*)-3-(6-chloro-9H-purin-9-yl)-5-(hydroxymethyl)bicyclo[2.2.1]hept-5-en-2-ol (19a) and (1R*,2R*,3S*,4S*)- 3-(6-chloro-9H-purin-9-yl)-6-(hydroxymethyl)bicyclo[2.2.1]hept-5-en-2-ol (19b) using trifluoro- acetic acid as a catalyst. From19aand19b, 6-amino- and 6-(cyclopropylamino)purine derivatives20and21were prepared.
APA, Harvard, Vancouver, ISO, and other styles
38

Hengkengbala, Irvan R., Grevo S. Gerung, and Stenly Wullur. "DNA extraction and amplification of the rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) gene of red seaweed Gracilaria sp. from Bahoi Waters, North Minahasa Regency." AQUATIC SCIENCE & MANAGEMENT 6, no. 2 (August 10, 2019): 33. http://dx.doi.org/10.35800/jasm.6.2.2018.24836.

Full text
Abstract:
Title (Bahasa Indonesia): Ekstraksi DNA dan Amplifikasi gen rbcL(ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) Alga Merah Gracilaria sp. dari Perairan Desa Bahoi, Kabupaten Minahasa Utara The quality of DNA extraction and gene amplification in algae are influenced by several factors includingthe characters and components of the algal cell wall. Therefore, extraction procedure that successfully works in one species of algae mayfail for another type of algae. The present study was aimed to examine several DNA extraction techniquesand rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit)gene amplifications of Gracilaria sp. collected inBahoi, North Minahasa (126043’48’’N 12501’33”E). DNA genom of Gracilariasp. was extracted using conventional method (CTAB, Cetyltrimethyl ammonium Bromide), and commercial extraction kits (innuPrep Plant DNA Kit and Geneaid Genomic Plant Mini Kit). Amplification of rbcLgene employed 2 primers (rbcL-aF; ATGTCACCACAAACAGAGACTA AAGC, rbcL-aR; GTAAAATC-AAGT CCACCRCG, and rbcL-1F ATGTCACCACAAACAGAAAC, rbcL-724R TCGCATGTA-CC TGCAGTAGC under 2 different annealing temperatures (45 and 500C). Genomic DNA of Gracilariasp. was successfully extracted using Geneaid DNA Mini Kit (Plant) indicated by a DNA band on the agarose gel. RbcLgene of Gracilaria sp. could be amplified using primer 1F-724R and annealing temperature at 500C indicated bya sharp DNA band at 300-400 bp (1kb marker, Solis Biodyne) as a partial amplification of the target gene.Kualitas hasil ekstraksi DNA dan amplifikasi gen pada alga dipengaruhi oleh beberapa faktor diantaranya adalah karakter dan komponen penyususun dinding sel alga itu sendiri. Oleh karena itu, prosedur ekstraksi yang berhasil dilakukan pada pada satu jenis alga dapat saja gagal dilakukan untuk jenis alga lainnya. Penelitian ini dilakukan untuk mengkaji beberapa teknik ekstraksi DNA dan kondisi amplifikasi gen rbcL(ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) pada alga jenis Gracilariasp. dari perairan Bahoi, Minahasa Utara (126043’48’’N 12501’33”E). Ekstraksi DNA Gracilaria sp. dilakukan menggunakan metode konvensional (CTAB, Cetyltrimethyl ammonium Bromide), dan menggunakan kit ekstraksi komersil (innuPrep Plant DNA Kitdan Geneaid Genomic Plant Mini Kit). Amplifikasi gen rbcLdilakukkan menggunakan 2 pasang primer (rbcL-aF; ATGTCACCACAAACAGAGACTA AAGC, rbcL-aR; GTAAAATCAAGTCCACCRCG, dan rbcL-1F ATGTCACCACA AACAGAAAC, rbcL-724R TCGCATGTACCTGCAGTAGC dan 2 kondisi suhu annealingberbeda(45 dan 500C). DNA genom alga (Gracilariasp.) dapat diekstraksi menggunakan prosedur Geneaid DNA Mini Kit (Plant) yang ditandai adanya pita DNA pada gel agarose. Gen rbcLof Gracilaria sp. dapat diamplifikasi menggunakan pasangan primer rbcL1F dan 724R pada suhu annealing 500C yang ditandai dengan adanya pita DNA tebal pada posisi sekitar 300-400 bp (1kb marker, Solis Biodyne). Munculnya pita DNA target pada posisi tersebut mengindikasikan keberhasilan amplifikasi gen target secara parsial.
APA, Harvard, Vancouver, ISO, and other styles
39

Rádl, Stanislav, Wieland Hafner, Petr Hezký, Ivan Krejčí, Jan Proška, and Josef Hájíček. "Synthesis and Antinociceptive Activity of Some 3-Chlorophenyl- and 6-Chloropyridin-2-yl Derivatives." Collection of Czechoslovak Chemical Communications 64, no. 2 (1999): 377–88. http://dx.doi.org/10.1135/cccc19990377.

Full text
Abstract:
Derivatives of 2-chloro-6-(4-hydroxy-1-methylpiperidin-4-yl)pyridine (2b) were prepared and tested as analgesics. 2-Chloro-6-lithiopyridine treated with quinuclidin-3-one, 1-methylpyrrolidin-3-one, 2-(dimethylaminomethyl)cyclohexanone, and ethyl 1-methylpiperidin-4-ylcarboxylate provided the corresponding alcohols 5, 6, 13a, and 6-chloro-2-pyridyl 1-methylpiperidin-4-yl ketone (9). The ketone was reduced with sodium borohydride or treated with methylmagnesium chloride or phenyllithium to provide the corresponding alcohols 11, 12a and 12b, respectively. 1-[4-(6-Chloro-2-pyridyl)1-methylpiperidin-4-yl]-1-methylethanol (4b) was prepared from 2-chloro-6-(1-methyl-1,2,5,6-tetrahydropyridin-4-yl)pyridine (14b) by treatment with butyllithium and acetone followed by reduction of intermediate 15b with sodium cyanoborohydride.
APA, Harvard, Vancouver, ISO, and other styles
40

Kutnii, Dmytro, Stanislav Vanzha, Dmytro Burdeynyi, Volodymyr Levenets, O. Omelnik, and A. Shchur. "Boron Isotopic Ratio (δ11B) Measurements in Boron Carbide (B4C): Benchmarking Between SF-ICP-MS and PIGE Techniques." 2, no. 2 (June 2, 2022): 75–79. http://dx.doi.org/10.26565/2312-4334-2022-2-08.

Full text
Abstract:
The results of comparing the analytical capabilities of Sector Field Inductively Coupled Plasma Mass Spectrometry (SF-ICP-MS) and Particle Induced Gamma-ray Emission (PIGE) methods for determining the 11B/10B isotope ratio in boron carbide samples (B4C) are presented. The following nuclear reactions excited by protons on the stable boron isotopes are considered: 10B(p,aγ)7Be, 10B(p,pγ)7Be and 11B(p,γ)12C. The optimum proton energy range was determined to be within 550 to 600 keV, while the energies of the induced gamma-radiation that can be used for quantitative estimation of the boron isotopes were 429 keV and 4439 keV for the isotopes 10B and 11B, respectively. Considering the uncertainties of measurements, the data for the 11B/10B isotope ratios, measured by the SF‑ICP‑MS and PIGE methods, are found to correlate with each other; yet they are characterized by a systematic bias. The uncertainty of measurements by the PIGE method was somewhat higher in comparison with SF-ICP-MS, and ranged from ± 4.1 % to ± 4.3 %, and from ± 1.1 % to ± 3.5 %, respectively.
APA, Harvard, Vancouver, ISO, and other styles
41

Sada, Pedro V., and Felipe G. Ramón-Fox. "Exoplanet Transits Registered at the Universidad de Monterrey Observatory. I. HAT-P-12b, HAT-P-13b, HAT-P-16b, HAT-P-23b, and WASP-10b." Publications of the Astronomical Society of the Pacific 128, no. 960 (January 18, 2016): 024402. http://dx.doi.org/10.1088/1538-3873/128/960/024402.

Full text
APA, Harvard, Vancouver, ISO, and other styles
42

Rendsburg, Gary. "PSALM CXVI 14B, 18B." Vetus Testamentum 53, no. 3 (2003): 328–36. http://dx.doi.org/10.1163/156853303768266326.

Full text
APA, Harvard, Vancouver, ISO, and other styles
43

Daniel, Philip B., Chathurini Fernando, C. S. Jenny Wu, Rebecca Marnane, Ric Broadhurst, and Kathleen G. Mountjoy. "1kb of 5′ flanking sequence from mouse MC4R gene is sufficient for tissue specific expression in a transgenic mouse." Molecular and Cellular Endocrinology 239, no. 1-2 (July 2005): 63–71. http://dx.doi.org/10.1016/j.mce.2005.03.013.

Full text
APA, Harvard, Vancouver, ISO, and other styles
44

Hřebabecký, Hubert, and Antonín Holý. "Synthesis of Carba Analogues of 2'-Deoxy-4'-C-(hydroxymethyl)nucleosides." Collection of Czechoslovak Chemical Communications 64, no. 9 (1999): 1485–96. http://dx.doi.org/10.1135/cccc19991485.

Full text
Abstract:
Racemic dimethyl 2-hydroxy-4-[5-methyl-2(1H),4(3H)-dioxopyrimidin-1-yl]- (7a and 8a) and dimethyl 4-(6-aminopurin-9-yl)-2-hydroxycyclopentane-1,1-dicarboxylates (7b and 8b) were prepared by addition of sodium salt of thymine and adenine, respectively, to dimethyl (Z)-(4-oxobut-2-en-1-yl)malonate (1). Reduction of the diesters with sodium borohydride in methanol in the presence of sulfuric acid gave corresponding racemic 2,2-bis(hydroxymethyl)-4-[5-methyl-2(1H),4(3H)-dioxopyrimidin-1-yl]- (14a and 15a), 4-(6-aminopurin- 9-yl)-2,2-bis(hydroxymethyl)cyclopentan-1-ol (14b and 15b), methyl (±)-cis-2-hydroxy- 1-hydroxymethyl-4-[5-methyl-2(1H),4(3H)-dioxopyrimidin-1-yl]- (13a), and methyl (±)-cis-4-(6-aminopurin-9-yl)-2-hydroxy-1-hydroxymethylcyclopentan-1-carboxylate (13b), respectively.
APA, Harvard, Vancouver, ISO, and other styles
45

Ren, Jingwen, and Mark J. P. Chaisson. "lra: A long read aligner for sequences and contigs." PLOS Computational Biology 17, no. 6 (June 21, 2021): e1009078. http://dx.doi.org/10.1371/journal.pcbi.1009078.

Full text
Abstract:
It is computationally challenging to detect variation by aligning single-molecule sequencing (SMS) reads, or contigs from SMS assemblies. One approach to efficiently align SMS reads is sparse dynamic programming (SDP), where optimal chains of exact matches are found between the sequence and the genome. While straightforward implementations of SDP penalize gaps with a cost that is a linear function of gap length, biological variation is more accurately represented when gap cost is a concave function of gap length. We have developed a method, lra, that uses SDP with a concave-cost gap penalty, and used lra to align long-read sequences from PacBio and Oxford Nanopore (ONT) instruments as well as de novo assembly contigs. This alignment approach increases sensitivity and specificity for SV discovery, particularly for variants above 1kb and when discovering variation from ONT reads, while having runtime that are comparable (1.05-3.76×) to current methods. When applied to calling variation from de novo assembly contigs, there is a 3.2% increase in Truvari F1 score compared to minimap2+htsbox. lra is available in bioconda (https://anaconda.org/bioconda/lra) and github (https://github.com/ChaissonLab/LRA).
APA, Harvard, Vancouver, ISO, and other styles
46

Mahmoud, Mahmoud A. Abdelaziz, Rafat M. Mohareb, and Meshari A. Al-Sharif. "Heterocyclization of Thiophenes Derived from Estrone Followed by Cytotoxic, HTRF Kinase and Pim-1 Kinase Evaluations." Anti-Cancer Agents in Medicinal Chemistry 18, no. 12 (January 29, 2019): 1711–28. http://dx.doi.org/10.2174/1871520618666180507141045.

Full text
Abstract:
Background: A wide range of heterocyclic steroidal derivatives gained a special attention due to their wide range of pharmacological activities especially the therapeutic activities. Many pharmacological drugs containing the steroid nucleus are known in the market. Objective: Our main aim of this work was to synthesise a series of heterocyclic compounds especially thiophene and thienopyridine derivatives containing the estrone nucleus. The synthesized compounds posses antitumor and kinases inhibitions. Method: Thiophene derivatives of estrone were synthesized and used for further heterocyclization reactions through the reaction with the different reagent. Results: Antiproliferative evaluations and c-Met kinase, Pim-1 kinase inhibitions were performed where some compounds revealed high activities. Conclusion: Compounds that showed high antiproliferative activity and c-Met- kinase inhibitions were tested for all compounds. The most promising compounds 3b, 5c, 6c, 8d, 8f, 13e, 13f, 18b and 20d were further investigated against tyrosine kinase (c-Kit, Flt-3, VEGFR-2, EGFR, and PDGFR). Compounds 6b, 13b, 16b and 16c were selected to examine their Pim-1 kinase inhibition activity where compounds 11c, 18b and 20f showed high activities. Structure-Activity Relationship (SAR) was rationalized by looking at the varying structural features of the molecules.
APA, Harvard, Vancouver, ISO, and other styles
47

Benichel, Cariston Rodrigo, Silmara Meneguin, Camila Fernandes Pollo, Mariele Gobo Oliveira, and Cesar de Oliveira. "Psychometric Properties of the Brazilian Version of the Quality of Dying and Death for Adult Family Members of ICU Patients." International Journal of Environmental Research and Public Health 20, no. 6 (March 13, 2023): 5034. http://dx.doi.org/10.3390/ijerph20065034.

Full text
Abstract:
Death is a complex, subjective phenomenon that requires an understanding of experiences to be qualified to provide care during the end-of-life process. This study aimed to analyze the psychometric properties of the Portuguese version (Brazil) of the Quality of Dying and Death (QODD) scale on family members of patients who died in adult intensive care units. A methodological study was conducted with 326 family members of patients that died in three ICUs of public hospitals in the state of São Paulo, Brazil. For this study, the QODD 3.2a (25 items and six domains) was administered during the period from December 2020 to March 2022. The analysis was performed using the classic theory of the tests and the goodness of fit of the model was tested using confirmatory factor analysis. We have used Spearman’s correlation coefficients between the scores of the overall scale and domains. Cronbach’s alpha coefficient and the intraclass correlation coefficient (ICC) were used for the evaluation of internal consistency and temporal stability, respectively. The Horn’s parallel analysis indicated two factors that were not confirmed in the exploratory factor analysis. A single factor retained 18 of the initial 25 items and the analysis of the goodness of fit to the unidimensional model resulted in the following: CFI = 0.7545, TLI = 0.690, chi-squared = 767.33, df = 135, RMSEA = 0.121 with 90%CI, and p = 5.04409. The inter-item correlations indicated a predominance of weak correlations among the items of the instrument. The items with the largest number of moderate correlations were questions 13b, 9b, and 10b and a strong correlation was found between questions 15b and 16b. Cronbach’s alpha coefficient was 0.8 and the ICC was 0.9. The Quality of Dying and Death—Version 3.2a (intensive therapy) in Brazilian Portuguese has a unidimensional structure and acceptable reliability. However, it did not obtain a good fit to the proposed factorial model.
APA, Harvard, Vancouver, ISO, and other styles
48

Pattiram, Parveen Devi, Baskaran Gunasekaran, and Norazah Bt Mohammad Nawawi. "Identification of Bacteria from Soil of Cameron Highlands." Asian Journal of Plant Biology 2, no. 2 (December 30, 2014): 39–47. http://dx.doi.org/10.54987/ajpb.v2i2.187.

Full text
Abstract:
The bacteria are a large group of unicellular microorganisms. Bacteria are ubiquitous in everyhabitat on Earth for example growing in soil, radioactive waste, water and as well as in organicmatter and the live bodies of plants and animals. They are small cells, found in the environmentas either individual cells or aggregated together as clumps. This study was aimed to identify thebacteria from soil sample obtained from Cameron Highlands. Eight samples were inoculated onNutrient Agar plate. After obtaining pure culture, stock cultures on Nutrient Agar slant andglycerol stock were prepared and the samples were kept in -20ËšC. Next the samples werefurther studied using microscopic observation. From this technique, seven Gram positivebacteria and one Gram negative bacteria were obtained. The Gram positive rod shaped wasanalyzed further using the molecular technique 16S rDNA using pA and pH primers. Then thesample proceeds to bulk. PCR product of approximately 1kb in size was obtained. The purityvalue of the DNA sample obtained was 1.16 A260/280. The sample was sent for sequencing toNHK Bioscience and Macrogreen (Korea). Only one sample showed positive for 16S rDNAfragments which were analyzed using Basic Local Alignment Search Tool (BLAST) forbacterial identification. The data analysis of the sequence shows that the bacterium obtainedwas Bacillus pumilus strain.
APA, Harvard, Vancouver, ISO, and other styles
49

XIE, MINZHU, JIANXIN WANG, and JIANER CHEN. "A practical parameterised algorithm for the individual haplotyping problem MLF." Mathematical Structures in Computer Science 20, no. 5 (October 2010): 851–63. http://dx.doi.org/10.1017/s096012951000023x.

Full text
Abstract:
Haplotypes are more useful in complex disease gene mapping than single-nucleotide polymorphisms (SNPs). However, haplotypes are difficult to obtain directly using biological experiments, which has prompted research into efficient computational methods for determining haplotypes. The individual haplotyping problem called Minimum Letter Flip (MLF) is a computational problem that, given a set of aligned DNA sequence fragment data of an individual, induces the corresponding haplotypes by flipping minimum SNPs. There has been no practical exact algorithm for solving the problem. Due to technical limits in DNA sequencing experiments, the maximum length of a fragment sequenced directly is about 1kb. In consequence, with a genome-average SNP density of 1.84 SNPs per 1 kb of DNA sequence, the maximum number k1 of SNP sites that a fragment covers is usually small. Moreover, in order to save time and money, the maximum number k2 of fragments that cover an SNP site is usually no more than 19. Building on these fragment data properties, the current paper introduces a new parameterised algorithm with running time O(nk22k2 + mlogm + mk1), where m is the number of fragments and n is the number of SNP sites. In practical biological applications, the algorithm solves the MLF problem efficiently even if m and n are large.
APA, Harvard, Vancouver, ISO, and other styles
50

Hà, Nguyễn Thị Minh, Lê Thị Phương, Đào Nguyễn Hà Linh, Nguyễn Hoàng Việt, Phạm Lê Anh Tuấn, Đinh Thuý Linh, and Trần Vân Khánh. "Xác định đột biến xóa đoạn gen RB1 ở bệnh nhân u nguyên bào võng mạc bằng phương pháp MLPA." Tạp chí Nghiên cứu Y học 169, no. 8 (September 20, 2023): 1–7. http://dx.doi.org/10.52852/tcncyh.v169i8.1843.

Full text
Abstract:
U nguyên bào võng mạc (Retinoblastoma - UNBVM) là bệnh ung thư ác tính ở mắt thường gặp ở trẻ em dưới 5 tuổi, gây ra bởi đột biến trên gen RB1. Bệnh xảy ra ở hai dạng: dạng ngẫu nhiên và dạng gia đình. Bệnh gây ra những tổn thương nghiêm trọng về mắt, có thể dẫn đến khoét bỏ mắt, di căn và tử vong bởi nhiều kiểu đột biến gen RB1 khác nhau, trong đó khoảng 20% số trường hợp có mất đoạn lớn hơn 1kb và 30% có mất đoạn nhỏ hơn hay lặp đoạn. Hiện nay, kỹ thuật MLPA là phương pháp được ưu tiên chọn lựa trong chẩn đoán đột biến xóa đoạn lớn, lặp đoạn với độ chính xác cao và cho kết quả nhanh chóng. Nghiên cứu được thực hiện trên mẫu máu ngoại vi và mẫu mô của 20 bệnh nhân u nguyên bào võng mạc nhằm phát hiện các đột biến tế bào mầm di truyền và đột biến soma bằng kỹ thuật MLPA. Kết quả đã phát hiện 2/20 bệnh nhân (10%) có đột biến xóa đoạn dị hợp tử toàn bộ gen RB1 trên cả mẫu máu và mẫu mô.
APA, Harvard, Vancouver, ISO, and other styles
We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!

To the bibliography