Um die anderen Arten von Veröffentlichungen zu diesem Thema anzuzeigen, folgen Sie diesem Link: Wheat Diseases and pests Cultural control.
Zeitschriftenartikel zum Thema „Wheat Diseases and pests Cultural control“
Geben Sie eine Quelle nach APA, MLA, Chicago, Harvard und anderen Zitierweisen an
Machen Sie sich mit Top-50 Zeitschriftenartikel für die Forschung zum Thema "Wheat Diseases and pests Cultural control" bekannt.
Neben jedem Werk im Literaturverzeichnis ist die Option "Zur Bibliographie hinzufügen" verfügbar. Nutzen Sie sie, wird Ihre bibliographische Angabe des gewählten Werkes nach der nötigen Zitierweise (APA, MLA, Harvard, Chicago, Vancouver usw.) automatisch gestaltet.
Sie können auch den vollen Text der wissenschaftlichen Publikation im PDF-Format herunterladen und eine Online-Annotation der Arbeit lesen, wenn die relevanten Parameter in den Metadaten verfügbar sind.
Sehen Sie die Zeitschriftenartikel für verschiedene Spezialgebieten durch und erstellen Sie Ihre Bibliographie auf korrekte Weise.
1
Ba-Angood, S. A. „Control of cereal aphids on wheat in People's Democratic Republic of Yemen“. Insect Science and Its Application 6, Nr. 2 (April 1985): 221–25. http://dx.doi.org/10.1017/s1742758400006688.
Der volle Inhalt der QuelleAnnotation:
AbstractLoss estimates for wheat insects in Africa and Asia have not received adequate attention. However, in PDR of Yemen, pests including insects, diseases, weeds and birds can cause 10™70% loss of wheat crop. Aphids are considered to be the major insect pests of wheat in the country. A survey of indigenous natural enemies has shown that they may contribute to overall aphid control. Sowing date experiments have shown that sowing in November led to higher yields and lower insect infestation than sowing in October and December. The insecticides tested achieved a significant control of aphids and higher yields when compared with unsprayed plots. A single application of malathion or dimethoate before mid-January was recommended for chemical control.
2
DĂRAB, Ionel Dragoş, Dana MALASCHI, Ana Maria VĂLEAN, Adina Daniela TĂRĂU, Cornel CHEŢAN und Ion OLTEAN. „Preliminary Research on the Wheat Pests and on Their Integrated Control during 2015-2016, at Agricultural Research-Development Station Turda“. Bulletin of University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca. Agriculture 74, Nr. 1 (19.05.2017): 1. http://dx.doi.org/10.15835/buasvmcn-agr:12652.
Der volle Inhalt der QuelleAnnotation:
In Transylvania, the evolution of wheat insect pests is strongly influenced by the ecotehnological conditions, by climate change and current technology (Malschi, 2009 Malschi et al., 2015). The paper presents the dynamics and importance of the main pests of wheat (thrips, aphids, leafhoppers, wheat flies, cereals sunbugs, investigated under the integrated pest control system suitable of the area. During 2015-2016, the investigations were conducted at the Agricultural Research and Development Station Turda, from the wheat no tillage cultural system with cereal rotation of three years and applying all zonal recommendations of technology and phytosanitary complex. The pest monitoring was performed based on the samples collected with entomological net, by decadal 100 sweep-net catches/sample. The study data shows the danger of the attack of abundant populations of wheat flies (Phorbia securis, Delia coarctata, Opomyza florum, Oscinella frit etc.; wheat fleas (Chaetocnema aridula) and cereal leaf beetle (Oulema melanopa); leafhoppers (Psammotettix alienus, Javesella pellucida, Macrosteles laevis); aphids (Sitobion avenae, Schizaphis graminum, Rhopalosiphum padi); thrips (Haplothrips tritici), sunbugs (Eurygaster maura, Aelia acuminata) etc., and the necessity of applying insecticide treatments on the vegetation.Since 2015, a stronger impact of global warming on the wheat pests structure (%) are found. This change began on the last ten years. The importance of cereal sunbugs is increasing, well as the importance of the wheat flies, aphids and leafhoppers, which requires professional study on the pest dynamics and adequate integrated control of wheat pests.
3
Wada, Akaamaa C. „Some Important Diseases and Pests of Sugarcane in Nigeria and Their Control“. Outlook on Agriculture 26, Nr. 2 (Juni 1997): 101–5. http://dx.doi.org/10.1177/003072709702600207.
Der volle Inhalt der QuelleAnnotation:
Sugarcane smut (Ustilagoscitaminea), red rot (Glomerellatucumanensis), sugarcane leaf blast (Paraphaeosphaeriamichotil). sugarcane mosaic virus (SCMV) and Curvularia leaf spot are the prevalent diseases of sugarcane in Nigeria today. Sugarcane pests of economic importance include the stemborers, termites and nematodes. These diseases and pests can be managed by cultural and chemical methods pending the development of resistant varieties. The problems caused to sugarcane growers in some states of Nigeria by these diseases and pests, and some palliative measures which are used to contain them, are discussed.
4
OERKE, E. C. „Crop losses to pests“. Journal of Agricultural Science 144, Nr. 1 (09.12.2005): 31–43. http://dx.doi.org/10.1017/s0021859605005708.
Der volle Inhalt der QuelleAnnotation:
Productivity of crops grown for human consumption is at risk due to the incidence of pests, especially weeds, pathogens and animal pests. Crop losses due to these harmful organisms can be substantial and may be prevented, or reduced, by crop protection measures. An overview is given on different types of crop losses as well as on various methods of pest control developed during the last century.Estimates on potential and actual losses despite the current crop protection practices are given for wheat, rice, maize, potatoes, soybeans, and cotton for the period 2001–03 on a regional basis (19 regions) as well as for the global total. Among crops, the total global potential loss due to pests varied from about 50% in wheat to more than 80% in cotton production. The responses are estimated as losses of 26–29% for soybean, wheat and cotton, and 31, 37 and 40% for maize, rice and potatoes, respectively. Overall, weeds produced the highest potential loss (34%), with animal pests and pathogens being less important (losses of 18 and 16%). The efficacy of crop protection was higher in cash crops than in food crops. Weed control can be managed mechanically or chemically, therefore worldwide efficacy was considerably higher than for the control of animal pests or diseases, which rely heavily on synthetic chemicals. Regional differences in efficacy are outlined. Despite a clear increase in pesticide use, crop losses have not significantly decreased during the last 40 years. However, pesticide use has enabled farmers to modify production systems and to increase crop productivity without sustaining the higher losses likely to occur from an increased susceptibility to the damaging effect of pests.The concept of integrated pest/crop management includes a threshold concept for the application of pest control measures and reduction in the amount/frequency of pesticides applied to an economically and ecologically acceptable level. Often minor crop losses are economically acceptable; however, an increase in crop productivity without adequate crop protection does not make sense, because an increase in attainable yields is often associated with an increased vulnerability to damage inflicted by pests.
5
Qi, Tuo, Jia Guo, Huan Peng, Peng Liu, Zhensheng Kang und Jun Guo. „Host-Induced Gene Silencing: A Powerful Strategy to Control Diseases of Wheat and Barley“. International Journal of Molecular Sciences 20, Nr. 1 (08.01.2019): 206. http://dx.doi.org/10.3390/ijms20010206.
Der volle Inhalt der QuelleAnnotation:
Wheat and barley are the most highly produced and consumed grains in the world. Various pathogens—viruses, bacteria, fungi, insect pests, and nematode parasites—are major threats to yield and economic losses. Strategies for the management of disease control mainly depend on resistance or tolerance breeding, chemical control, and biological control. The discoveries of RNA silencing mechanisms provide a transgenic approach for disease management. Host-induced gene silencing (HIGS) employing RNA silencing mechanisms and, specifically, silencing the targets of invading pathogens, has been successfully applied in crop disease prevention. Here, we cover recent studies that indicate that HIGS is a valuable tool to protect wheat and barley from diseases in an environmentally friendly way.
6
Belen, Mustafa, Dürdane Yanar und Gülistan Erdal. „Sivas İlinde Buğday Üretiminde Karşılaşılan Bitki Koruma Sorunlarının Belirlenmesi“. Turkish Journal of Agriculture - Food Science and Technology 8, sp1 (14.12.2020): 208–14. http://dx.doi.org/10.24925/turjaf.v8isp1.208-214.4114.
Der volle Inhalt der QuelleAnnotation:
Objective of this study is to determine plant protection problems which wheat growers encountered and their knowledge on plant protection in Sivas province. This study is carried out in the Central, Hafik, Ulas and Yıldızeli districts of Sivas province with 220 farmers. The problems which related to plant diseases, pests and weeds in wheat growers faced were also determined. Almost all farmers (99.09%) apply chemical control. Farmers decides the pesticide applications in their wheat growing areas according to own experience (84.09%), manufacturers recommendations (24.09%), the advice of agricultural experts (17.27%) and the advice of neighbours and friends (9.55%). Farmers mostly have been applying pesticides based on their own experiences. In recent years, pesticides are being used widely against diseases, pests and weeds. Some times over dose application of pesticides by farmers in judiciously resulted in environmental pollution, health problems. Also the natural enemies will be affected. Furthermore, in weed control farmers use herbicides against broad leaved weeds. It was determined that the farmers do not have knowledge about narrow leaved weeds and herbicides use against these weed species is limited. According to the results of this survey, it will be beneficial to provide training on plant protection to wheat producers in the region.
7
Beres, B. L., L. M. Dosdall, D. K. Weaver, H. A. Cárcamo und D. M. Spaner. „Biology and integrated management of wheat stem sawfly and the need for continuing research“. Canadian Entomologist 143, Nr. 2 (April 2011): 105–25. http://dx.doi.org/10.4039/n10-056.
Der volle Inhalt der QuelleAnnotation:
AbstractThe wheat stem sawfly, Cephus cinctus Norton (Hymenoptera: Cephidae), is historically one of the most important economic insect pests in the northern Great Plains of North America. Within this geographical region, the areas subjected to greatest attack are southern Alberta and Saskatchewan, southwestern Manitoba, eastern and northern Montana, North Dakota, northern South Dakota, and western Minnesota. Cumulative grain-yield losses and annual economic losses associated with this pest can exceed 30% and $350 million, respectively. Solid-stemmed cultivars of common wheat, Triticum aestivum L. (Poaceae), tolerant of infestation, are critical for C. cinctus management, but outbreaks of this pest continue to occur even after six decades of cultivar development. Furthermore, chemical control (a primary control option for other cereal (Poaceae) insect pests) has proven ineffective; this underscores the need to integrate resistant cultivars into a comprehensive integrated pest management program. We provide overviews of wheat stem sawfly biology, recent advances in applied research, the efficacy and integration of cultural and biological management strategies, and future directions for global research activities to manage wheat stem sawfly.
8
Horrocks, A., M. M. Davidson, D. A. J. Teulon und P. A. Horne. „Demonstrating an integrated pest management strategy in autumnsown wheat to arable farmers“. New Zealand Plant Protection 63 (01.08.2010): 47–54. http://dx.doi.org/10.30843/nzpp.2010.63.6567.
Der volle Inhalt der QuelleAnnotation:
Six crops of autumnsown wheat managed under integrated pest management (IPM) were compared to six adjacent crops grown under the participating farmers current pest management practices in demonstration trials in Canterbury during the 200809 and 200910 seasons Farmer training with a focus on monitoring and beneficial predator identification was carried out The presence and abundance of key pests and diseases (slugs aphids yellow dwarf virus (YDV)) and beneficial predators was determined Carabid beetles and other beneficial insects capable of contributing to pest control were present in the arable cropping systems There was an increasing trend in the number of beneficial organisms a reduction in pests and a 50 reduction in the number of insecticides applied in the IPM managed crops There were negligible YDV and crop yield differences between the two approaches IPM adoption at these farms was very high after these participatory trials
9
Zhang, Songchao, Baijing Qiu, Xinyu Xue, Tao Sun, Wei Gu, Fuliang Zhou und Xiangdong Sun. „Effects of Crop Protection Unmanned Aerial System Flight Speed, Height on Effective Spraying Width, Droplet Deposition and Penetration Rate, and Control Effect Analysis on Wheat Aphids, Powdery Mildew, and Head Blight“. Applied Sciences 11, Nr. 2 (13.01.2021): 712. http://dx.doi.org/10.3390/app11020712.
Der volle Inhalt der QuelleAnnotation:
As a new type of crop protection machinery, the Crop Protection Unmanned Aerial System (CPUAS) has developed rapidly and been widely used in China; currently, how to use the CPUAS scientifically has become a top priority. However, the relationships between the operating parameters of the CPUAS and the effective spraying width (ESW), droplet distribution characteristics, and control effects of insect pests and diseases are not clear yet. Therefore, three levels of flight speed (FS) as 3, 4, and 5 m/s, three levels of flight height (FH) as 1.5, 2.0, and 2.5 m, and spraying volume 2.0 L/min experiments were carried out to investigate the effects of FS and FH on the ESW, droplet deposition uniformity (DDU), and droplet penetration rate (DPR) by using an electric single-rotor CPUAS CE20. Based on the obtained results, combined with the insect pests and diseases occurrence agronomic laws, the optimal operation parameters of the CPUAS were selected to control the wheat aphids, powdery mildew, and head blight. The results showed that the ESW of CE20 was not consistent, the maximum value was 5.78 m, and the minimum one was 2.51 m. The FS had a highly significant impact on ESW (p = 0.0033 < 0.01), while the FH and the interaction between FS and FH had no significant impact on ESW. The coefficients of variation (CV) of the droplet deposition were between 23.3% and 34.4%, which meant good deposition uniformity. The FH (p = 0.0019) and the interaction between FS and FH (p = 0.02) had significant impacts on the DDU. The control effects on aphids were 78.71% (1 day), 84.88% (3 days), and 90.42% (7 days), the control effects on powdery mildew were 77.17% (7 days) and 82.83% (14 days), and the control effect on head blight was 88.32% (20 days). This study proved that by the optimization of parameters and the combination of agronomy, good control effects for insect pests and diseases could be achieved by the CPUAS. The research results would provide some technical supports for CPUAS application.
10
Rasche, Livia. „Estimating Pesticide Inputs and Yield Outputs of Conventional and Organic Agricultural Systems in Europe under Climate Change“. Agronomy 11, Nr. 7 (26.06.2021): 1300. http://dx.doi.org/10.3390/agronomy11071300.
Der volle Inhalt der QuelleAnnotation:
Simulating organic agriculture is a considerable challenge. One reason is that few models are capable of simulating crop-pest interactions and the yield losses they cause. Here, a recently developed process-based crop-pest model (Pest-EPIC) was used to simulate conventional and organic agriculture in the European Union for the years 1995–2100. Yields and pesticide application rates were calibrated against FAOSTAT and Eurostat data. Results indicate that current pesticide application rates may be sufficient to control pests and diseases even at the end of the century. The range of simulated yield differences under organic and conventional agriculture under current conditions (e.g., wheat 21–55% (mean 34%) lower yields; potatoes 20–99% (mean 56%) lower yields) closely matched recorded values. Under climate change, the gap between yields under conventional and organic management will remain constant for some crops (e.g., at 3 t/ha for potatoes), but others—susceptible to a larger number of pests and diseases—may experience a widening of the yield gap (e.g., increase of yield difference from 0.8 to 1.6 t/ha for wheat). The presented results-dataset may in future be a valuable resource for integrated assessments of agricultural land use and policy planning, but the inherent uncertainty is still very high.
11
Brussaard, L. „Current perspectives on integrated control of some soil-borne diseases and pests of potato in the Netherlands.“ Netherlands Journal of Agricultural Science 34, Nr. 3 (01.08.1986): 263–71. http://dx.doi.org/10.18174/njas.v34i3.16780.
Der volle Inhalt der QuelleAnnotation:
The current status and prospects of biological control methods and the application of certain crop varieties and cultural methods to prevent and control yield depressions and some soil-borne diseases, including Pseudomonas and Rhizoctonia solani, and nematodes (Globodera spp.) of potato in the Netherlands are evaluated. (Abstract retrieved from CAB Abstracts by CABI’s permission)
12
Prymak, I. D., O. M. Yakovenko, M. V. Voytovyk, V. M. Karaulna, L. V. Yezerkovska, O. B. Panchenko, Yu V. Fedoruk, I. A. Pokotylo und I. A. Panchenko. „Effect of soil treatment on pest infestation and crop disease distribution in black soil fields with short rotation crops“. Ukrainian Journal of Ecology 10, Nr. 1 (10.02.2020): 127–32. http://dx.doi.org/10.15421/2020_20.
Der volle Inhalt der QuelleAnnotation:
We have established the influence of four tillage systems on pest distribution and development of diseases in cultivated cereals during three-year research (2017-2019) in the field stationary of the Bila Tserkva National Agrarian University, Ukraine (chernozem grain sprouting with five-course rotation). The population of turnip moth in winter wheat, spring barley, and soya was the highest under application of disk tillage, the lowest – under moldboard tillage. The moldboard treatment limited while the beardless and disk treatments stimulate the development of beet webworm in the cereal crops. The number of pests in soya, winter wheat, spring barley, and maize was higher under combined soil treatment compared to moldboard. We recorded no significant difference in pests towards tillage systems in sunflower crops. In soya, winter wheat and maize crops, the number of wireworm was significantly higher in molded than in molded cultivation; the opposite pattern was observed in the sunflower field, while for spring barley these values were at the same level. The distribution and development of root rot in cereal crops was higher in comparison with control, but this difference was insignificant in spring barley. The development of powdery mildew in spring barley crops was almost the same for these tillage options. In cereal crops, septoriosis lesions were almost at the same level in case of moldboard and combined tillage. Significant deterioration of phytosanitary condition at beardless and disk tillage resulted in significant reduction of crop rotation productivity in comparison with control. In the fields with combined and disk treatments, the productivity value was almost the same.
13
Otambekova, Munira, Bahriddin Solihov, Bahromiddin Husenov und Hafiz Mumindzhanov. „LIMITATIONS AND PROSPECTS FOR SUSTAINABLE INCREAYIELD IN TAJIKISTAN SE OF WHEAT“. Vestnik of Kazan State Agrarian University 15, Nr. 3 (30.11.2020): 31–36. http://dx.doi.org/10.12737/2073-0462-2020-31-36.
Der volle Inhalt der QuelleAnnotation:
Wheat is a major crop with a key role for food security in Tajikistan. A clear understanding of the major constraints and opportunities relating to wheat production and sustainability in farmers’ fields is therefore required. Monitoring of pests, diseases and weeds in the wheat fields of different sizes, located in different agricultural zones in Tajikistan and at different altitudes, was conducted during (2003–2016). A questionnaire on wheat production and sustainability, seeking overall information about farms and specific data on crop management practices, was applied. The results showed that the agronomic knowledge of Tajik farmers was generally poor and that wheat yield was low, affecting social, economic, and environmental sustainability. The farms surveyed were generally small, growing winter wheat for human consumption year after year. Seeds were hand-broadcast at the optimal sowing time, without chemical treatments and either wheat or technical crops were used as preceding crops. The low knowledge status of wheat farmers influenced crop performance and were correlated with lack of crop rotation, while the lack of pest management resulted in high levels of weeds and severe insect damage. Wheat production on small farms still relied heavily on manual labor, while larger farms used more machinery. Most of the Tajik wheat varieties and lines screened were found to be susceptible to at least one of the diseases screened for, i.e., stripe rust, leaf rust, and common bunt. Our findings demonstrate a need for concerted action to overcome wheat yield constraints and achieve sustainabшlity in crop production in Tajikistan. Education of farmers appears key to improving social, economic, and environmental sustainability. Use of certified seed of suitable wheat varieties and appropriate crop management practices, including weed control while also taking biodiversity into consideration, are other important measures for increasing wheat yield and improving sustainability
14
Cook, R. James. „Biological control and holistic plant-health care in agriculture“. American Journal of Alternative Agriculture 3, Nr. 2-3 (1988): 51–62. http://dx.doi.org/10.1017/s0889189300002186.
Der volle Inhalt der QuelleAnnotation:
AbstractBiological control is defined broadly as the “use of natural or modified organisms, genes, or gene products” to reduce the effects of pests and diseases. Physical control is the use of tillage, open-field burning, heat-treatment (pasteurization), and other physical methods, usually to eliminate pests or separate them from the crop. Chemical control is the use of synthetic chemical pesticides to eliminate pests or reduce their effects. The many approaches to biological control can be categorized conceptionally into 1) regulation of the pest population (the classical approach), 2) exclusionary systems of protection (a living barrier of microorganisms on the plant or animal that deters infection or pest attack), and 3) systems of self-defense (resistance and immunization). The agents of biological control include the pest- or disease-agent itself (sterile males or avirulent strains of pathogens), antagonists or natural enemies, or the plant or animal managed or manipulated (immunized) to defend itself. The methods range from 1) conserving and making maximum use of indigenous (resident) biological control through cultural practices, 2) making one-time or occasional introductions of genes or natural enemies that are more or less self-sustaining and 3) making repeated introductions of a biocontrol agent (e.g. a microbial pesticide). Biological, physical, and chemical treatments and pest controls can be integrated into holistic plant-health care also known as integrated crop and pest management. Eight principles of plant health care are offered: 1) know the production limits of the agroecosystem; 2) rotate the crops; 3) maintain soil organic matter; 4) use clean planting material; 5) plant well-adapted, pest-resistant cultivars; 6) minimize environmental and nutritional stresses; 7) maximize the effects of beneficial organisms; and 8) protect with pesticides as necessary.
15
Rivers, Ariel, Christina Mullen, John Wallace und Mary Barbercheck. „Cover crop-based reduced tillage system influences Carabidae (Coleoptera) activity, diversity and trophic group during transition to organic production“. Renewable Agriculture and Food Systems 32, Nr. 6 (10.01.2017): 538–51. http://dx.doi.org/10.1017/s1742170516000466.
Der volle Inhalt der QuelleAnnotation:
AbstractOrganic grain growers rely on cultural practices and biological control to regulate pests, and the implementation and timing of cultural practices can affect many characteristics of the cropping system as a habitat for natural enemies of arthropod pests. Ground beetles (Coleoptera: Carabidae) in particular are important insect and weed-seed predators, and are sensitive to crop rotations, tillage and environmental complexity. In a reduced tillage system in transition to organic management, we evaluated the effect of cover crop species and termination date, crop rotation and high residue cultivation on ground and tiger beetle (Coleoptera: Carabidae) activity-density, community composition and size and trophic groups. The 3-year experiment included a sequence of corn (Zea maysL.), soybean (Glycine max(L.) Merr.) and winter wheat (Triticum aestivumL.). A mixture of hairy vetch (Vicia villosaRoth) and triticale (xTriticosecaleWittmack) preceded corn, and cereal rye (Secale cerealeL.) preceded soybean, and each crop sequence was present in each year (full-entry). We compared three cover crop termination (and cash crop planting) dates by terminating the overwintered cover crops with a roller-crimper, and immediately or soon after, we no-till planted corn and soybean through the mat created by the rolled cover crops. In the corn and soybean phases of the rotation, we also compared inter-row cultivation as a pest management strategy to a control treatment (no inter-row cultivation in corn, and an alternative row-spacing in soybean). Wheat was planted on a single date in each year into tilled soil. Carabids were sampled using pitfall traps 2 weeks after termination of the two cover crop treatments, and in mid-June in wheat. Carabid activity-density and species richness increased across the experimental site during the 3-year transition, and community evenness across the experimental site increased by the third year. Crop species influenced carabid community composition, and by the third year, the carabid community was comparable between wheat and hairy vetch-triticale cover crop. The late cover crop termination date was positively associated with higher activity-densities of large carabids in rolled hairy vetch-triticale and rolled cereal rye; carnivorous beetles in rolled hairy vetch-triticale; and granivorous beetles in rolled cereal rye. Inter-row cultivation occurring in corn and soybean resulted in a significantly higher proportion of small beetles in the wheat phase of the rotation, with a significantly higher proportion of large beetles in wheat treatments, which had not received inter-row cultivation in corn and soybean. Results have strong implications for management during the transition to organic, including the importance of plant residue, reduced tillage and timing of cover crop termination dates for augmenting carabid populations.
16
Shabolkina, E. N., L. K. Neshcheret, N. V. Anisimkina, O. V. Shuvalova und M. V. Belyaeva. „THE EFFECT OF SEEDBED TREATMENT BY THE PROTECTING PREPARATIONS AND MINERAL FERTILIZERS ON SEED QUALITY“. Grain Economy of Russia, Nr. 4 (23.08.2018): 11–14. http://dx.doi.org/10.31367/2079-8725-2018-58-4-11-14.
Der volle Inhalt der QuelleAnnotation:
Soil fertility decrease, economic and organizational factors reduce the valuable qualities of the varieties, and therefore the preventive measures that prevent deterioration of the variety are of great importance. Seedbed treatment, such as disinfection of seeds with the preparations that have a healing effect from various diseases, soil pests and air-thermal treatment of seeds, application of mineral fertilizers are important measures necessary for effective seed production. Long-term studies conducted on experimental and industrial plots of the Samara RIA have established that seed disinfection with the preparations of systemic action ‘ScenicCombi’, ‘Lamador KS’, ‘Ranazol Ultra KS’ is the most effective. There has been estimated the effect of spring solar heating of seeds by warm atmospheric air, promoting their awakening, exit from ‘secondary dormancy’ and germination increase. There has been noted a positive effect of the full fertilizer on the sowing and yielding qualities of the seeds. There have been determined the optimal doses of fertilizers N30P30K30, N45P45K45 for seed production of winter wheat, spring wheat and barley with the best yielding properties (on 6.2–7.4% in comparison with the control).
17
Alghali, A. M., und D. E. Pratt. „Utilisation of farmers' practices and perceptions in the formulation of pest management strategies for cowpea production in southern Sierra Leone“. Insect Science and Its Application 16, Nr. 1 (März 1995): 103–8. http://dx.doi.org/10.1017/s1742758400018385.
Der volle Inhalt der QuelleAnnotation:
AbstractSurvey questionnaires were administered to 50 farmers in three chiefdoms in the Moyamba District of southern Sierra Leone. The study was undertaken to gain insight into the indigenous farming practices for cowpea with emphasis on pest management. This is to serve as a guide in drawing up a research agenda and identifying appropriate measures for the control of cowpea pests. Farm sizes were generally small, usually less than 2 ha of intercropped cowpea. This suggests that the farmers were mostly subsistent and would require low cost inputs to boost production. Vertebrate and insect pests were identified by the farmers as limiting cowpea grain production. Insect pests were considered more serious than vertebrates. Pest control was mostly traditional and involved cultural measures such as weeding of plots, fencing, trapping and scaring of birds. These may be inefficient and labour intensive. Varieties planted by the farmers were mostly land races that have low yield potential and lack some other desirable agronomic character like semi-erectness and bold seeds. Selection criteria in breeding programmes should incorporate farmers' preferences which include high yields, sweet taste, resistance to pests and diseases, compatibility with the farming systems and acceptable seed appearance that would enhance marketing. The study further revealed that at present cowpea is grown mostly as a secondary crop. Therefore, introduced pest control efforts would have to be cheap, easy to adopt and integrative. These would include:(a) education on control options hitherto unknown to the farmers;(b) identifying and developing effective strategies that are low cost, labour insensitive, environmentally friendly and compatible with the socioculturel background of the farming community; and(c) creating awareness on the necessity for the inputs to be readily available and affordable at the local government level.
18
Munareto, Janete Denardi, Thomas Newton Martin, Tania Maria Müller, Ubirajara Russi Nunes, Guilherme Bergeijer da Rosa und Luiz Fernando Teleken Grando. „Compatibility of Azospirillum brasilense with fungicide and insecticide and its effects on the physiological quality of wheat seeds“. Semina: Ciências Agrárias 39, Nr. 2 (15.03.2018): 855. http://dx.doi.org/10.5433/1679-0359.2018v39n2p855.
Der volle Inhalt der QuelleAnnotation:
Seed treatment is a practice that helps the initial establishment of the crop without the effects caused by pests and diseases. The association of diazotrophic bacteria with grasses has been used in the supply of nitrogen to plants; however, these microorganisms produce growth-promoting substances, which promote benefits in the growth and development of the crops. Thus, the objective of this study was to evaluate the compatibility of Azospirillum brasilense associated with the fungicide difenoconazole and the insecticide thiamethoxam by observing the effects on the quality of seed emergence of three wheat cultivars (Triticum aestivum L.). Three wheat cultivars, arranged in a 4 x 2 factorial system with four replicates, were tested. The treatments were the control; difenoconazole (Spectro® at a dose of 150 mL per 100 kg of seed); thiamethoxam (Cruiser® FS 350 at a dose of 200 mL per 100 kg seed) and difenoconazole + thiamethoxam, applied on wheat cultivars TBIO Mestre, TBIO Itaipu and TBIO Sinuelo. Bacteria from the Azospirillum genus were used in the inoculation. The wheat seed retains its quality when it checks the germination, vigor and independent accelerated aging, whether or not fungicide, insecticide and A. brasilense were used. The insecticide thiamethoxam increased the length of shoots and roots and provided compatibility with A. brasilense, and fungicide inhibited the length of shoots and roots and was antagonistic to the bacterium A. brasilense.
19
Beljaev, V. I., V. V. Vol'nov, L. V. Sokolova, V. N. Kuznecov und A. V. Matsyura. „Effect of sowing techniques on the agroecological parameters of cereal crops“. Ukrainian Journal of Ecology 7, Nr. 2 (28.05.2017): 130–36. http://dx.doi.org/10.15421/2017_30.
Der volle Inhalt der QuelleAnnotation:
<p>In Western Siberia, the problem of obtaining full-fledged sprouts of cereal crops is due to hydrothermal conditions in the period of sowing-shoots, pests and diseases, and agronomical methods of sowing. In case of the direct sowing of cereal crops, the most common types of working organs of sowing machines are the V-sharped coulter, chisel and disc. The effectiveness of their use in the dry steppe of the Altai Territory has been poorly studied. To establish the most effective seed coulter in 26 farms in the dry part of the region, the studies were carried out from 2005 to 2012 on seeders with double disc coulters, with V-sharped coulters of domestic and foreign production, and with chisel-type coulters. The years of research (2006-2011) were characterized by a moisture supply below the average (vegetation rainfall was 80% of the norm), and in 2012 - as an acute drought (40% of the norm). The most effective seeders in the cultivation of spring wheat in the dry steppe are seeders equipped with chisel-type coulters. They allow better preservation of soil moisture (by 17-28 mm to control) during the sowing period, improving the quality of crops, field germinating by 4.8 - 12.0%, and increasing the yield of wheat. In the arid year of 2012, it amounted to 1.26 t/ha after fallow, 0.88 t/ha after peas, 0.46 t/ha after wheat, respectively, at 0.64, 0.59 and 0.25 t/ha for control (two-disc coulter SZP-3,6). Seeders with V-sharped coulters of domestic and foreign production, for wheat yields did not differ significantly, but exceeded the control under the conditions of the arid year by 0.21-0.59 t/ha, depending on the forecrop.</p><p> </p>
20
Goldman, Abe. „Pest and Disease Hazards and Sustainability in African Agriculture“. Experimental Agriculture 32, Nr. 2 (April 1996): 199–211. http://dx.doi.org/10.1017/s0014479700026107.
Der volle Inhalt der QuelleAnnotation:
SUMMARYSurveys of the relationship between pests and diseases and crop sustainability in several areas of Kenya, Nigeria, and other regions of Africa indicate that the production of numerous crops has declined sharply as a result of major pest and disease outbreaks, and others are threatened with major decline because of a surge in virulence of an endemic pest or disease, the introduction of a virulent exotic pest or pathogen, or because a system of control used previously has collapsed. Many of the crops that have declined were already experiencing reduced economic demand. In other cases, crop sustainability has been preserved by vigorous farmer responses or by the intervention of national and international research institutions. Most pests and pathogens, however, remain within tolerable bounds most of the time, though this often requires the use of chemical or cultural controls, or the availability of adequate land to compensate for losses. As land availability declines, more strenuous management efforts may be needed to sustain productivity.
21
Jacobsen, B. J., N. K. Zidack und B. J. Larson. „The Role of Bacillus-Based Biological Control Agents in Integrated Pest Management Systems: Plant Diseases“. Phytopathology® 94, Nr. 11 (November 2004): 1272–75. http://dx.doi.org/10.1094/phyto.2004.94.11.1272.
Der volle Inhalt der QuelleAnnotation:
Bacillus-based biological control agents (BCAs) have great potential in integrated pest management (IPM) systems; however, relatively little work has been published on integration with other IPM management tools. Unfortunately, most research has focused on BCAs as alternatives to synthetic chemical fungicides or bactericides and not as part of an integrated management system. IPM has had many definitions and this review will use the national coalition for IPM definition: “A sustainable approach to managing pests by combining biological, cultural, physical and chemical tools in a way that minimizes economic, health and environmental risks.” This review will examine the integrated use of Bacillus-based BCAs with disease management tools, including resistant cultivars, fungicides or bactericides, or other BCAs. This integration is important because the consistency and degree of disease control by Bacillus-based BCAs is rarely equal to the control afforded by the best fungicides or bactericides. In theory, integration of several tools brings stability to disease management programs. Integration of BCAs with other disease management tools often provides broader crop adaptation and both more efficacious and consistent levels of disease control. This review will also discuss the use of Bacillus-based BCAs in fungicide resistance management. Work with Bacillus thuringiensis and insect pest management is the exception to the relative paucity of reports but will not be the focus of this review.
22
Silaev, Aleksey Ivanovich, Lyudmila Denisovna Grishechkina und Vera Gennadievna Churikova. „Efficiency of the application of insectofungicide prestige for grain crops protection against harmful organisms“. Agrarian Scientific Journal, Nr. 7 (15.07.2019): 34–39. http://dx.doi.org/10.28983/asj.y2019i7pp34-39.
Der volle Inhalt der QuelleAnnotation:
The effectiveness of the insecticofungicide Prestige, KS, used to protect plants from damage by diseases and damage by pests in the first stages of ontogenesis is shown. Presowing seed treatment with a preparation with a flow rate of 2.5–3.5 l/t reduced the incidence of winter wheat with root rot of rhizoctoniosis etiology by 62.9%. The biological effectiveness of the Prestige, KS (3.5 l / t) on moderately infectious background was also quite high - 59.5%, however, it was 9.0% lower than the standard. It practically did not influence overwintering of plants. After application of Prestige, KS were in the norm of 2.5 and 3.5 l/t, and Maxim Extreme, KS in the norm of 1.75 l/t, the number of plants preserved by spring varied from 91.9 to 92.9%, that is higher than in the control by 3.9–4.9%. The application of insectofungicide Prestige, KS at a rate of 2.5 l/t on spring wheat sowings reduced the number of grain fleas by more than 80.0%and the damage of the stems by the larvae of cereal flies by 74.3%. This preparation is not phytotoxic with respect to cereals.
23
Carbonari, Caio A., Ana Karollyna Alves de Matos, Ivana Paula Ferraz Santos de Brito, Edivaldo D. Velini und Franck E. Dayan. „Impact of Green Cane Harvesting on Pest Management in Sugarcane“. Outlooks on Pest Management 31, Nr. 2 (01.04.2020): 64–73. http://dx.doi.org/10.1564/v30_apr_04.
Der volle Inhalt der QuelleAnnotation:
Green cane harvesting is a new agricultural practice that provides many benefits to sugar cane production in Brazil by allowing cane straw to remain on the soil surface. However, this system has complicated the management of weeds, pests and diseases. This review will highlight the impact of green cane harvesting on the management of weeds, insect pests, and pathogens in sugar cane production, and cover novel techniques and practices used to manage pests in this production system. Brazil has a unique agroecosystem that includes tropical and subtropical climates and distinct technical challenges relative to other agricultural regions around the world. Sugarcane stands out as an economically important crop in Brazilian agriculture, both in terms of its planting area and the complexity of the production system (e.g., constant changes in planting, cultural practices, and harvest managements). Brazilian sugarcane production in the 2018/2019 season was 620.44 million tons produced over more than 8.5 million hectares distributed mainly in the states of São Paulo, Goiás, and Minas Gerais. Currently, 38% of this production is intended to produce sugar and 62% to ethanol, generating 29.04 million tons of sugar and 33.14 billion liters of ethanol, making Brazil the largest sugar and ethanol producing country in the world. The sugarcane agroindustry continues to expand in Brazil, showing a great capacity to aggregate value to byproducts of ethanol and sugar, such as vinasse (fertilizer), filter cake (fertilizer and soil conditioner), bagasse (raw-material for industries; animal feed; and electrical energy generation), and plant straws (electrical energy generation). The adoption of mechanized harvests without burning has allowed accumulation of sugarcane straw residues over the cropping area (green cane harvesting). Approximately 84% of the sugarcane production area in Brazil follows green cane harvesting practices. This harvesting system has made the management of weeds, pests and diseases even more complex in sugarcane fields than before. Green cane harvesting has made pest and weed management (mainly) more complex. The presence of residues on the soil directly affects the action of pre-emergent herbicides that are most commonly used in sugarcane and increases the incidence of some important pests such as S. levis and M. fimbriolata. Integration of management programs for weeds, pests, and diseases generates economic benefits and control efficacy (broad spectrum action), maximizing their individual efficacy level, reducing the dependence on only one of them and the risk of selection of resistant pest populations. Monitoring, planning, and evaluation of the history of the sugarcane fields are essentials and assist in decision making regarding the method and time of control to be used. The efficiency of this system assists in the maintenance of high yields, health, and longevity for sugarcane fields.
24
Ceccarelli, S., J. Valkoun, W. Erskine, S. Weigand, R. Miller und J. A. G. Van Leur. „Plant Genetic Resources and Plant Improvement as Tools to Develop Sustainable Agriculture“. Experimental Agriculture 28, Nr. 1 (Januar 1992): 89–98. http://dx.doi.org/10.1017/s0014479700023036.
Der volle Inhalt der QuelleAnnotation:
SummaryThis paper addresses the current and future contributions of plant genetic resources and plant improvement to sustainable agriculture with reference to the activities of the International Center for Agricultural Research in the Dry Areas (ICARDA) in association with national programmes in West Asia and North Africa. These regions constitute the primary centres of diversity of crops such as wheat, barley, chickpea and lentil. Genetic erosion is being curtailed by germplasm collection and preservation. Selection for low-input cultivars of barley is conducted under low input conditions, and new cultivars of lentil and barley are often intentionally heterogeneous to stabilize their performance in dry rainfed areas. The importance of genetic differences in the cultivars on subsequent crops in the rotation and on straw quality for livestock is under study. Insect pests and diseases contribute to yield instability. Because of the potential adverse impact of pesticides on the fragile ecosystems of the region, integrated control strategies based on agronomic management, host plant resistance, biological control agents and strategic use of selective insecticides are being developed.
25
Torres, A. M., S. A. Palacios, N. Yerkovich, J. M. Palazzini, P. Battilani, J. F. Leslie, A. F. Logrieco und S. N. Chulze. „Fusarium head blight and mycotoxins in wheat: prevention and control strategies across the food chain“. World Mycotoxin Journal 12, Nr. 4 (04.12.2019): 333–55. http://dx.doi.org/10.3920/wmj2019.2438.
Der volle Inhalt der QuelleAnnotation:
With 744 million metric tons produced in 2017/2018, bread wheat (Triticum aestivum) and durum wheat (Triticum durum) are the second most widely produced cereal on a global basis. Prevention or control of wheat diseases may have an enormous impact on global food security and safety. Fusarium head blight is an economically debilitating disease of wheat that reduces the quantity and quality of grain harvested, and may lead to contamination with the mycotoxin deoxynivalenol, which affects the health of humans and domesticated animals. Current climate change scenarios predict an increase in the number of epidemics caused by this disease. Multiple strategies are available for managing the disease including cultural practices, planting less-susceptible cultivars, crop rotation, and chemical and biological controls. None of these strategies, however, is completely effective by itself, and an integrated approach incorporating multiple controls simultaneously is the only effective strategy to limit the disease and reduce deoxynivalenol contamination in human food and animal feed chains. This review identifies the available tools and strategies for mitigating the damage that can result from Fusarium head blight.
26
Dorneles, Alicia Baumhardt, Eduardo Leonel Bottega, Zanandra Boff de Oliveira, Alberto Eduardo Knies, Clarissa Moraes da Silva und Irajá Jantsch de Souza. „Uso de diferentes pontas de pulverização no controle de doenças no trigo“. Ciência e Natura 40 (12.03.2019): 11. http://dx.doi.org/10.5902/2179460x35494.
Der volle Inhalt der QuelleAnnotation:
Unstable environmental factors contribute to the incidence of diseases and pests, causing reduced yield and grain contamination, especially the attack by Giberela (Fusarium graminerum). In this scenario, appropriate management techniques are needed. Strategies such as choosing the suitability of the spray tip for chemical control are indispensable. The aim of this study was to use four spray tips: CVI 11002, ADI ISO 11002, TVI ISO 8002 and ATR 8002. The experiment was conducted in the experimental area of The State University of Rio Grande do Sul, in the district of Três Vendas, in Cachoeira do Sul-RS. The cultivar used was TBIO SELETO. The fungicide used was Nativo®. A completely randomized experimental design with 4 replicates and a control plot was adopted. The following parameters were evaluated: weight of one thousand grains (PMG, %), hectoliter weight (PH; kg hL-1) and yield (PRD; kg ha-1). The variance was tested by applying the Snedcor F test (p<0.05) and the means were compared by the Tukey's test (p<0.05). The weight of one thousand grains, hectoliter weight and yield were not influenced by the use of different spray tips adopted in the wheat phytosanitary control.
27
Connell, Joseph H. „Alternative Practices for Almond“. HortScience 31, Nr. 4 (August 1996): 691f—692. http://dx.doi.org/10.21273/hortsci.31.4.691f.
Der volle Inhalt der QuelleAnnotation:
Improving almond orchard management by integrating cultural practices, pest and disease controls, and vegetation management has been a goal of Univ. of California research and extension efforts for more than 25 years. Alternative cultural practices related to orchard floor management, fertilizer applications, and pest and disease control are currently important components of the almond production system. Nontillage, with or without a seeded cover crop, has improved potassium uptake and reduced pest problems. In-season fertilizer applications reduced the potential for nitrate pollution of groundwater. Minimizing dust, early harvest, and destruction of overwintering refugia are all cultural practices that reduce crop damage caused by pests. New methods of pest and disease monitoring using pheromone traps, egg traps, or a better understanding of disease life cycles have reduced unnecessary chemical applications. Degree-day phenology models have improved the timing of needed sprays. Expanded use of selective spray materials, such as narrow-range oils and Bacillus thuringiensis, reduce impacts on non-target species while natural predators and parasites are encouraged. Augmentative releases of beneficial insects are currently being evaluated as an additional alternative to in-season spraying. Cultivar and rootstock choices for new plantings present alternatives that can help avoid pests or diseases. Planting pattern affects productivity and is another factor to consider when evaluating alternative production practices for almond as new orchards are established.
28
De Jong, Van, B. E. Braithwaite, T. L. Roush, A. Stewart und J. G. Hampton. „Opportunities for developing value-added brassica seed“. NZGA: Research and Practice Series 14 (01.01.2010): 139–46. http://dx.doi.org/10.33584/rps.14.2008.3174.
Der volle Inhalt der QuelleAnnotation:
New Zealand produces approximately 5,500 tonnes of brassica seed per year, two thirds of which, valued at $13M, is exported. Black rot caused by Xanthomonas campestris pv. campestris is a common disease of brassicas, and while crop losses are not extensive in New Zealand, internationally total crop losses have been reported. Seeds are the primary source of inoculum and the ease with which this inoculum spreads means that even small traces can cause severe epidemics. Genetic resistance to black rot is a complex trait which makes breeding for resistance in brassicas challenging. The effectiveness of chemical and cultural practices is variable. Biological control with natural antagonistic microbes may provide a more effective means of controlling black rot and other pests and diseases, and create opportunities for increasing the export value of brassica seed. Current cultural practices and the potential for biological control for the management of black rot are reviewed. Keywords: biocontrol, Brassicaceae, crucifer
29
Medvid, Ya. „The role of nectariferous plants in the attraction of coccinellids (Coleoptera: Coccinellidae)“. Karantin i zahist roslin, Nr. 1 (19.03.2020): 13–15. http://dx.doi.org/10.36495/2312-0614.2020.01.13-15.
Der volle Inhalt der QuelleAnnotation:
Goal. To evaluate the role of nectarines in attracting coccinellid in the agrocenosis of spring wheat.
Methods. Field experience on the effect of nectarines to attract coccinellid; accounting ladybirds on the plot of nectarines and sowing of spring wheat in accordance with standard methods; laboratory — determination of species composition of ladybirds. The study was conducted in the 2017—2019 years. at the experimental field of the National scientific center «Institute of agriculture of NAAS of Ukraine» in the Department of plant protection against pests and diseases (Kiev region, Kiev-Svyatoshinsky district, town Chabany).
Results. Updated the species composition of coccinellid in modern conditions on nectarines. Identified eight types of ladybirds, among which Coccinella septempunctata Linnaeus, 1758 and Hippodamia variegata Goeze, 1777 are the dominant species. Reflected seasonal population dynamics of ladybirds. Identified a high effect of attracting coccinellid on the dill, where their average number was much higher than on some other options. Given the average number of ladybugs on spring wheat during the accounting period.
Conclusions. Considering the useful role of representatives of the family Coccinellidae (Latreille, 1807) on crops, it is necessary to improve the practical use of entomophages and engaging coccinellid in agrocenoses with overseeding nectarines. Culture that attracts the entomophagous defined by dill (40.0 specimen/100 sweep net). More diverse species composition was observed coccinellid on Vick spring (six species). The average number of ladybirds over the growing period of spring wheat amounted to: land adjacent to nechernozeme to 16.7 ind./100 sweep net, control of 9.4 ind/100 sweep net. Such an advantage underscores the need of interplanting of plants that attract coccinellid in agrocenoses.
30
Bates, Maynard E. „MANAGING ENVIRONMENT TO OPTIMIZE PRODUCTION AND MINIMIZE COSTS“. HortScience 25, Nr. 9 (September 1990): 1182b—1182. http://dx.doi.org/10.21273/hortsci.25.9.1182b.
Der volle Inhalt der QuelleAnnotation:
Increased production and reduced costs are goals of all plant growers. As a rule, introduction of computer-based control of the plant environment in a well-designed greenhouse will result in yield increases of thirty percent (30%) over other control techniques. A simple model will show how these changes impact profitability.New technologies in sensors, interfaces, computers, software, and plant growth knowledge are being applied to management of the crop environment. Examples of direct canopy temperature measurement, online plant weight measurement, integration and control of photosynthetic photon flux, and nutrition control will be presented. Integrated process control is replacing setpoint maintenance. Models are being developed for incorporation into environmental control systems. Examples for solar irradiance and crop growth will be demonstrated.Ultimately expert systems based on artificial intelligence technology will manage crop production in controlled environments. These systems will incorporate information on crop genome, local climate, cultural practices, pests and diseases, economics, and markets, in addition to environmental control. A possible configuration of the hardware and software for such a system will be discussed.
31
Teulon, D. A. J., P. J. Cameron, G. W. Bourdot, D. Curtin und M. Ralston. „Plant protection guides for organic arable and vegetable crops a growers resource“. New Zealand Plant Protection 57 (01.08.2004): 351. http://dx.doi.org/10.30843/nzpp.2004.57.6970.
Der volle Inhalt der QuelleAnnotation:
A New Zealand guide for pest, disease and weed management in organic arable andvegetable crops was developed. This guide is a resource for current organic growers andtheir consultants, as well as those contemplating converting to organics. It includesinformation collected from a wide range of sources within New Zealand and overseas.The guide has three parts: (I) a general section on the principles of soil, pest and diseaseand weed management in organic systems, (II) an arable section covering barley, borage,clover seed, grass seed, lentils, linseed, maize and wheat, and (III) a vegetable sectioncovering asparagus, brassicas, capsicum, carrot, onion, peas, potato, squash and tomato.For each crop there is a summary of the main pests, diseases and weeds to identify thepotential risks to organic growing. The options for preventing or managing these risksthat are available to organic growers given the cropping operations and control alternativesavailable to them are then described. This guide aims to fill the current gap between“introductory” and “anecdotal” organic publications with comprehensive documentationof growing operations that have been used successfully in specific crops for organicpest, disease and weed management.
32
Liu, Yu, Xiaoping Wang und Jiaxin Qian. „Crop distribution extraction based on Sentinel data“. E3S Web of Conferences 252 (2021): 02081. http://dx.doi.org/10.1051/e3sconf/202125202081.
Der volle Inhalt der QuelleAnnotation:
Remote sensing identification and classification of crops is the use of remote sensing for estimating crop planting area of timely and accurate monitoring of crop growth and plant diseases and insect pests in advance to make the product output to estimate the key and premise of the study using Sentinel-1 and Sentinel-2 satellite, by random forest algorithm, the traditional optical wavelengths and vegetation index The backward scattering field of red edge information and radar information in feature selection and feature classification, including winter wheat summer corn orchard woodland town water and bare land set three controls, such as the first group contains radar time characteristics, the characteristics of the second control group contains red edge long, the third group includes traditional vegetation index for phase characteristics, analyzed the different classification accuracy. The results from the confusion matrix show that the red edge band edge after index and the radar scattering information to join the crop classification accuracy is improved effectively. Sentinel optical and radar satellites with a time resolution of 5–6 days have great potential for crop monitoring research.
33
Elkhalil Elnour Breima, Amani Ahmed Idris, Elhafiz Abdalla Haroon, Aboh Adam Elnour und Ali Ahmed Dawoud. „Enhancing rainfed wheat productivity through technology validation and dissemination in Nertiti locality of Central Darfur State-Sudan“. World Journal of Advanced Research and Reviews 9, Nr. 3 (30.03.2021): 281–87. http://dx.doi.org/10.30574/wjarr.2021.9.3.0082.
Der volle Inhalt der QuelleAnnotation:
This research has been conducted in Nertiti locality of central Darfur State during 2020/2021 cropping season in order to enhance rainy wheat productivity through technology validation and dissemination. Farmers Field School was established with 25 farmers (5 men and 20 women). On-station demonstration farm was conducted with an area of 2feddan. Improved wheat variety Zakia (1feddan) grown versus Nillin (0.5 feddan) and local (0.5 feddan) to evaluate crop performance and potentiality. Clustered random sampling technique applied. Evaluation questionnaires developed randomly to 20 farmers to know farmers perceptions on wheat performance and productivity. Farmers subjected to farming training in wheat technologies of land preparation, sowing date, seed preparation, seed dressing, weeding, water harvesting, soil conservation, pests and diseases control, seed production technologies and harvest and post harvest technologies. Results showed that excessive rainfall variation during reproductive growth affect wheat yield by 32%. Socioeconomic characteristics and frequency distribution of farmers revealed that 80% of FFS participants were educated and 20% illiterate. 10% of farmers have farm size less than 1 feddan, 50% have 1-2 feddan, 30% have farm size range between 3-4 feddan and 10% have more than 4 feddan. Agriculture is the main source of income (80%), while 20% traders and pity trading. Results noted that 90% of FFS participants have no extension services and only 10% have.40% of respondent’s have experience in wheat production, while 60 have no experience.40% of participants perceived that improved wheat is resistant to water logging and high rain fall, 20% resist to insects, 30% high yielded and 10% said low yielded. Crop productivity trend showed that highest grain yield was obtained by improved Zakaia (655 kg/feddan) followed by Nillin (626 kg/feddan), while the lowest yield gained by local (424 kg/fedan). It was also recorded that improved Zakia exceed local and Nillin yields by 54% and 5%, respectively. Partial crop budget result revealed that all treatments were financially gave positive net returns. Improved Zakia gave highest net returns (SDG 21,500), Nillin (SDG18, 900) and the lowest net returns obtained by local wheat (SDG 15,000). Study recommended training in wheat technologies and enhancing the role of research station in the study area.
34
Araújo, W. L., A. G. Oliveira, A. P. N. Ferreira, F. S. Sousa und A. B. A. Andrade. „Manejo de pragas no controle de doenças no cultivo de hortícolas“. Revista Verde de Agroecologia e Desenvolvimento Sustentável 10, Nr. 1 (27.12.2015): 43. http://dx.doi.org/10.18378/rvads.v10i5.3887.
Der volle Inhalt der QuelleAnnotation:
<p>Os insetos estão geralmente associados a uma planta, em sua maioria são considerados pragas, principalmente em cultivos agrícolas, sejam como pragas broqueadoras, sugadoras de seiva, ou até mesmo como vetores de fitopatógenos, sendo neste último uma das causas mais preocupantes, uma vez que muitos fitopatógenos patógenos causam doenças que ainda não tem-se um controle eficaz. Sabe-se que no modelo convencional de produção, o manejo das pragas são feitos por controle químico. Este trabalho teve como objetivo fazer uma revisão bibliográfica de trabalhos representativos a respeito do controle de pragas vetores de doenças. A mosca-branca (<em>Bemisia ssp</em>) foi o gênero que mais preocupa os produtores, uma vez que se apresentou como praga em uma grande quantidade de plantas hortícolas, e por ser vetor de vírus, doenças a te então, com controle restrito. Pulgões (<em>Aphididae</em>) também foram relatados, assim como a traça-das-crucíferas (<em>Plutella xylostela</em>) e do tomateiro (<em>Tuta absoluta</em>), controle biológico com o uso de <em>Trichogramma</em> ssp., <em>Beauveria Bassiana, </em>bem como controle físico, químico, etc<em>.</em> De modo geral, vários controles se mostraram viáveis para o controle destas pragas, dentre eles estão o controle químico, físico, genético, biológico e cultural, ambos no intuito de controlar a praga com a finalidade de prevenir a transmissão de doenças por estes.</p><p><strong> </strong></p><p align="center"><strong><em>Pest management in disease control in vegetable growing</em></strong></p><p><strong>Abstract:</strong> The insects are usually associated with a plant, for the most part are considered pests, particularly in agricultural crops, are as broqueadoras pests, sap suckers, or even how plant pathogens vectors, with the latter one of the most disturbing causes a Since many pathogens pathogens cause disease that still has to be an effective control. It is known that the conventional model of production, pest management are made by chemical control. This study aimed to do a literature review of representative works about pest control disease vectors. The whitefly (Bemisia spp) was the genre that most worries the producers, as it is presented as a pest in a lot of vegetable plants, and for being virus vector, the diseases you then, with strict control. Aphids (Aphididae) have also been reported, as well as the moth-the-cruciferous (Plutella xylostela) and tomato (Tuta absoluta), biological control using Trichogramma ssp., Beauveria bassiana, as well as physical, chemical control, etc. In general, various controls have proven viable for the control of these pests, among them are the chemical, physical, genetic, biological and cultural control, both in order to control the pest in order to prevent the transmission of diseases by these.</p>
35
Adewale Osipitan, O. „Weed Interference and Control in Cowpea Production: A Review“. Journal of Agricultural Science 9, Nr. 12 (15.11.2017): 11. http://dx.doi.org/10.5539/jas.v9n12p11.
Der volle Inhalt der QuelleAnnotation:
In spite of the great economic potential of cowpea as both domestic and commercial crop, a number of constraints, which include insect pests, diseases and weeds, limits its production in West and many parts of Africa. Weeds reduced cowpea yield and value by competing for light, water and nutrients. Cowpea suffers from weeds particularly when the crop is in the early growth stages before ground cover. Yield losses cause by weeds alone in cowpea production can be as high as 76% depending on the cowpea cultivar, environment and weed management practices. A timely weed removal at the critical period, which falls within the first 40 days of cowpea growth, would help to prevent an unacceptable yield. Weed management in cowpea has been with low technology. Hand weeding is the most widely used weed control method in cowpea but they are usually expensive and labour intensive. Cultural practices such as narrow row spacing and planting of early maturing varieties are also used for weed control in cowpea. Herbicides, which are relatively easy to use and less expensive, have not been widely adopted for weed control in cowpea. There are limited number of selective herbicides with wide spectrum for weed control in cowpea. However, an integrated practices that involved pre-emergence weed control using herbicides or physical weeding, and a supplementary weed removal that would ensure weed control up to 40 days after cowpea emergence could substantially prevent yield losses associated with weed interference.
36
Moody, J. T., und M. C. Halbrooks. „AN INTEGRATED PEST MANAGEMENT EXTENSION PROGRAM FOR NURSERY PRODUCERS IN SOUTH CAROLINA“. HortScience 27, Nr. 11 (November 1992): 1167b—1167. http://dx.doi.org/10.21273/hortsci.27.11.1167b.
Der volle Inhalt der QuelleAnnotation:
The ornamental horticulture industry in South Carolina has expanded significantly over the last decade. Today, concerns regarding environmental and public health, and stricter regulations of pesticide use, are creating incentives for growers to evaluate alternative methods of pest control. Nursery producers currently use an array of chemicals in an attempt to control pests including insects, weeds, and diseases. Integrated pest management (IPM) provides an opportunity to reduce chemical reliance. The overall objective of this extension program is to collect and collate information relevant to the implementation of an IPM program. The first year, 1989-90, surveys were developed to determine key factors related nursery pest management. Types of data collected included: key pest species; pest-plant relationships; grower action responses to pest problems; types and frequency of pesticide use. The second year, 1990-91, involved implementing IPM strategies such as: cultural methods; use of horticultural oils, soaps, and lower risk pesticides; and spot treatment applications to help maintain pest populations below economically damaging levels. Improvements in pest management included; reduced chemical applications, reduced associated environmental risks, and maintenance of aesthetic quality of plants.
37
Farias-Larios, J., und A. Michel-Rosales. „Sustainable Production of Honeydew and Muskmelon in Western Mexico“. HortScience 33, Nr. 3 (Juni 1998): 495d—495. http://dx.doi.org/10.21273/hortsci.33.3.495d.
Der volle Inhalt der QuelleAnnotation:
In Western Mexico, melon production depends on high-input systems to maximize yield and product quality. Tillage, plasticulture, fumigation with methyl bromide, and fertigation, are the principal management practices in these systems. However, at present several problems has been found: pests as sweetpotato whitefly (Bemisia tabaci Gennadius), aphids (Myzus and Aphis), leafminer (Liryomiza sativae); diseases as Fusarium, Verticilium, and Pseudoperenospora, and weeds demand high pesticide utilization and labor. There is a growing demand for alternative cultural practices, with an emphasis on reducing off-farm input labor and chemicals. Our research is based on use of organic mulches, such as: rice straw, mature maize leaves, banana leaves, sugarcane bagasse, coconut leaves, and living mulches with annual legume cover crop in melons with crop rotation, such as: Canavalia, Stilozobium, Crotalaria, and Clitoria species. Also, inoculations with mycorrhizal arbuscular fungi for honeydew and cantaloupe melon seedlings production are been assayed in greenhouse conditions for a transplant system. The use of life barriers with sorghum, marigold, and other aromatic native plants in conjunction with a colored yellow systems traps for monitoring pests is being studied as well. While that the pest control is based in commercial formulations of Beauveria bassiana for biological control. The first results of this research show that the Glomus intraradices, G. fasciculatum, G. etunicatum, and G. mosseae reached 38.5%, 33.5%, 27.0%, and 31.0% of root infection levels, respectively. Honeydew melons production with rice and corn straw mulches shows an beneficial effect with 113.30 and 111.20 kg/plot of 10 m2 compared with bare soil with 100.20 kg. The proposed system likely also lowers production cost and is applicable to small- and large-scale melon production.
38
Cox, C. M., K. A. Garrett, T. S. Cox, W. W. Bockus und T. Peters. „Reactions of Perennial Grain Accessions to Four Major Cereal Pathogens of the Great Plains“. Plant Disease 89, Nr. 11 (November 2005): 1235–40. http://dx.doi.org/10.1094/pd-89-1235.
Der volle Inhalt der QuelleAnnotation:
Methods of disease management used in annual grain crops, especially cultural practices designed to disrupt the disease cycle of a particular pathogen, will not necessarily be applicable to perennial grain crops. Resistance to multiple pathogens, therefore, will clearly be important in disease management. The objective of this research was to evaluate disease resistance in 10 perennial grain accessions (one to two accessions of each: perennial wheat (Thinopyrum sp. × Triticum aestivum), intermediate wheatgrass (Thinopyrum intermedium), perennial rye (Secale montanum), hexaploid triticale (Triticum turgidum × S. montanum), octoploid triticale (Triticum aestivum × S. montanum), tetraploid perennial rye (Secale cereale × S. montanum), and tall wheat-grass (Thinopyrum ponticum)) to tan spot (caused by Pyrenophora tritici-repentis), take-all (caused by Gaeumannomyces graminis var. tritici), wheat streak mosaic, and barley yellow dwarf, four important diseases of the Great Plains. Several of the grasses were resistant to tan spot, barley yellow dwarf, and wheat streak mosaic. Indeed, the wild grasses and perennial donors T. intermedium (including BFPMC1), T. ponticum, and S. montanum, in addition to Permontra, a tetraploid perennial rye, were highly resistant to all three diseases. Additionally, the remaining grasses tested were also more resistant to tan spot than the susceptible wheat control. However, none of the 10 grass accessions appeared highly resistant to take-all, and substantial losses in biomass were observed, although such effects may be moderated under field conditions due to the potential for take-all decline in perennial plantings.
39
Butsenko, Liudmyla, Lidiia Pasichnyk, Yuliia Kolomiiets, Antonina Kalinichenko, Dariusz Suszanowicz, Monika Sporek und Volodymyr Patyka. „Characteristic of Pseudomonas syringae pv. atrofaciens Isolated from Weeds of Wheat Field“. Applied Sciences 11, Nr. 1 (30.12.2020): 286. http://dx.doi.org/10.3390/app11010286.
Der volle Inhalt der QuelleAnnotation:
The aim of this study was the identification of the causative agent of the basal glume rot of wheat Pseudomonas syringae pv. atrofaciens from the affected weeds in wheat crops, and determination of its virulent properties. Isolation of P. syringae pv. atrofaciens from weeds of wheat crops was carried out by classical microbiological methods. To identify isolated bacteria, their morphological, cultural, biochemical, and serological properties as well as fatty acids and Random Amplification of Polymorphic DNA (RAPD)-PCR (Polymerase chain reaction) profiles with the OPA-13 primer were studied. Pathogenic properties were investigated by artificial inoculation of wheat plants and weed plants, from which bacteria were isolated. For the first time, bacteria that are virulent both for weeds and wheat were isolated from weeds growing in wheat crops. It was shown that the fatty acids profiles of the bacteria isolated from the weeds contained typical for P. syringae pv. atrofaciens fatty acids, in particular, hydroxy acids: 3-hydroxydecanoic, 2-hydroxydodecanoic, and 3-hydroxydodecanoic. RAPD-PCR profiles of the newly isolated strains were identical to those of the collection strains P. syringae pv. atrofaciens UCM B-1011 and P. syringae pv. atrofaciens UCM B-1014 and contained a dominant fragment of 700 bp. The isolated strains, according to their phenotypic and genotypic properties, were identified as P. syringae pv. atrofaciens. It was established that the causative agent of basal glume rot of wheat P. syringae pv. atrofaciens is polyphagous and capable of infecting a wide range of plants. The main control measure for cereals diseases caused by P. syringae pv. Atrofaciens—crop rotations with nonhost species, should be revised, and alternative control methods must be proposed.
40
Hokanson, Stan C., und Chad E. Finn. „Strawberry Cultivar Use in North America“. HortTechnology 10, Nr. 1 (Januar 2000): 94–106. http://dx.doi.org/10.21273/horttech.10.1.94.
Der volle Inhalt der QuelleAnnotation:
Strawberry (Fragaria ×ananassa Duch.) cultivars used by commercial producers in North America often change rapidly due to several factors including modified cultural practices, processing and marketing practices, the desire for new cultivars with larger and higher quality berries, resistant insect and disease pests, loss of traditional chemical control methods, and private sector breeding programs. Within the past decade, the annual plastic-mulched production system has quickly expanded into eastern North America prompting the need for cold-hardy cultivars adapted to that system. The continuing loss of traditional chemical controls for strawberry insects and diseases, including the impending loss of methyl bromide, has prompted the need for increased insect and disease resistance. In addition, consumer demands for a healthier food product with lower chemical residues has heightened this need. Small fruit experts from across North America provided information on the primary strawberry cultivars used in the recent past, the present, and potential cultivars for the future, as well as on current strawberry acreage in their respective states and provinces.
41
Astuti, Ludji Pantja, und Mutala’liah Mutala’liah. „Host preference of Tribolium castaneum (Herbst) on six kinds of flour“. Jurnal Entomologi Indonesia 17, Nr. 3 (11.12.2020): 149. http://dx.doi.org/10.5994/jei.17.3.149.
Der volle Inhalt der QuelleAnnotation:
<p>The red flour beetle, <em>Tribolium castaneum </em>(Herbts)<em> </em>is a major pest of flour from various grains. The infested flour is discoloured and will emit a disagreeable odour due to the secretion of benzoquinone from the insect’s abdominal glands. Considering the economic losses effected by <em>T. castaneum, </em>new alternative control measures are needed for this pest. This study sought to determine the host preferences of <em>T. castaneum </em>from amongst six kinds of flour to assess their vulnerability to infestation. The research was conducted in the Plant Pest Laboratory, Department of Plant Pests and Diseases, Faculty of Agriculture, University of Brawijaya. The host preferences of <em>T. castaneum</em> were examined using a six-arm olfactometer. Feeding preference tests were performed for a duration of 12 hours at 200 ml/minute airflow in each chamber-arm, followed by oviposition preference observations one week later. Feeding preference was calculated for the total pool of adults observed, segregated by sex, whereas oviposition preference was calculated as the number of eggs laid. Flour nutrition (proximate composition, phenolic content, and riboflavin content) were analyzed. Our results showed a feeding preference by <em>T. castaneum </em>for bran, soy and tapioca flour was greater over wheat, corn, and white gelatinous rice flour, while for oviposition, bran flour was the most preferred.</p>
42
Kabbage, Mehdi, und William W. Bockus. „Effect of Placement of Inoculum of Gaeumannomyces graminis var. tritici on Severity of Take-all in Winter Wheat“. Plant Disease 86, Nr. 3 (März 2002): 298–303. http://dx.doi.org/10.1094/pdis.2002.86.3.298.
Der volle Inhalt der QuelleAnnotation:
Take-all, caused by Gaeumannomyces graminis var. tritici, is one of the most important root diseases of wheat worldwide. Because of the lack of highly effective chemical control, cultural practices, such as crop rotation, play a major role in managing disease severity. In Kansas, many producers do not use these measures and continue to suffer losses from take-all. Greenhouse and field experiments were established to assess the effect of horizontal versus vertical distribution of G. graminis var. tritici inoculum on disease severity. Oat kernel inoculum was placed at 0 (seed level), 5, 10, or 15 cm below the wheat seed or 5, 10, or 15 cm to the side of the wheat seed at a depth of 5 cm. Inoculum spatial location and distance greatly influenced take-all. Experiments showed more severe losses due to take-all when inoculum was placed below the seed than to the side of the seed. Regression analyses were used to develop take-all risk models relating inoculum distance from the seed to yield loss. Quadratic models were a better fit for data from experiments where inoculum was placed to the side of the seed, whereas linear models significantly fit data from experiments where inoculum was positioned below the seed. Within the same direction, take-all decreased as the inoculum was placed at greater distances from the seed, often to insignificant levels at 10 to 15 cm. According to the regression models, significant reduction (≥50%) in take-all might be achieved by plowing under the infested residues (crowns) to depths greater than 15 cm, or placing seed >6.0 cm to the side of inoculum. Therefore, under no-till conditions, sowing parallel to and exactly between the previous years' stubble rows (inoculum) might help manage take-all. These possibilities need to be investigated under field conditions.
43
Zhao, C., und X. H. Wu. „First Report of Sugar Beet Rhizoctonia Crown and Root Rot Caused by Rhizoctonia solani AG-2-2IIIB in Shanxi Province of China“. Plant Disease 98, Nr. 3 (März 2014): 419. http://dx.doi.org/10.1094/pdis-12-12-1202-pdn.
Der volle Inhalt der QuelleAnnotation:
Sugar beet (Beta vulgaris L.) is grown worldwide as the second largest sugar crop. Sugar beet crown and root rot is an economically serious disease mainly caused by Rhizoctonia solani (teleomorph Thanatephorus cucumeris) AG 2-2 and AG 4 (1). In July 2010, at the 25- to 27-leaf stage, symptoms typically associated with crown and root rot, including dark brown to black lesions at the base of the petioles or circular to oval dark lesions (up to 10.0 mm in diameter) at the taproot, were observed on 15% of sugar beet plants collected from three sites in Shanxi Province, northern China. Pieces of internal root tissues cut from the margins between symptomatic and healthy-appearing tissue were disinfected with 0.5% NaOCl for 2 min, rinsed three times with sterile water, then placed on water ager (WA) for incubation at 25°C in the dark. After 2 days, single hyphal tips of three Rhizoctonia-like isolates (designated SX-RSD1, SX-RSD2, and SX-RSD3) were transferred to potato dextrose ager (PDA). Colonies of all isolates were brown and developed dark brown sclerotia (0.5 to 1.0 mm diameter) on the media surface after 4 and 7 days, respectively. Mycelia were branched at right angles with septa near the branches and slight constrictions at the bases of the branches were present. Average hyphal diameters of the three isolates were 8.1, 7.3, and 7.6 μm, respectively. Hyphal cells were determined to be multinucleate (4 to 9 nuclei per cell) by staining with 4′-6-diamidino-2-phenylindole (DAPI) (2). Anastomosis groups were determined by pairing with reference strains (kindly provided by N. Kondo, Hokkaido University, Japan) (2), and all three isolates anastomosed with R. solani AG-2-2IIIB. All three isolates grew well on PDA at 35°C, which separates AG-2-2IIIB from AG-2-2 IV. The internal transcribed spacer (ITS) region of rDNA was amplified from genomic DNA of these isolates with primers ITS1 (5′-TCCGATGGTGAACCTGCGG-3′)/ITS4 (5′-TCCTCCGCTTATTGATATGC-3′). Sequences (GenBank Accession Nos. KC413984, KC413985, and KC413986) were over 99% identical to those of 19 R. solani AG-2-2 IIIB isolates (e.g., FJ492146.3; strain F510). Therefore, based on the molecular characteristics and the anastomosis assay, these three isolates were identified as R. solani AG-2-2IIIB. To determine the pathogenicity of the isolates, wheat seeds were autoclaved twice for 60 min at 121°C on consecutive days and inoculated with each isolate (3). Subsequently, wheat seeds (three seeds per plant) were placed around 8-week-old sugar beet (cv. HI0305) plants at 2 cm intervals to each root and 10 mm deep in soil. Plants were grown at 25 to 27°C for 7 days in a glasshouse. All inoculated plants developed symptoms of root rot, whereas control plants inoculated with sterilized wheat seeds remained healthy. R. solani AG-2-2IIIB was consistently re-isolated from the symptomatic root tissue and was confirmed by both morphological and molecular characteristics described above, fulfilling Koch's postulates. To our knowledge, this is the first report of R. solani AG-2-2IIIB on sugar beet in Shanxi Province of China. R. solani AG2-2IIIB has been reported to be pathogenic on wheat in China (4), which is often grown in rotation with sugar beet. This rotation could increase the risk of soilborne infection to either crop by R. solani AG2-2IIIB. References: (1) R. M. Harveson et al. Compendium of Beet Diseases and Pests, American Phytopathological Society. St. Paul, MN. 2009. (2) W. C. Kronland and M. E. Stanghellini. Phytopathology. 78:820, 1988. (3) M. J. Lehtonen et al. Plant Pathol. 57:141, 2008. (4) D. Z. Yu et al., Hubei Agric. Sci. 3:39, 2000.
44
McLeod, A., und S. Coertze. „First Report of Phytophthora infestans on Petunia × hybrida in South Africa“. Plant Disease 90, Nr. 12 (Dezember 2006): 1550. http://dx.doi.org/10.1094/pd-90-1550b.
Der volle Inhalt der QuelleAnnotation:
Phytophthora infestans is known worldwide as the destructive, late blight pathogen of potatoes and tomatoes. However, erratic reports dating back to 1856 also have shown it to be pathogenic on petunia (Petunia × hybrida), although it has not been regarded as an important pathogen on this host (4). Recently, reports from North America showed that P. infestans is of commercial importance in greenhouse-grown petunias (2), and that late blight-infected petunias may serve as inoculum to tomatoes growing in the same greenhouse (1,2). In the Western Cape Province of South Africa, two petunia samples were received at the Stellenbosch University Plant Disease Clinic in 2005 that showed symptoms resembling P. infestans infections. The two samples were from nurseries where petunias were either grown under shading nets or in a greenhouse. In the greenhouse-grown petunias, the presumptive late blight infections resulted in substantial losses to the grower. Symptoms included gray, slightly sunken leaf lesions with white sporulation mainly on the adaxial side of the leaves. Leaflets of the petunias were incubated in moist chambers, and sporangia sporulating from lesions were identified morphologically as being P. infestans (3). Subsequently, one isolate was cultured onto synthetic media by carefully transferring sporangia from a lesion with the tip of a bended glass rod onto wheat medium (120 g/L of crushed wheat seeds, blended, boiled and filtered through cheesecloth, plus 15 g of sucrose and agar). The identity of the culture was further confirmed through sequence analyses of the internal transcribed spacer regions (GenBank Accession No. DQ479409). The isolated P. infestans strain (STE-U 6134) has been submitted to the Stellenbosch University culture collection. Inoculum for the pathogenicity tests was produced by first flooding 14-day-old cultures with sterile distilled water to obtain a 2 × 104/ml sporangial suspension, followed by zoospore induction at 4°C. A mixture of petunia cultivars (n = 24) were spray inoculated to runoff with the zoospore induced sporangial suspension. Control plants were sprayed with sterile distilled water. Inoculated plants were incubated at 22 to 25°C and high relative humidity (≥93%) within perspex humidity chambers (60 × 30 × 60 cm) lined with a wet sheet of chromatography paper. The experiment was repeated twice. The first late blight symptoms similar to those of the submitted samples appeared 5 to 7 days after inoculation, with some lesions containing profuse white mycelia and sporangiophores typical for P. infestans. The pathogen was reisolated from the leaf lesions, completing Koch's postulate. To our knowledge, this is the first report of P. infestans causing damage on petunias in South Africa. Future studies should be aimed at investigating whether late blight-infected petunias provide an important source of inoculum for potatoes and tomatoes, which are widely grown in the Western Cape Province of South Africa. References: (1) M. C. Becktell et al. Plant Dis. 89:1000, 2005. (2) K. L. Deahl and D. K. Farel. Plant Dis. 87:1004, 2003. (3) D. C. Erwin and O. K. Ribeiro, Phytophthora Diseases Worldwide. The American Phytopathological Society St. Paul, MN, 1996. (4) J. M. Hirst and W. C. Moore. Phytophthora infestans on petunia and datura. Page 76 in: Plant Pathology-A Record of Current Work on Plant Diseases and Pests. Vol. 6. Ministry of Agriculture, Fisheries and Food Plant Pathology Laboratory, Harpenden, England, 1957.
45
Bechini, Luca, Chiara Costamagna, Laura Zavattaro, Carlo Grignani, Jo Bijttebier und Greet Ruysschaert. „Barriers and drivers towards the incorporation of crop residue in the soil. Analysis of Italian farmers’ opinion with the theory of planned behaviour“. Italian Journal of Agronomy 10, Nr. 4 (03.12.2015): 178. http://dx.doi.org/10.4081/ija.2015.663.
Der volle Inhalt der QuelleAnnotation:
Despite the benefits arising from incorporating crop residue in the soil, some farmers decide to burn or sell it. The objective of the work described in this paper was to quantify the adoption of crop residue incorporation by Italian farmers, and to identify the barriers and drivers that they perceive towards this agricultural management practice. We applied a behavioural approach, based on the theory of planned behaviour. In agriculture, this theory can be used to study individual farmer beliefs to understand the intention to adopt agricultural management practices. Based on preliminary semi-structured interviews with 24 farmers, we have prepared and disseminated a structured questionnaire in dairy farms in the plain of northern Italy, in arable farms in the plain of northern, central, and southern Italy, and in arable farms in the hill of central and southern Italy. The questionnaire contained questions to reveal subjective beliefs of the farmers on the outcomes of incorporating crop residue, and on the referents and control factors that might influence adoption. We have received 315 filled questionnaires from 16 regions and 54 provinces. The survey has identified major drivers and barriers towards the incorporation of crop residue in the soil. The main drivers were the expected improvement of soil quality (higher soil organic matter, improved structure and fertility), the expected increase of grain protein concentration in the following wheat crop, the availability of adequate machinery, the prohibition of burning crop residue, and the knowledge that incorporation is important (which emphasizes the importance of an effective advisory service). The main barriers were the costs of incorporation, the need to increase the use of nitrogen fertiliser when straw is incorporated, and the problems to sow the following crop in the presence of residue. While on the basis of the preliminary interviews we expected that the possibility to sell the straw and the slow residue decomposition in the soil could be barriers against residue incorporation in the soil, questionnaire results did not confirm this expectation. The survey did not indicate that farmers are particularly worried about crop residue as potential sources of weeds, pests and diseases. Even if the methodology applied did not identify any of the referents as important barriers or drivers, there were important differences with respect to the perceived opinion of the social environment between adopters and non-adopters. This emphasizes the importance of an encouraging social environment for the propagation of good practices.
46
Lotz, Lambertus AP, Clemens CM van de Wiel und Marinus JM Smulders. „Genetic engineering at the heart of agroecology“. Outlook on Agriculture 49, Nr. 1 (März 2020): 21–28. http://dx.doi.org/10.1177/0030727020907619.
Der volle Inhalt der QuelleAnnotation:
We discuss whether genetic engineering and agroecology are compatible. For this, we investigated three cases of genetically engineered crops and considered agroecology as scientific discipline as well as a social movement. One case was the use of cisgenic modifications to make potato durably resistant to late blight, the second was the use of CRISPR/Cas to make rice resistant to bacterial blight and as a third case, we evaluated experiences with cultivating transgenic Bt crops. These cases demonstrated that genetic engineering offers opportunities to grow crops in novel integrated pest management (IPM) systems with, as direct benefit, a decrease in the use of chemical crop protection agents, and as indirect effect that the role of predators and biological control agents can become more important than in present conventional systems based on pesticides. We used a framework based on four concerns (both cons and pros) that were gathered from an extensive societal interaction organized around the Dutch research project DuRPh, which produced a proof-of-concept of a cisgenic late blight-resistant potato. We concluded that genetic engineering and agroecology certainly have synergy in the context of agroecology as science, when applied to making crops less vulnerable to pests and diseases and when combined with cultivation using IPM. By contrast, within the movement context, genetically engineered varieties may be welcomed if they include traits that contribute to successful IPM schemes and are socially benign. Whether they would actually be deemed desirable or acceptable will, however, vary depending on the norms and values of the social movements. We propose that some concerns may be reconcilable in a dialogue. Deontological arguments such as naturalness are more difficult to reconcile, as they relate to deeply felt ethical or cultural values. A step forward would be when also for these arguments everyone can make an informed choice and when these choices can coexist in a respectful manner.
47
Yang, C. D., X. R. Chen, H. X. Jiang und C. J. Pu. „First Report of Potato Gangrene Caused by Phoma foveata in China“. Plant Disease 96, Nr. 11 (November 2012): 1698. http://dx.doi.org/10.1094/pdis-06-12-0528-pdn.
Der volle Inhalt der QuelleAnnotation:
A potato tuber rot disease of unknown cause, affecting 5 to 15% of the potato tuber, was observed at Gansu Province of China in March 2010. Sunken, round, oval, or irregular lesions formed at the umbilicus or buds of potato tubers after 30 days of storage at 4°C. These lesions gradually expanded to form khaki, lavender sunken lesions ranging from 1 to 3 cm. Small black bodies were observed in the center of the lesions after 45 days. Twenty-six diseased tubers were collected and surface sterilized with 75% alcohol. Diseased tissue was then directly transferred to potato dextrose agar (PDA) medium for isolation of pathogenic fungi. Eight fungal isolates from disease tubers were obtained and pathogenicity was evaluated. Conidial suspensions (106 CFU/ml) of per isolate were sprayed on 20 potato tubers, respectively. These potato tubers were stabbed about 20 times with five wounds in a row along the tuber and maximum distance between each row. Wounds were made 2 mm deep and 0.5 mm in diameter with a no. 4 insect needle. Control tubers received water without conidia. The inoculated tubers were put in an incubator at 15°C after 72 h with relative humidity 100%. Assays were repeated three times. Typical symptoms of the disease were observed 14 days after inoculation. Pycnidia sharing the characteristics of the inoculated isolates were retrieved from new lesions after 6 weeks, whereas symptoms did not occur on control tubers. Eight isolates were cultured on PDA medium for 7 days at 20°C and then at 5°C for approximately 30 days to determine cultural and morphological characteristics. Pycnidia were black brown, spherical or oblate, scattered or clustered, and ranged from 82 to 210 × 64 to 175 μm. Conidia were unicellular and colorless, and 2.1 to 4.4 × 5.8 to 11.5 μm. Chlamydospores were spherical and 27 to 81 × 18 to 63 μm. The fungi shared morphological characteristics of P. foveata described in the literature. On oat medium (OA), yellow-green, needle-like crystals were formed. The growth rate of the pathogen on MA and OA was 1.0 cm/day. The pathogens were identified as P, foveata based on the symptoms, morphology, and growth rate (1, 2, 3). Genomic DNA was extracted with UNIQ-10 column fungal genomic DNA extraction kit and ribosomal DNA was amplified with ITS1(TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) primers. The nucleotide sequence of the 539-bp amplicon (GenBank Accession No. JQ804843) was 99% identical to the ITS sequence from P. foveata available from GenBank (GU237742). Management strategies for potato disease control must be adjusted for the presence and control of gangrene disease in Gansu Province. References: (1) G. H. Boerema et al. Page 220 in: Phoma Identification Manual. CABI Publishing, Wallingford, UK, 2004. (2) EPPO. Quarantine pests for Europe University Press, Cambridge. 865, 1997. (3) W. R. Stevenson et al. Page 25 in: Compendium of Potato Diseases, 2nd Edition. APS Press, St. Paul, MN, 2004.
48
Li, J., V. L. Gaskins, H. J. Yan, Y. G. Luo und W. M. Jurick II. „First Report of Mucor Rot on Stored ‘Gala’ Apple Fruit Caused by Mucor piriformis in Pennsylvania“. Plant Disease 98, Nr. 8 (August 2014): 1157. http://dx.doi.org/10.1094/pdis-02-14-0149-pdn.
Der volle Inhalt der QuelleAnnotation:
Mucor piriformis E. Fischer causes Mucor rot of pome and stone fruits during storage and has been reported in Australia, Canada, Germany, Northern Ireland, South Africa, and portions of the United States (1,2). Currently, there is no fungicide in the United States labeled to control this wound pathogen on apple. Cultural practices of orchard sanitation, placing dry fruit in storage, and chlorine treatment of dump tanks and flumes are critical for decay management (3,4). Cultivars like ‘Gala’ that are prone to cracking are particularly vulnerable as the openings provide ingress for the fungus. Mucor rot was observed in February 2013 at a commercial packing facility in Pennsylvania. Decay incidence was ~15% on ‘Gala’ apples from bins removed directly from controlled atmosphere storage. Rot was evident mainly at the stem end and was light brown, watery, soft, and covered with fuzzy mycelia. Salt-and-pepper colored sporangiophores bearing terminal sporangiospores protruded through the skin. Five infected apple fruit were collected, placed in an 80-count apple box on trays, and temporarily stored at 4°C. Isolates were obtained aseptically from decayed tissue, placed on potato dextrose agar (PDA) petri plates, and incubated at 25°C with natural light. Five single sporangiospore isolates were identified as Mucor piriformis based on cultural characteristics according to Michailides and Spotts (1). The isolates produced columellate sporangia attached terminally on short and tall, branched and unbranched sporangiophores. Sporangiospores were ellipsoidal, subspherical, and smooth. Chlamydospore-like resting structures (gemmae), isogametangia, and zygospores were not evident in culture. Mycelial growth was examined on PDA, apple agar (AA), and V8 agar (V8) at 25°C with natural light. Isolates grew best on PDA at rates that ranged from 38.4 ± 5.3 to 34.5 ± 2.41 mm/day, followed by AA from 30.5 ± 1.22 to 28.5 ± 2.51 mm/day, and V8 from 29.2 ± 3.0 to 26.7 ± 2.17 mm/day. Species-level identification was conducted by isolating genomic DNA, amplifying a portion of the 28S rDNA gene, and directly sequencing the products. MegaBLAST analysis of the 2X consensus sequences revealed that all five isolates were 99% identical to M. piriformis (GenBank Accession No. JN2064761) with E values of 0.0, which confirms the morphological identification. Koch's postulates were conducted using organic ‘Gala’ apples that were surface sanitized with soap and water, then sprayed with 70% ethanol and allowed to air dry. Wounds 3 mm deep were created using the point of a finishing nail and then inoculated with 50 μl of a sporangiospore suspension (1 × 105 sporangiospores/ml) for each isolate. Ten fruit were inoculated with each isolate, and the experiment was repeated. The fruit were stored at 25°C in 80-count boxes on paper trays for 14 days. Decay observed on inoculated ‘Gala’ fruit was similar to symptoms originally observed on ‘Gala’ apples from storage and the pathogen was re-isolated from inoculated fruit. This is the first report of M. piriformis causing postharvest decay on stored apples in Pennsylvania and reinforces the need for the development of additional tools to manage this economically important pathogen. References: (1) T. J. Michailides, and R. A. Spotts. Plant Dis. 74:537, 1990. (2) P. L. Sholberg and T. J. Michailides. Plant Dis. 81:550, 1997. (3) W. L. Smith et al. Phytopathology 69:865, 1979. (4) R. A. Spotts. Compendium of Apple and Pear Diseases and Pests: Second Edition. APS Press, St. Paul, MN, 2014.
49
Liefting, L. W., Z. Perez-Egusquiza und G. R. G. Clover. „First Report of Helleborus net necrosis virus in Hellebore in New Zealand“. Plant Disease 94, Nr. 4 (April 2010): 479. http://dx.doi.org/10.1094/pdis-94-4-0479b.
Der volle Inhalt der QuelleAnnotation:
Hellebores (Helleborus spp.) are widely grown in gardens for their winter and early spring flowers. They are extremely hardy and will grow easily in many different environments. In April 2009, black streaks on the leaves and stems were observed on approximately 3 to 5% of hellebores in a home garden in the Waikato Region, New Zealand. The symptoms appeared similar to those of ‘black death’, determined to be associated with a newly characterized carlavirus termed Helleborus net necrosis virus (HeNNV) (1). Transmission electron microscopy revealed the presence of typical carlavirus-like particles (slightly flexuous filaments ≈700 nm long) in crude sap extracts. Total nucleic acid was extracted separately from the leaves and stem from one of the symptomatic plants with an InviMag Plant DNA Mini Kit (Invitek GmbH, Berlin, Germany) and a KingFisher mL workstation (Thermo Scientific, Waltham, MA). One-step reverse transcription (RT)-PCR using carlavirus group-specific primers (Agdia Inc., Elkhart, IN) produced an amplicon of approximately 300 bp in both the leaf and stem samples. The PCR product was cloned into the pCR4-TOPO vector (Invitrogen, Carlsbad, CA) and three clones were sequenced. BLAST analysis of the consensus sequence (GenBank Accession No. GQ499837) showed the highest nucleotide identity (78%) to the replicase polyprotein genes of HeNNV strains I6 and G5 (GenBank Accession Nos. FJ196837 and FJ196836, respectively). A fragment of 376 bp was also amplified from the symptomatic plant by RT-PCR with primers HCV8484c and HCV8109, designed specifically to amplify the capsid protein genes and putative nucleic acid binding protein genes of HeNNV (1) and sequenced directly (GenBank Accession No. GQ499838). BLAST analysis showed the highest nucleotide identity (85%) with HeNNV strain G5 (GenBank Accession No. FJ196835) followed by 84% nucleotide identity with HeNNV strains H6 and I6 (GenBank Accession Nos. FJ196836 and FJ196837, respectively). Three asymptomatic hellebore plants purchased from a nursery tested negative by RT-PCR using the carlavirus group-specific and HeNNV-specific primers as described above. To our knowledge, this is the first report of HeNNV infecting hellebores in New Zealand. Hellebores are regularly imported into New Zealand as tissue cultures or nursery stock. The import requirement for acceptance of plants in tissue culture is visual inspection at the border. Nursery stock must be grown in a post-entry quarantine facility for 6 months during which time they are inspected for pests and diseases. The long latent period of HeNNV (1) and the recent discovery of the etiology of ‘black death’ could have resulted in accidental introduction of diseased plants. Knowledge of the causal agent of ‘black death’ is beneficial to growers who have already implemented cultural control strategies to reduce the spread of the disease. Most carlaviruses are aphid transmitted but no vector of HeNNV has been identified, and therefore, it is unknown if the virus spreads naturally in New Zealand. Reference: (1) K. C. Eastwell et al. Plant Dis. 93:332, 2009.
50
Pane, A., F. Raudino, S. Adornetto, G. Proietto Russo und S. O. Cacciola. „Blight of English Ivy (Hedera helix) Caused by Sclerotium rolfsii in Sicily“. Plant Disease 91, Nr. 5 (Mai 2007): 635. http://dx.doi.org/10.1094/pdis-91-5-0635a.
Der volle Inhalt der QuelleAnnotation:
English ivy, Hedera helix L. (Araliaceae), an evergreen climbing vine is widely cultivated as an ornamental and foliage plant. In the summer of 2005, a severe blight of ivy plants trained as topiaries and grown in an open field was observed in a nursery near Giarre (eastern Sicily). Foliage of infected plants appeared lighter green and progressively turned bronze and withered. Eventually, the entire plant collapsed. Foliar symptoms were associated with basal stem and root rot. White, cottony mycelium and numerous sclerotia developed externally on the lower stem and on the soil around the affected plants. The disease was randomly distributed, affecting approximately 5% of plants in a stock of 1,500 English ivy plants. Sclerotium rolfsii Sacc. (teleomorph Athelia rolfsii (Curzi) Tu & Kimbrough) was consistently isolated from symptomatic basal stem tissues by disinfecting in 1% NaOCl and plating on potato dextrose agar (PDA) amended with 100 mg/liter of streptomycin sulfate. The isolated fungus was identified on the basis of morphological and cultural characteristics (2). On PDA, it produced a densely, floccose, white mycelium. Mycelium was septate with clamp connections at hyphal septa. Optimum growth temperature was 30 ± 2°C. Numerous small (0.5 to 1.9 mm in diameter) sclerotia developed on the colony surface; they were spherical, occasionally slightly ellipsoidal, quite uniform in size (modal value of the diameter 1.4 mm), with a smooth surface. The surface color of the sclerotia was initially white, turned to pinkish buff, then to olive-brown, and eventually to clove brown as sclerotia matured. Sclerotia were most numerous in the center as well as close to the edge of petri dishes. Pathogenicity of one isolate obtained from infected plants was confirmed by inoculating 10 1-year-old potted English ivy plants by placing mycelium-infested wheat kernels and sclerotia on the soil surface around the collar of each plant. Ten noninoculated plants served as control. Plants were held in a dew chamber for 48 h at 28°C and subsequently placed in a greenhouse where the temperature ranged between 25 and 31°C. Plants showed wilting within 3 weeks after inoculation. Fans of white mycelium and numerous sclerotia were produced on the basal stem of inoculated test plants. Noninoculated controls remained healthy. S. rolfsii was reisolated from infected plants to fulfill Koch's postulates. English ivy has been already reported as a host of S. rolfsii, the causative agent of southern blight in nurseries of ornamentals (1). However, to our knowledge, this is the first report of southern blight on English ivy in Italy. The disease may have been favored by warm summer temperatures and overwatering with a drip irrigation system. References: (1) A. R. Chase. Compendium of Ornamental Foliage Plant Diseases. The American Phytopathological Society, St. Paul, MN, 1992. (2) J. E. M. Mordue. Corticium rolfsii. No. 410 in: Description of Pathogenic Fungi and Bacteria. CMI. Kew, Surrey, UK, 1974.