Thematische Bibliographien / United States. Crop Corps

Auswahl der wissenschaftlichen Literatur zum Thema „United States. Crop Corps“

Autor: Grafiati

Veröffentlicht am 27. Juli 2024

Zuletzt aktualisiert am 29. Juli 2024

Geben Sie eine Quelle nach APA, MLA, Chicago, Harvard und anderen Zitierweisen an

Wählen Sie eine Art der Quelle aus:

Machen Sie sich mit den Listen der aktuellen Artikel, Bücher, Dissertationen, Berichten und anderer wissenschaftlichen Quellen zum Thema "United States. Crop Corps" bekannt.

Neben jedem Werk im Literaturverzeichnis ist die Option "Zur Bibliographie hinzufügen" verfügbar. Nutzen Sie sie, wird Ihre bibliographische Angabe des gewählten Werkes nach der nötigen Zitierweise (APA, MLA, Harvard, Chicago, Vancouver usw.) automatisch gestaltet.

Sie können auch den vollen Text der wissenschaftlichen Publikation im PDF-Format herunterladen und eine Online-Annotation der Arbeit lesen, wenn die relevanten Parameter in den Metadaten verfügbar sind.

Zeitschriftenartikel zum Thema "United States. Crop Corps"

Wolkoff, Adam. „Every Man His Own Avenger: Landlord Remedies and the Antebellum Roots of the Crop Lien and Chattel Mortgage in the United States“. Law and History Review 35, Nr. 1 (05.12.2016): 131–54. http://dx.doi.org/10.1017/s0738248016000511.

Der volle Inhalt der Quelle

Annotation:

The crop lien was more than a strange fruit of emancipation, a hard-fought compromise, or a pragmatic choice. Its legal logic rested on several generations’ experience with capitalist social relations in the antebellum North, where intense pressures on land use in urban cores and their agricultural hinterlands promoted contestation and experimentation in the ancient body of landlord–tenant law. Northerners designed the crop lien as a way to disentangle contract from property: to strip the lease of its common law guarantee of exclusive possession and shift the burden onto tenants to bargain for it.1

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Isakeit, T., G. N. Odvody und R. A. Shelby. „First Report of Sorghum Ergot Caused by Claviceps africana in the United States“. Plant Disease 82, Nr. 5 (Mai 1998): 592. http://dx.doi.org/10.1094/pdis.1998.82.5.592a.

Der volle Inhalt der Quelle

Annotation:

In March 1997, ergot was found on sorghum (Sorghum bicolor (L.) Moench) regrowth in several abandoned commercial grain sorghum fields in Cameron and Hidalgo counties in the Lower Rio Grande Valley (LRGV) of Texas. White sphacelia in florets produced honeydew containing macrospores (hyaline, oblong to oval, 10 to 25 μm × 5 to 7 μm) and microspores (hyaline, spherical, 3 μm in diameter). Macrospores germinated iteratively to form secondary conidia when placed on water agar and in situ following rain. Secondary conidia were hyaline, pyriform, with a protruding hilum, and measured 10 to 17 μm × 5 to 7 μm. High-pressure liquid chromatography analysis detected the alkaloid di-hydroergosine in sphacelia, which is unique to C. africana (1). The pathogen was also confirmed on adjacent johnsongrass (S. halepense). The spread of ergot across Texas was associated with the progressive maturation of the commercial sorghum crop as follows: LRGV (mid-May), Coastal Bend near Corpus Christi (June), Winter Garden area southwest of San Antonio (July), and the seed production region of the Texas Panhandle (mid-August). Ergot incidence ranged from a trace to 10% of the heads in (self-fertile) grain sorghum fields of the LRGV. Most heads had only a few infected florets, but a few heads had 35 to 50% of the florets infected. Only trace amounts were found in grain sorghum fields in other areas of the state. Incidence and severity of ergot were greatest in fields of male-sterile sorghums grown for forage. Ergot was generally low in primary heads of male-sterile sorghums in hybrid seed production fields but, in the absence of pollen, axillary tillers sometimes developed high levels of ergot. The major impact of sorghum ergot is expected to be in hybrid seed production fields in the High Plains of Texas. Reference: (1) D. E. Frederickson et al. Mycol. Res. 95:1101, 1991.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Guaragna, M. A., J. Lamborn, D. Groth-Helms, S. Juszczak, D. Mollov, B. Lockhart, T. van Schadewijk, J. Hammond und R. Jordan. „First Report of Nerine yellow stripe virus in Amaryllis in the United States“. Plant Disease 97, Nr. 10 (Oktober 2013): 1389. http://dx.doi.org/10.1094/pdis-11-12-1042-pdn.

Der volle Inhalt der Quelle

Annotation:

Ornamental flower bulbs (including true bulbs, bulbils, corms, tubers, and rhizomes) are increasingly important floriculture crops. Amaryllis is a small genus of flowering bulbs, with two species. The South African native, Amaryllis belladonna, also known as belladonna lily, Jersey lily, naked lady, Amarillo, or March lily, is one of numerous ornamental species with the common name “lily” due to their flower shape and growth habit. Amaryllis are popular for their 6- to 10-inch trumpet shaped colorful flowers that are borne on 1- to 2-foot stalks. In January, 2011, a home gardener in California observed mosaic symptoms on the leaves of A. belladonna growing in her garden. Leaf samples were sent to Agdia Inc. for testing. Samples tested positive for the presence of Potyvirus in a reverse transcription (RT)-PCR screen using universal potyvirus primers (2) yielding the expected ∼1,600-bp product corresponding to the partial nuclear inclusion body (NIb) gene, full-length coat protein (CP) gene, and 3′ end untranslated region (UTR). Electron microscopy of symptomatic leaves confirmed the presence of filamentous potyvirus-like particles. The RT-PCR amplicon was cloned and sequenced (2); the 1,616-bp consensus sequence was deposited in GenBank (Accession No. JX865782). NCBI BLAST analysis of the consensus sequence revealed highest identities with isolates of Nerine yellow stripe virus (NeYSV; family Potyviridae, genus Potyvirus). Pair-wise analyses of the 261 amino acid sequence of the predicted CP had 88% sequence identity with a Stenomesson isolate reported from the Netherlands (EU042758); 87% identity with Hymenocallis and Nerine isolates, both also from the Netherlands (EF362622 and EF362621, respectively); and, 86% with two New Zealand isolates infecting Amaryllis or Vallota (FJ618537 and DQ407932, respectively). The five Netherlands and New Zealand isolates are more closely related to each other than to the U.S. isolate as they share 93 to 98% CP identity. When using viral genome sequence relatedness as a criterion for defining potyvirus species, isolates with CP amino acid identity greater than 80% are considered the same species (1). The predicted coat protein gene of the California isolate was sub-cloned into the bacterial expression vector pET44 EK/LIC. Serological analysis of coat protein expressing clones in ELISA and Western Blot analysis using a potyvirus broad-spectrum reacting monoclonal antibody PTY-2 (3) and a NeYSV-specific rabbit antiserum (Applied Plant Research, Lisse, The Netherlands) resulted in positive reactions. NeYSV has previously been reported in the United Kingdom, the Netherlands, Australia, and New Zealand. Based on the results of electron microscopy, RT-PCR, nucleotide and amino acid identity, and serological reactivity, we identify this virus as a U.S. isolate of NeYSV, NeYSV-US. To our knowledge, this is the first report of Nerine yellow stripe virus in the United States. Development of antisera specific to this U.S. isolate is in progress. References: (1) A. Gibbs and K. Ohshima. Ann. Rev. Phytopathol. 48:205, 2010. (2) R. L. Jordan et al. Acta Hortic. 901:159, 2011. (3) R. L. Jordan and J. Hammond. J. Gen. Virol. 72:1531, 1991.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Roberts, J. A., und L. P. Tredway. „First Report of Curvularia Blight of Zoysiagrass Caused by Curvularia lunata in the United States“. Plant Disease 92, Nr. 1 (Januar 2008): 173. http://dx.doi.org/10.1094/pdis-92-1-0173b.

Der volle Inhalt der Quelle

Annotation:

Symptoms of an unknown foliar blight have been observed in zoysiagrass (Zoysia matrella, Z. japonica, and hybrids) landscapes in North Carolina since 2002. Disease activity is most common during spring and summer when temperatures are between 21 and 30°C. Affected leaves initially exhibit small, chocolate brown spots, followed by dieback of leaves from the tips, and eventually blighting of entire tillers. Symptoms appear in small, irregular patches as much as 15 cm in diameter, but numerous patches may coalesce to impact large sections of turf. Infected turf appears tan or brown from a distance, but often turns black during periods of wet or humid weather. Microscopic analysis revealed profuse sporulation of Curvularia spp. on the surface of symptomatic leaves. Leaf sections were surface disinfested in 10% Clorox for 1 to 2 min, blotted dry, then plated on potato dextrose agar (PDA) containing 50 mg/l of tetracycline, streptomycin, and chloramphenicol. Twenty-eight fungal isolates were obtained from six locations. Examination of conidia produced in culture revealed 21 isolates of Curvularia, two isolates of Drechslera, one isolate of Nigrospora, and four unidentified sterile fungi. Curvularia isolates were identified to species on the basis of morphological characteristics (1) and ITS-rDNA sequences. Known isolates of C. eragrostidis, C. geniculata, C. inequalis, C. lunata, C. pallescens, and C. trifolii were obtained from the American Type Culture Collection for comparison. All unknown isolates produced conidia that were characteristic of C. lunata (lacking a protuberant hilum, smooth walled, tri-septate, predominantly curved, and mid- or dark brown, average dimensions 17 to 25 × 8 to 12 μm). Colonies on PDA lacked stroma or the zonate appearance indicative of C. lunata var. aeria. The pathogenicity of C. lunata isolates was tested on zoysiagrass cvs. El Toro (Z. japonica) and Emerald (Z. japonica × matrella). Cores (11.4 cm in diameter) of established zoysiagrass were potted in calcined clay (Turface Allsport; Profile Products LLC, Buffalo Grove, IL), and transferred to a greenhouse where the average temperature was 26°C. Five isolates were selected to represent the geographic range of Curvularia blight in North Carolina, and conidia were produced on PDA under continuous fluorescent illumination. Each isolate was inoculated to one pot of each zoysiagrass variety by spraying with 25 ml of a suspension containing 2 × 105 conidia/ml with an airbrush. Inoculated pots were placed in a sealed, nontransparent plastic container for 48 h at 28°C to encourage infection and then transferred back to the greenhouse bench. Pathogenicity tests were repeated four times over time. Isolates ZFB3 and ZFB28 were most virulent with initial symptoms of foliar dieback appearing within 1 week after inoculation. Continued disease progress resulted in necrosis of the entire plant. Other isolates induced symptoms within 2 to 3 weeks after inoculation; however, disease severity was lower as compared with ZFB3 and ZFB28 throughout each experiment. Cvs. Emerald and El Toro were equally susceptible to infection by C. lunata. To our knowledge, this is the first report of Curvularia blight of zoysiagrass in the United States. This disease was previously described in Japan where it is commonly referred to as ‘dog footprint’ (3) and Brazil (2). References: (1) M. B. Ellis. Dematiaceous Hyphomycetes. CMI, Kew, Surrey, UK, 1971. (2) F. B. Rocha et al. Australas. Plant Pathol. 33:601, 2004. (3) T. Tani and J. B. Beard. Color Atlas of Turfgrass Diseases. Ann Arbor Press, Chelsea, MI, 1997.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Sandoya, Germán, Abbas Lafta und Beiquan Mou. „Heat-tolerant Lettuce Germplasm (Lactuca sativa L.) Identified in Romaine and Butterhead Types for Warmer Plantings“. HortScience 59, Nr. 2 (Februar 2024): 151–63. http://dx.doi.org/10.21273/hortsci17368-23.

Der volle Inhalt der Quelle

Annotation:

Warmer temperatures during crop production are not desirable for a cool-season crop such as lettuce (Lactuca sativa L.). Lettuce is among the top 10 most consumed vegetables in the United States. Production of this vegetable is concentrated mostly in temperate areas of California, and during the wintertime in Arizona and Florida as a result of their mild climatic conditions. Heat-tolerant cultivars are needed for the leafy vegetable industry to continue thriving. However, there is very little information on heat-tolerant germplasms of lettuce that can be used as a source to improve heat tolerance in lettuce. This is particularly important in romaine and butterhead lettuce, which are two morphological types with increasing demand in the market. Therefore, research was conducted to identify germplasm that performs acceptably in warmer regions in the western United States. This investigation also aimed to understand the reaction of varieties to different environments, which could help plant breeders select and evaluate lettuce plants during the breeding process. Twenty-three and 25 accessions of romaine and butterhead lettuce, respectively, were planted in five trials near Holtville, CA, USA: Five Points, CA, USA, under warmer temperatures and Salinas, CA, USA, under cooler temperatures. Romaine genotypes Bambi, Blonde Lente a Monter, Medallion MT, and Red Eye Cos; and butterhead genotypes Butter King and Margarita had no bolting, an acceptable head weight, short cores, and acceptable head height. Head weight and related traits (including core length, height, width, etc.) and heat-related disorders were significantly different across multiple experiments, indicating genetic variation. The major component of the phenotypic variation in these experiments was a result of environmental factors. Therefore, plant breeders may still need to evaluate progeny in multiple trials and multiple locations to select heat-tolerant romaine and butterhead lettuce effectively.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Wintermantel, W. M., und D. Bachinsky. „First Report of Moroccan pepper virus in Association with Yellows on Escarole in the United States and the World“. Plant Disease 98, Nr. 10 (Oktober 2014): 1448. http://dx.doi.org/10.1094/pdis-04-14-0394-pdn.

Der volle Inhalt der Quelle

Annotation:

During the fall of 2013, endive (Cichorium endivia L.) and escarole (C. endivia ssp. latifolia) fields in New Jersey were found with severe disease symptoms. The cores of the heads were necrotic and rotted, while outer leaves were yellow with more pronounced yellowing of veins and occasional veinal necrosis. The disease occurred in plants grown in sandy loam soils, and developed following a period of extended soil moisture; most escarole and endive in the ground at that time developed symptoms. Similar symptoms have been observed for 15 to 20 years in the area and are commonly referred to as yellows. Initial ELISA tests (Agdia) identified tombusvirus infection in two composite samples of 10 plants each from two fields. To confirm tombusvirus infection and determine which tombusvirus was responsible, RNA was extracted from four plant samples using the RNeasy Plant Mini Kit (Qiagen). Complimentary DNA was synthesized using Maxima reverse transcriptase (Fermentas) and random primers. PCR was performed using GenScript enzymes (Genscript) and virus species specific primer sets designed to amplify a portion of the coat protein gene of either Tomato bushy stunt virus (TBSV) or Moroccan pepper virus (MPV) (2,3), the two tombusviruses responsible for a disease of lettuce that develops under similar environmental conditions. All samples tested negative for TBSV, but one sample of escarole was positive for MPV using primers MPVcp2766F 5′ CGGTAAGATTGTAGGGTTCATGGTGG 3′; and MPVcp3603R 5′ TGCTCCAGTGTCACGGAAGT 3′, which amplify an 837-nt section of the MPV coat protein gene. Direct sequencing confirmed 94% identity with an isolate of MPV from Japan (AB704411) and 97% identity to isolates from Morocco (JX197071) and California (JN700748) (3). Secondary confirmation was obtained with an additional primer set designed to amplify a 372-nt region of ORF1 of select tombusviruses (Tombus270F 5′ TGAGATACATGAGGACAGG 3′; and Tombus642R 5′ AGCTTAAATACCGACAGTT 3′). Direct sequencing confirmed 96 (AB704411) to 99% (JX197071) identity to MPV isolates from Japan and Morocco, respectively. Eight additional samples of symptomatic escarole from three farms were tested, and two samples reacted positive to MPV using the methods described above. Attempts at mechanical transmission of virus from escarole to known hosts of MPV were unsuccessful; however, transmission of MPV from infected lettuce (Lactuca sativa L.) is often low efficiency as well; therefore, this result was not surprising. To our knowledge, this is the first report of MPV in escarole anywhere in the world, and the first report of MPV in a United States field crop outside of California and Arizona. MPV and TBSV are known to cause the disease, lettuce dieback, in the western United States. Like yellows on escarole, lettuce dieback is associated with saturated soils (1) and other stress factors (Wintermantel, unpublished). Further studies will be needed to determine if MPV is the sole cause of yellows in escarole and endive or if it is part of a disease complex; however, the identification of MPV in this important leafy greens production region and its association with yellowing and core rot symptoms in escarole warrant further study of the association of MPV and potentially other tombusviruses with yellows of escarole. References: (1) C. Obermeier et al. Phytopathology 91:797, 2001. (2) W. M. Wintermantel and A. G. Anchieta. Arch. Virol. 157:1407, 2012. (3) W. M. Wintermantel and L. L. Hladky. Phytopathology 105:501, 2013.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Odvody, G. N., D. T. Rosenow und M. C. Black. „First Report of Ramulispora sorghicola in the United States Causing Oval Leaf Spot on Johnsongrass and Sorghum in Texas“. Plant Disease 90, Nr. 1 (Januar 2006): 108. http://dx.doi.org/10.1094/pd-90-0108a.

Der volle Inhalt der Quelle

Annotation:

Oval leaf spot (OLS) caused by Ramulispora sorghicola Harris was observed on grain sorghum, Sorghum bicolor (L.) Moench, and johnsongrass, S. halepense (L.) Pers., near Beeville, TX during August 2002. Symptoms were first observed on several sorghum lines and hybrids in a field nursery including a bulk planting of the line ATx623. Highest incidence of OLS occurred in rows adjacent to johnsongrass with symptoms of OLS. Average lesion size (mm) was 1.3 × 2.8 with a range from 0.5 to 2.5 × 1.5 to 5.0. Lesions had a straw-colored sunken center and on red- and purple-pigmented sorghums, lesion borders were highly pigmented. Cone-shaped conidial masses and superficial sclerotia (subglobose, black, 80 to 190 μm in diameter × 50 to 70 μm high, with spiny setae) were sometimes present or readily produced on lesions within 48 to 72 h after placement in humidity chambers. Conidia were branched, filiform, tapered, and 1.1 to 2.4 × 20 to 75 μm. The pathogen, R. sorghicola, was isolated from conidia and sclerotia. A water suspension of culturally derived conidia of R. sorghicola (3 × 104 conidia per ml) was spray inoculated (5:30 p.m., October 11, 2002) onto four or more upper leaves per plant of six grain sorghum plants (ATx623) and approximately nine johnsongrass plants (three tillers each of three plants) at a Corpus Christi field location where OLS was absent. Three grain sorghum and one johnsongrass plant were sprayed with a water control. Cloudy, wet, and cool conditions after inoculation and increasingly cooler nights probably delayed symptom expression until 3 to 4 weeks after inoculation. Typical lesions were observed simultaneously on both hosts with symptoms restricted to inoculated plants. Lesions from both hosts were placed onto water agar at 25°C for 24 h, and the pathogen was reisolated from field-produced conidia of rehydrated conidial masses. Through 2004, OLS was observed on sorghum hosts in 29 counties from central Texas to the Lower Rio Grande Valley. During the growing season, OLS was predominantly absent in grain and forage sorghum fields and absent or often difficult to detect in johnsongrass. In all 3 years, OLS was most common after the normal growing season from August through December with occurrence primarily on johnsongrass but also on late-planted and feral S. bicolor hosts, especially when proximal to symptomatic johnsongrass. Presence and incidence of OLS was highly variable between and within stands of johnsongrass with incidence ranging from a few to most plants. Incidence in forage or grain sorghum fields was highest at field borders adjacent to johnsongrass with OLS. Disease severity was low except on johnsongrass at a few locations. The pathogen appears to pose low economic risk to any sorghum host in Texas at any time of the year although highly susceptible lines and hybrids should be identified and possibly avoided. The previous most proximal report of R. sorghicola in the Western Hemisphere was in Honduras (1). The widespread distribution of OLS across southern Texas and its pattern of occurrence in johnsongrass suggest that the pathogen may have been unobserved in Texas for several years. Presence of OLS near the Rio Grande indicates probable occurrence in johnsongrass at least in some areas along this river in northeastern Mexico. Reference: (1) G. C. Wall et al. Trop. Pest Manag. 35:57, 1989.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Iriarte, F. B., H. C. Wetzel, J. D. Fry, D. L. Martin und N. A. Tisserat. „Genetic Diversity and Aggressiveness of Ophiosphaerella korrae, a Cause of Spring Dead Spot of Bermudagrass“. Plant Disease 88, Nr. 12 (Dezember 2004): 1341–46. http://dx.doi.org/10.1094/pdis.2004.88.12.1341.

Der volle Inhalt der Quelle

Annotation:

The distribution of three Ophiosphaerella spp. that cause spring dead spot (SDS) of bermudagrass was studied by sampling at 24 locations in the southeastern United States. O. korrae was isolated from 73% of the 204 bermudagrass cores collected and was the only SDS pathogen recovered at most sites. O. herpotricha was isolated at three locations in Kentucky and one in North Carolina, and O. narmari was found at two locations in North Carolina. Most O. korrae isolates collected from Alabama, Kentucky, Mississippi, Tennessee, and Virginia clustered in an amplified fragment length polymorphism group (AFLP group II) that was distinct from Kentucky bluegrass isolates collected throughout North America and similar to bermudagrass isolates from Kansas and Oklahoma (AFLP group I). A third AFLP group (III) consisting of bermudagrass isolates from Mississippi and Virginia was identified. Isolates representing AFLP groups II and III grew more rapidly on potato dextrose agar at 25 and 30°C than those in group I. O. korrae isolates differed in their aggressiveness to two bermudagrass cultivars in greenhouse studies, but these differences were not associated with AFLP group, location, or host from which the isolate was collected.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

McGroary, P. C., J. L. Cisar, R. M. Giblin-Davis, O. F. Ruiz und E. J. Nangle. „First Report of Plant-Parasitic Nematodes on Seashore Paspalum (Paspalum vaginatum) in Barbados“. Plant Disease 98, Nr. 7 (Juli 2014): 1018. http://dx.doi.org/10.1094/pdis-08-13-0832-pdn.

Der volle Inhalt der Quelle

Annotation:

Seashore paspalum (Paspalum vaginatum Swartz) is a warm-season perennial turfgrass commonly used for golf courses that are grown in saline environments or using saline water for irrigation. However, seashore paspalum is also grown in non-saline conditions due to its low fertilizer and water requirements (2). In Barbados, on a newly constructed golf course, seashore paspalum ‘Sea Isle Supreme’ sprigs were imported from Georgia (United States) and were planted over 2006 and 2007 on greens, tees, fairways, and rough. Golf greens were constructed following the United States Golf Association Green Section (Far Hills, NJ) putting green guidelines. Tees and fairways were constructed using native soil. Two years after the grow-in, the putting greens began to exhibit irregular chlorotic patches, followed by gradual thinning and decline of turfgrass stand density in those areas. Additionally, turfgrass roots sampled from those symptomatic patches appeared to be abbreviated compared to non-symptomatic areas of the greens. A survey was conducted in May 2013 to determine if plant-parasitic nematodes were present coinciding with the observed symptoms, which were similar to those described in a previous report (3). Consequently, two samples were collected from each green with a total of four greens sampled. Each sample consisted of 20 soil cores (15 cm depth × 1.2 cm in diameter) from either areas of the greens showing symptoms or from non-symptomatic areas. Nematodes were extracted from 100 cm3 soil samples using a modified centrifugal-sugar flotation technique (4). No plant parasitic nematodes were present in any of the samples from the non-symptomatic areas. Three genera of plant parasitic nematodes were found in all the samples from the symptomatic areas: Helicotylenchus. Mesocriconema, and Pratylenchus. Nematode populations of these genera averaged 30, 60, and 200 nematodes per 100 cm3, respectively. Populations of the genera Helicotylenchus and Mesocriconema were below the action threshold levels for seashore paspalum used by the University of Florida Nematode Assay Laboratory (1). Currently, no threshold exists for Pratylenchus for seashore paspalum. Conversely, the genera Helicotylenchus. Mesocriconema, and Pratylenchus were found associated with the irregular chlorotic patches but not with the non-symptomatic areas. To our knowledge, this is the first report of plant parasitic nematodes associated with seashore paspalum maintained as putting greens in Barbados. References: (1) W. T. Crow. Nematode management for golf courses in Florida. EDIS. Accessed 31 July 2013 from: http://edis.ifas.ufl.edu/in124 , 2001. (2) R. R. Duncan and R. N. Carrow. Seashore Paspalum: The Environmental Turfgrass. John Wiley & Sons, Inc., Hoboken, New Jersey, 2000. (3) A. C. Hixson and W. T. Crow. Plant Dis. 88:680, 2004. (4) W. R. Jenkins. Plant Dis. Rep. 48:692, 1964.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Peterson, Anne Palmer. „Academic conceptions of a United States Peace Corps“. History of Education 40, Nr. 2 (März 2011): 229–40. http://dx.doi.org/10.1080/0046760x.2010.526966.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Mehr Quellen

Dissertationen zum Thema "United States. Crop Corps"

Kelly, Patrick J. „United States Marine Corps Performance Pricing Model“. Thesis, Monterey, California : Naval Postgraduate School, 2009. http://edocs.nps.edu/npspubs/scholarly/theses/2009/Sep/09Sep%5FKelly.pdf.

Der volle Inhalt der Quelle

Annotation:

Thesis (M.S. in Operations Research)--Naval Postgraduate School, September 2009.
Thesis Advisor(s): Nussbaum, Daniel A. "September 2009." Description based on title screen as viewed on 6 November 2009. Author(s) subject terms: Maintenance, ground equipment, descriptive statistics, table of authorized material control number. Includes bibliographical references (p. 95). Also available in print.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Ramirez, Mark Park Dong Ho. „The Marine Corps enlisted assignment process : the customer's perspective /“. Monterey, Calif. : Springfield, Va. : Naval Postgraduate School ; Available from National Technical Information Service, 2003. http://library.nps.navy.mil/uhtbin/hyperion-image/03Mar%5FRamirez.pdf.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Harris, Kenneth G. „Restructuring the United States Navy Chaplain Corps“. Thesis, Monterey, Calif. : Springfield, Va. : Naval Postgraduate School ; Available from National Technical Information Service, 2005. http://library.nps.navy.mil/uhtbin/hyperion/05Sep%5FHarris.pdf.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Tivnan, Brian F. „Optimizing United States Marine Corps enlisted assignments“. Thesis, access online version, 1998. http://handle.dtic.mil/100.2/ADA355998.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

O'Brien, William E. „The effect of Marine Corps enlisted commissioning programs on officer retention“. Thesis, Monterey, Calif. : Springfield, Va. : Naval Postgraduate School ; Available from National Technical Information Service, 2002. http://library.nps.navy.mil/uhtbin/hyperion-image/02Jun%5FOBrien.pdf.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Fecteau, Ly T. „2002- analysis of the Marine Corps enlisted assignment process“. Thesis, Monterey, Calif. : Springfield, Va. : Naval Postgraduate School ; Available from National Technical Information Service, 2002. http://library.nps.navy.mil/uhtbin/hyperion-image/02Jun%5FFecteau.pdf.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Drexler, Jonathan A. „Enhancing persistence when optimally scheduling depot-level repair activity for the United States Marine Corps“. Thesis, Monterey, Calif. : Springfield, Va. : Naval Postgraduate School ; Available from National Technical Information Service, 2003. http://library.nps.navy.mil/uhtbin/hyperion-image/03Jun%5FDrexler.pdf.

Der volle Inhalt der Quelle

Annotation:

Thesis (M.S. in Operations Research)--Naval Postgraduate School, June 2003.
Thesis advisor(s): Gerald G. Brown, Alan R. Washburn. Includes bibliographical references (p. 59). Also available online.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Marshall, David Herman. „The Marine Corps subculture“. CSUSB ScholarWorks, 1995. https://scholarworks.lib.csusb.edu/etd-project/1145.

Der volle Inhalt der Quelle

Annotation:

This thesis analyzes the subculture within the United States Marine Corps. It attempts to bring the traditional literature of criminal subculture and the subculture of violence together with literature of occupational subculture to explain many of the behaviors exhibited by Marines.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Ulbrich, David J. „Thomas Holcomb and the advent of the Marine Corps defense battalion, 1936-1941“. Quantico, Va. : History and Museums Division, Marine Corps University, 2004. http://catalog.hathitrust.org/api/volumes/oclc/55759480.html.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Lamoureux, Gerard P. Forero Juan F. Martin Richard C. MartinezDiaz Alberto. „Navy/Marine Corps TACAIR integration : impact on operational and supporting activities /“. Monterey, Calif. : Springfield, Va. : Naval Postgraduate School ; Available from National Technical Information Service, 2003. http://library.nps.navy.mil/uhtbin/hyperion-image/03Dec%5FLamoureux.%5FMBA.pdf.

Der volle Inhalt der Quelle

Annotation:

Thesis (M.B.A.)--Naval Postgraduate School, December 2003.
"MBA professional report"--Cover. Joint authors: Juan F. Forero, Richard C. Martin, Jr., Alberto MartinezDiaz. Thesis advisor(s): Lawrence R. Jones, Jerry L. McCaffery. Includes bibliographical references (p. 33). Also available online.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Mehr Quellen

Bücher zum Thema "United States. Crop Corps"

Resources, United States Congress House Committee on Public Works and Transportation Subcommittee on Water. Proposed authorizations for the water resources development program of the U.S. Army Corps of Engineers: Hearings before the Subcommittee on Water Resources of the Committee on Public Works and Transportation, House of Representatives, One Hundred First Congress, second session, March 1, 7, 14; April 24, 1990. Washington: U.S. G.P.O., 1990.

Den vollen Inhalt der Quelle finden

APA, Harvard, Vancouver, ISO und andere Zitierweisen

David, Jack. United States Marine Corps. Minneapolis, MN: Bellwether Media, 2008.

Den vollen Inhalt der Quelle finden

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Corps, United States Marine. United States Marine Corps. [Washington, D.C: Marine Corps Division of Public Affairs, 1990.

Den vollen Inhalt der Quelle finden

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Cureton, Charles H. The United States Marine Corps. London: Greenhill Books, 1997.

Den vollen Inhalt der Quelle finden

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Cureton, Charles H. The United States Marine Corps. Philadelphia: Chelsea House Publishers, 2000.

Den vollen Inhalt der Quelle finden

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Portman, Michael. Marine Corps. New York: Gareth Stevens, 2011.

Den vollen Inhalt der Quelle finden

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Halberstadt, Hans. US Marine Corps. Osceola, Wis: Motorbooks International, 1993.

Den vollen Inhalt der Quelle finden

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Ricks, Thomas E. Making the Corps. New York, NY: Simon & Schuster, 1998.

Den vollen Inhalt der Quelle finden

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Cooke, Tim. US Marine Corps. New York: PowerKids Press, 2013.

Den vollen Inhalt der Quelle finden

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Gordon, Nick. U.S. Marine Corps. Minneapolis, MN: Bellwether Media, 2013.

Den vollen Inhalt der Quelle finden

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Mehr Quellen

Buchteile zum Thema "United States. Crop Corps"

Seaton, James B. „The United States Marine Corps“. In Understanding the U.S. Military, 91–107. London: Routledge, 2022. http://dx.doi.org/10.4324/9781003154877-9.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Mbata, G. N. „Cowpea: United States of America“. In Crop Post-Harvest: Science and Technology, Volume 2, 151–58. Oxford, UK: Blackwell Science Ltd, 2007. http://dx.doi.org/10.1002/9780470751022.ch7.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Mercier, Stephanie A., und Steve A. Halbrook. „Policy Spotlight: The Federal Crop Insurance Program“. In Agricultural Policy of the United States, 363–76. Cham: Springer International Publishing, 2020. http://dx.doi.org/10.1007/978-3-030-36452-6_21.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Miller, Fred P., Wayne D. Rasmussen und L. Donald Meyer. „Historical Perspective of Soil Erosion in the United States“. In Soil Erosion and Crop Productivity, 23–48. Madison, WI, USA: American Society of Agronomy, Crop Science Society of America, Soil Science Society of America, 2015. http://dx.doi.org/10.2134/1985.soilerosionandcrop.c3.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Johnson, J. „Dried Fruit and Nuts: United States of America“. In Crop Post-Harvest: Science and Technology, Volume 2, 226–35. Oxford, UK: Blackwell Science Ltd, 2007. http://dx.doi.org/10.1002/9780470751022.ch13.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Batie, Sandra S. „Direction and Politics of Soil Conservation Policy in the United States“. In Soil Erosion and Crop Productivity, 505–15. Madison, WI, USA: American Society of Agronomy, Crop Science Society of America, Soil Science Society of America, 2015. http://dx.doi.org/10.2134/1985.soilerosionandcrop.c27.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Brown, Patrick H. „Micronutrient Use in Agriculture in the United States of America“. In Micronutrient Deficiencies in Global Crop Production, 267–86. Dordrecht: Springer Netherlands, 2008. http://dx.doi.org/10.1007/978-1-4020-6860-7_11.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

McGuire, Frederick L. „Enter the Medical Service Corps.“ In Psychology aweigh! A history of clinical psychology in the United States Navy, 1900-1988., 49–53. Washington: American Psychological Association, 1990. http://dx.doi.org/10.1037/10069-006.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Sankula, Sujatha. „Crop Biotechnology in the United States: Experiences and Impacts“. In Plant Biotechnology, 28–52. Chichester, UK: John Wiley & Sons, Ltd, 2006. http://dx.doi.org/10.1002/0470021837.ch2.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Adams, Fred. „Crop Response to Lime in the Southern United States“. In Agronomy Monographs, 211–65. Madison, WI, USA: American Society of Agronomy, Crop Science Society of America, Soil Science Society of America, 2015. http://dx.doi.org/10.2134/agronmonogr12.2ed.c5.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Konferenzberichte zum Thema "United States. Crop Corps"

Haynes, S. R. „Institutional metrics for the United States Marine Corps“. In 36th Annual Hawaii International Conference on System Sciences, 2003. Proceedings of the. IEEE, 2003. http://dx.doi.org/10.1109/hicss.2003.1174603.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Broders, Kirk. „Status of bacterial leaf streak of corn in the United States“. In Proceedings of the 28th Annual Integrated Crop Management Conference. Iowa State University, Digital Press, 2017. http://dx.doi.org/10.31274/icm-180809-247.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Hart, Chad. „Sustainable production and distribution of bioenergy for the Central United States“. In Proceedings of the 21st Annual Integrated Crop Management Conference. Iowa State University, Digital Press, 2012. http://dx.doi.org/10.31274/icm-180809-85.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Spearow, W. H. „The practical application of the United States Marine Corps' common streamlined standalone electro-optical tester“. In 2010 IEEE AUTOTESTCON. IEEE, 2010. http://dx.doi.org/10.1109/autest.2010.5613629.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Mathew, Febina M., und Samuel G. Markell. „Insights into the Diaporthe/Phomopsis complex infecting soybeans in the United States“. In Proceedings of the 24th Annual Integrated Crop Management Conference. Iowa State University, Digital Press, 2014. http://dx.doi.org/10.31274/icm-180809-153.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Taylo, S. Elwynn. „Possible Influence of Global Warming on Climate Variability in the Central United States“. In Proceedings of the 1995 Integrated Crop Management Conference. Iowa State University, Digital Press, 1995. http://dx.doi.org/10.31274/icm-180809-518.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Parcell, William C. „EARLY GEOLOGIC RECONNAISSANCE OF THE SOUTHWESTERN UNITED STATES BY THE U.S. ARMY CORPS OF TOPOGRAPHICAL ENGINEERS“. In GSA Annual Meeting in Phoenix, Arizona, USA - 2019. Geological Society of America, 2019. http://dx.doi.org/10.1130/abs/2019am-338096.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Kniss, Andrew R. „Trends in diversity and relative toxicity of herbicide use in the United States“. In Proceedings of the 28th Annual Integrated Crop Management Conference. Iowa State University, Digital Press, 2016. http://dx.doi.org/10.31274/icm-180809-203.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Khedun, C. Prakash, und Clement D. D. Sohoulande. „Characteristics of Drought Events That Influence Crop Yield in the Southeastern United States“. In World Environmental and Water Resources Congress 2023. Reston, VA: American Society of Civil Engineers, 2023. http://dx.doi.org/10.1061/9780784484852.045.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Jacobs, Keri. „Perennial grasses for bioenergy in the central United States: Updates on economics and research progress“. In Proceedings of the 24th Annual Integrated Crop Management Conference. Iowa State University, Digital Press, 2013. http://dx.doi.org/10.31274/icm-180809-115.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Berichte der Organisationen zum Thema "United States. Crop Corps"

Mouat, David, Richard Jasoni, Judith Lancaster, Jessica Larsen, Pablo Marin, Jay Arnone und Erin Adams. Carbon Sequestration at United States Marine Corps Installations West. Fort Belvoir, VA: Defense Technical Information Center, Mai 2014. http://dx.doi.org/10.21236/ada605923.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Mulvihill, Brian T. The Ever-Changing United States Marine Corps Rifle Qualification. Fort Belvoir, VA: Defense Technical Information Center, Februar 2005. http://dx.doi.org/10.21236/ada507305.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Crean, Peter. Political Participation and the United States Army Officer Corps. Fort Belvoir, VA: Defense Technical Information Center, März 2012. http://dx.doi.org/10.21236/ada563669.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Williamson, John R. The United States Army Signal Corps: A Culturally Rich Organization. Fort Belvoir, VA: Defense Technical Information Center, Mai 1988. http://dx.doi.org/10.21236/ada202056.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Apte, Aruna, und Keenan Yoho. Analyzing Resources of United States Marine Corps for Humanitarian Operations. Fort Belvoir, VA: Defense Technical Information Center, August 2014. http://dx.doi.org/10.21236/ada612608.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

HEADQUARTERS MARINE CORPS WASHINGTON DC. United States Marine Corps Expeditionary Energy Strategy and Implementation Plan. Fort Belvoir, VA: Defense Technical Information Center, Februar 2011. http://dx.doi.org/10.21236/ada541407.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Bloss, Richard E. The Conflict Between the United States Army and Marine Corps. Fort Belvoir, VA: Defense Technical Information Center, April 2003. http://dx.doi.org/10.21236/ada414981.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Dodt, Robert C., und Jr. Tactical Ballistic Missile Defense for the United States Marine Corps. Fort Belvoir, VA: Defense Technical Information Center, April 1992. http://dx.doi.org/10.21236/ada262624.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Rathgeber, David G. The United States Marine Corps and the Operational Level of War. Fort Belvoir, VA: Defense Technical Information Center, Mai 1994. http://dx.doi.org/10.21236/ada284711.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Thomas, Gary L. United States Marine Corps Air-Ground Integration in the Pacific Theater. Fort Belvoir, VA: Defense Technical Information Center, März 1999. http://dx.doi.org/10.21236/ada424520.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Wir bieten Rabatte auf alle Premium-Pläne für Autoren, deren Werke in thematische Literatursammlungen aufgenommen wurden. Kontaktieren Sie uns, um einen einzigartigen Promo-Code zu erhalten!