Um die anderen Arten von Veröffentlichungen zu diesem Thema anzuzeigen, folgen Sie diesem Link: Test 3F.
Zeitschriftenartikel zum Thema „Test 3F“
Geben Sie eine Quelle nach APA, MLA, Chicago, Harvard und anderen Zitierweisen an
Machen Sie sich mit Top-50 Zeitschriftenartikel für die Forschung zum Thema "Test 3F" bekannt.
Neben jedem Werk im Literaturverzeichnis ist die Option "Zur Bibliographie hinzufügen" verfügbar. Nutzen Sie sie, wird Ihre bibliographische Angabe des gewählten Werkes nach der nötigen Zitierweise (APA, MLA, Harvard, Chicago, Vancouver usw.) automatisch gestaltet.
Sie können auch den vollen Text der wissenschaftlichen Publikation im PDF-Format herunterladen und eine Online-Annotation der Arbeit lesen, wenn die relevanten Parameter in den Metadaten verfügbar sind.
Sehen Sie die Zeitschriftenartikel für verschiedene Spezialgebieten durch und erstellen Sie Ihre Bibliographie auf korrekte Weise.
1
Akhtar, Muhammad Shoaib, Aziz-Ur Rehman, Haroon Arshad, Abdul Malik, Muheer Fatima, Tahira Tabassum, Abdul Rauf Raza et al. „In Vitro Antioxidant Activities and the Therapeutic Potential of Some Newly Synthesized Chalcones Against 4-Acetaminophenol Induced Hepatotoxicity in Rats“. Dose-Response 19, Nr. 1 (01.01.2021): 155932582199695. http://dx.doi.org/10.1177/1559325821996955.
Der volle Inhalt der QuelleAnnotation:
The lack of safety and efficacy of existing hepatoprotective agents urge the need to explore novel hepatoprotective agents. The research work was planned to study the therapeutic potential of some newly synthesized chalcones against 4-acetaminophenol induced hepatotoxicity in rats. Male albino rats (N = 30) were divided into 6 groups of 5 animals each i.e. group I; Toxic control (4-acetaminophenol), group II; normal control (Normal saline), group III; Positive control (silymarin; 50 mg/kg bw) and groups IV-VI (test groups) treated with 3 chalcone analogues i-e 3a, 3f & 3 g (100, 150, 150 mg/kg bw, respectively). All the study group animals were administered with 4-acetaminophenol to induce hepatotoxicity except normal control. Following hepatotoxicity induction, test group animals were administered with selected doses of test compounds and toxic group animals left untreated. Liver enzymes including ALT, AST, ALP and serum bilirubin were determined photometrically. Antioxidant activities of test compounds were also determined. Histopathological examination of liver biopsies was also carried out through H & E staining. The test chalcones (3a, 3f & 3 g) significantly decreased the levels of liver enzymes and serum bilirubin toward normal and the pattern of results in the test group animals were comparable to silymarin administered animals indicating the hepatoprotective potential of test compounds. Moreover, the test chalcones (3a, 3f & 3 g) antagonized the effect of 4-acetaminophenol and thus, raised the catalase (CAT) and superoxide dismutase (SOD) while decreased the malondialdehyde (MDA) in experimental animals. The test chalcones (3a, 3f & 3 g) on histological examination of liver showed improvement of tissue morphology. The study concluded that the tested compounds have antioxidant potential and may act as hepatoprotective agent. However, in-depth studies are required to validate their safety and to elucidate the exact mechanism of action.
2
Robin, Nicolas, Guillaume R. Coudevylle, Aymeric Guillot und Lucette Toussaint. „French translation and validation of the Movement Imagery Questionnaire-third version (MIQ-3f)“. Movement & Sport Sciences - Science & Motricité, Nr. 108 (2020): 23–31. http://dx.doi.org/10.1051/sm/2019035.
Der volle Inhalt der QuelleAnnotation:
Objectives: Imagery ability is a variable influencing the effectiveness of imagery practice that can be estimated by means of questionnaires. Among them, the Movement Imagery Questionnaire-Revised, translated and validated in French, is widely used by French speakers. However, it does not allow for the distinction between the two visual imagery perspectives (internal vs. external). The Movement Imagery Questionnaire-3 has been recently proposed in the English literature to differentiate between the ease of performing internal visual, external visual and kinesthetic imagery. The aim of this study was to translate and validate a French version of this questionnaire (MIQ-3f). Method: We examined the validity of constructs, internal consistency, and test-retest inter-rate reliability of the visual and kinesthetic items of the MIQ-3f in 272 healthy participants (Mage = 20.26 years, SD = 1.73). Results: The internal consistency (composite reliability scores ≥ 0.88 for the three subscales) and test-retest reliability (intraclass correlation coefficients: 0.87 for visual internal imagery, 0.86 for visual external imagery, and 0.88 for kinesthetic imagery) of the MIQ-3f were satisfactory. The three-factor structure (with 4 items for each factor) was supported by confirmatory factor analysis. The MIQ-3f appears to be a valid and reliable instrument that can be used to assess imagery ability in French speakers.
3
Sarkar, Biplab, und Anirudh Pradhan. „Choice of appropriate beam model and gantry rotational angle for low-dose gradient-based craniospinal irradiation using volumetric-modulated arc therapy“. Journal of Radiotherapy in Practice 16, Nr. 1 (04.11.2016): 53–64. http://dx.doi.org/10.1017/s146039691600042x.
Der volle Inhalt der QuelleAnnotation:
AbstractObjectivesWe aimed to assess the impact of advanced multileaf collimator (MLC) models and flattening filter-free (3F) beam in volumetric-modulated arc therapy (VMAT)-based craniospinal irradiation (CSI).MethodsCT scans of five medulloblastoma patients who previously received CSI at our hospital were used for the present study. Patients were planned for a prescription dose of 35 Gy to craniospinal axis. A three-dimensional conformal radiotherapy (3DCRT) plan and a VMAT plan using 1 cm MLC leaf width were generated as the gold standard (reference arm). Test VMAT plans were generated using Agility MLC model (MLC leaf width 5 mm) for various combinations of flattened beam (F) and 3F beam for treating the brain and spine planning target volume (PTV). Organs at risks (OARs) were analysed for dose 5, 50, 75 and 90% volumes, mean dose and maximum dose.ResultsAll 3DCRT plans and VMAT plans were aimed to cover 95% of PTV by at least 95% prescription dose. VMAT demonstrated lesser dose spillage than 3DCRT to body volume minus PTV (NTID: non tumor integral dose) for a dose threshold above 7·5 Gy. For the low-dose range (1–7 Gy), variation between the dose coverage between all VMAT plans (for either spine or brain PTV) was <1%. Intra-VMAT plan dose variation for all OAR’s for all tested parameters was <1 Gy. Average monitor unit (MU) difference among different VMAT plans ranged between 1·52 and 2·13 when normalised to 3DCRT MU. For VMAT plans, flat beam with 1 cm MLC showed the highest MU, whereas Agility MLC with 3F beam had the least MU values for intra-VMAT plans. No statistical significance variation (p) was observed in between reference arm and test arm plans except for mean dose and V107% for PTV spine. When compared between reference arm 3DCRT and test arm VMAT plans. For OAR’s, no statistical difference was observed between reference and test arm VMAT plans.ConclusionsReference arm plans and test arm plans exhibit no statistically significant difference. However, as compared with 3DCRT, VMAT plans are more conformal and produce lesser dose to OAR at the cost of higher delivered MU. 3F beams or finer width MLC’s (width <5 mm) have no advantage over the conventional 1 cm MLC and flat beam except that 3F beams have a shorter beam delivery time. This study demonstrate a significantly lesser spillage dose to NTID/body that of the reported literature, which is attributed to limited rotational arc length used for VMAT plans.
4
Mishra, Shweta, Debashree Das, Adarsh Sahu, Ekta Verma, Shailendra Patil, Ram Kishore Agarwal und Asmita Gajbhiye. „Electronegativity in Substituted-4(H)-quinazolinones Causes Anxiolysis without a Sedative-hypnotic Adverse Reaction in Female Wistar Rats“. Central Nervous System Agents in Medicinal Chemistry 20, Nr. 1 (03.03.2020): 26–40. http://dx.doi.org/10.2174/1871524920666191220112545.
Der volle Inhalt der QuelleAnnotation:
Objectives: In the current study, the synthesis, characterization, and neuropharmacology of quinazolinone tethered with aromatic (3a-3i) and heteroaromatic substitution (3j, 3k, and 3l) as effective anxiolytic agents are reported. Background: Anxiety and depression are often comorbid with neurological as well as other medical maladies. Clinically known anxiolytics (Benzodiazepines) are accompanied by untoward sedation and other CNS depressive actions. The quinazolinone moiety is a privileged pharmacophore with a wide pharmacological spectrum. Herein, the synthesis, characterization, and neuropharmacological evaluation of some 2-substituted quinazolinone derivatives are reported. Methods: The synthesized compounds were characterized using 1H-NMR and TLC analysis. Behavioral analysis was performed using EPM (Elevated Plus Maze), OFT (Open Field Test), PIST (Pentobarbital Induced Sleep Test), FST (Forced Swim Test) and PCPA (p-chlorophenyl alanine) bioassay. To further justify the therapeutic claim, systemic and neurotoxicological analysis of the most potent members of the series was performed using OECD mandated protocols. The studies showed that the compounds had a wide therapeutic window with >1000 mg/kg and >500 mg/kg LD50 and NOAEL, respectively. Results: The compounds with an electronegative group in the quinazolinone nucleus (3f, 3e, 3d, and 3c) induced anxiolysis devoid of sedative adverse reaction. Besides, anti-depressant efficacy of 3f, 3e, 3d, and 3c observed in rodents was a result of a decrease in anxiety level. It was found that the neurotoxicology of the potent members (3f, 3e, 3d, and 3c) advocated their wide therapeutic window with >1000 mg/kg LD50 and >5000 mg/kg NOAEL. Conclusion: Our findings of behavioral bioassays revealed that inducing an electronegative group into the quinazolinone nucleus yielded the most potent members of the series (3f, 3e, 3d, and 3c). The said compounds were found to produce anxiolysis and anti-depressive action without sedative-hypnotic side effects in rodent models. In summary, it can be stated that extending the studies in a clinical setting would furbish the contours of current anxiolytic therapy, especially in anxiety comorbid with medical maladies.
5
Andreeva-Gateva, P., J. Tchekalarova, K. Kamenova, M. Strokova-Stoilova, S. Chakar, R. Hadjiolova, V. T. Angelova und Sl Surcheva. „Aryl Hydrocarbon Receptors in Indole Derivative Treated Mice: Neuropharmacological Perspectives“. Acta Medica Bulgarica 48, Nr. 1 (01.04.2021): 25–33. http://dx.doi.org/10.2478/amb-2021-0004.
Der volle Inhalt der QuelleAnnotation:
Abstract Aim/objective. When applied in pharmacological doses, the indole derivative melatonin exhibits neuroactive and neuroprotective effects. Indoles and their metabolites, such as kynurenine, are ligands of aryl hydrocarbon receptors (AhR). This study aimed to evaluate the antiepileptic and analgesic activity of melatonin and two synthetic melatonin derivatives. The possible involvement of AhR and kynurenine in their neuropharmacological effects were also tested. Methods. The tested substances were: melatonin, two melatonin derivatives bearing aryl hydrocarbon moiety with either furyl or thienyl substitute (3e and 3f), and alpha naphthoflavone (ANF), an antagonist of AhR. After intraperitoneal injection of 30, 100, or 300 mg/kg of the tested agents for seven days, male mice ICR (25-30 g) were subjected to a corneal kindling seizure model. Two tests for analgesia, i.e., the hot plate test and the formalin test, were also applied. AhR and kynurenine concentrations were evaluated in brain homogenates. Results. Substances 3e and 3f demonstrated an antiepileptic activity comparable to that of melatonin. Some analgesic activity was also shown, albeit lower than that of melatonin in equivalent doses. For melatonin and 3f treated mice, dose-dependent increases in AhR and kynurenine levels in brain homogenates were recorded. The antagonist ANF neither blocks the antiseizure activity of the tested indoles, nor demonstrated analgesic activity. Conclusion. Melatonin and the two tested melatonin-aroylhydrazone derivatives bearing either furyl or thienyl substitute exhibit antiepileptic and analgesic activity. Our results did not support the involvement of AhR in the demonstrated neurobiological activity. Further studies are needed to elucidate their exact molecular mechanisms.
6
Jia, Chengshu, Bin Hu, Yingying Ji, Yourui Su, Guoqing Gong, Qihua Zhu und Yungen Xu. „Synthesis of Limonin Derivatives with Improved Anti-inflammatory and Analgesic Properties“. Letters in Drug Design & Discovery 17, Nr. 3 (27.03.2020): 285–99. http://dx.doi.org/10.2174/1570180816666181113102359.
Der volle Inhalt der QuelleAnnotation:
Background: Limonoids represent an important class of natural products which possess a broad range of biological activities. Albeit their enormous potentials as therapeutic candidates, they usually suffer from low bioavailability, poor aqueous solubility and relatively weak biological activities which result in significant challenges in the clinic applications. Therefore, the exploration and development of novel limonin derivatives with improved drug-like properties through the structural modifications recently have attracted great attention in the biological and medicinal chemistry field. Methods: Based on the structural modifications of C17-furan ring in limonin, a series of limonin derivatives was designed, synthesized and screened for their anti-inflammatory and analgesic activities in vivo. Results and Conclusion: Preliminary pharmacological studies revealed that most tested compounds exhibited more potent anti-inflammatory and analgesic efficacies than lead molecule limonin. Especially, for compound 3f, it exhibited a stronger anti-inflammatory effect than that of naproxen and comparable analgesic potency with aspirin. In the formalin test, 3f showed an obviously attenuated phase-II pain response which indicated that it may produce an anti-inflammatory effect in the periphery. Furthermore, the significantly low hERG inhibition (IC50 >100 μM) and high LD50 value of target molecule 3f further demonstrated it as a promising analgesic/anti-inflammatory candidate with excellent drug-like profiles.
7
Todić, Maida, Sanela Bakić, Begler Begović, Sanja Krošnjar und Irfan Zulić. „Food and water consumption in assessment of acute oral toxicity of HEPALIP FORTE in rats“. Bosnian Journal of Basic Medical Sciences 3, Nr. 4 (20.11.2003): 47–53. http://dx.doi.org/10.17305/bjbms.2003.3493.
Der volle Inhalt der QuelleAnnotation:
Body weight variations during toxicological testing can be one of the indicators of the test substance toxic effects. Data on food and water consumption are true indicators of the rate of growth of experimental animals (Stevens & Gallo, 1989). Daily recording of the food and water consumption was done during the acute toxicity testing of HEPALIP FORTE. The study was performed on Wistar rats. The active component of HEPALIP FORTE is EPL substance--essential phospholipids, a natural substance present in every living cell. Essential phospholipids in combination with vitamins have been used in the treatment of liver diseases, dyslipoproteinaemias and intoxications accompanied with liver failure. Statistical analysis of the body weight variations was performed separately, for males and females. The analysis failed to show any significant difference between the groups. There was a significant difference in water consumption between the male group 2M and female groups 3F and 2F in comparison with control groups. Statistical analysis of the variations of food consumption showed a significant difference in all male groups in comparison with control groups, and only in the 3F female group in comparison with a control group. Considering the absence of lethality and the lack of significant influence of the test substance on animal body weights, we concluded that the test substance was not acutely toxic in rats, if applied orally, in single doses of 300 mg/kg, 500 mg/kg and 1000 mg/kg. Significant differences found in food and water consumption suggest a need of their during the future chronic toxicity testing.
8
Yücel, Nazlı Turan, Derya Osmaniye, Ümmühan Kandemir, Asaf Evrim Evren, Özgür Devrim Can und Ümide Demir Özkay. „Synthesis and Antinociceptive Effect of Some Thiazole-Piperazine Derivatives: Involvement of Opioidergic System in the Activity“. Molecules 26, Nr. 11 (02.06.2021): 3350. http://dx.doi.org/10.3390/molecules26113350.
Der volle Inhalt der QuelleAnnotation:
In this study, we aimed to design and synthesize novel molecules carrying both the thiazole and piperazine rings in their structures and to investigate their antinociceptive activity. Targeted compounds were obtained by reacting thiosemicarbazide derivative and appropriate 2-bromoacetophenone in ethanol. The structures of the obtained compounds were determined using data from various spectroscopic methods (IR, 1H-NMR, 13C-NMR, and LCMSMS). Experimental data from in vivo tests showed that test compounds 3a–3c, 3f, and 3g (50 mg/kg) significantly prolonged reaction times of animals in tail-clip and hot-plate tests compared to the controls, indicating that these compounds possess centrally mediated antinociceptive activities. Furthermore, these compounds reduced the number of writhing behaviors in the acetic acid-induced writhing tests, showing that the compounds also possess peripheral antinociceptive activity. In the mechanistic studies, naloxone pre-treatments abolished the antinociceptive activities of compounds 3a–3c, 3f, and 3g, indicating that opioidergic mechanisms were involved in their antinociceptive effects. Molecular docking studies demonstrating significant interactions between the active compounds and µ- and δ-opioid receptor proteins supported the pharmacological findings. This study is the first showing that molecules designed to bear thiazole and piperazine moieties together on their structure exert centrally and peripherally mediated antinociceptive effects by activating the opioid system.
9
Collado-Mateo, Daniel, Francisco Javier Domínguez-Muñoz, Jose C. Adsuar, Jose A. Parraca, Pablo Tomas-Carus, Miguel Ángel Garcia-Gordillo und Armando M. Raimundo. „Test-Retest Intra-Session Reliability of Isokinetic Knee Strength Measurements in Obese Children“. Applied Sciences 10, Nr. 17 (26.08.2020): 5923. http://dx.doi.org/10.3390/app10175923.
Der volle Inhalt der QuelleAnnotation:
Background: Childhood obesity is one of the most critical global health challenges. Poor knee extensor strength is associated with disability and difficulties with physical function in obese patients. The objective of this study was to evaluate the test-retest reliability of peak torque and total work in concentric flexion and concentric extension in obese children. Methods: 25 obese children aged between 6 and 11 years performed 3F maximal unilateral isokinetic repetitions with the knee extensors/flexors performing concentric actions at 60°/s. Peak torque (Nm), total work (J), and the ratio antagonist/agonist were recorded and normalized by total and lean mass. The intraclass correlation coefficient (ICC), standard error of measurement (SEM), and smallest real difference (SRD) were computed. Results: Reliability was excellent for almost all variables. The highest ICC values were observed when work or peak torque were not divided by any other variable. However, SEM (%) and SRD (%) were lower when peak torque and work were divided by the total mass or lean mass. The antagonist/agonist ratio showed an ICC value of 0.873. Conclusion: Peak torque, total work, and the antagonist/agonist ratio are reliable in obese children.
10
Banarouei, Nasimossadat, Asghar Davood, Hamed Shafaroodi, Ghazaleh Saeedi und Abbas Shafiee. „N-arylmethylideneaminophthalimide: Design, Synthesis and Evaluation as Analgesic and Anti-inflammatory Agents“. Mini-Reviews in Medicinal Chemistry 19, Nr. 8 (23.04.2019): 679–87. http://dx.doi.org/10.2174/1389557518666180424101009.
Der volle Inhalt der QuelleAnnotation:
Background and Objective: N-aryl derivatives of phthalimide and 4-nitro phthalimide have demonstrated cyclooxygenase inhibitory activity. Also, they possess excellent analgesic and antiinflammatory activity. In this work, a new series of N-arylmethylideneamino derivatives of phthalimide and 4-nitro phthalimide were designed and synthesized. Methods: The designed compounds were synthesized by condensation of the appropriate aldehyde and N-aminophthalimide in ethanol at room temperature at PH around 3. Their analgesic and antiinflammatory activity were evaluated by acetic acid-induced pain test and carrageenan-induced paw edema test in mice and rats, respectively. Results and Conclusion:: The details of the synthesis and chemical characterization of the analogs are described. In vivo screening showed compounds 3a, 3b, 3f and 3h were the most potent analgesic compounds. In addition, compounds 3a, 3c, 3d, 3e and 3j indicated comparable anti-inflammatory activity to indomethacin as a reference drug.
11
Holt, Dayna M., Cindy Lewis, Kathy Klimpel, Christine Sloan und Claire Aguda. „The Effects of Focused Nursing Education on 3F Groshong™ PICC Occlusion Rates: The Experience of One Tertiary Pediatric Care Facility.“ Journal of the Association for Vascular Access 15, Nr. 4 (01.12.2011): 213–21. http://dx.doi.org/10.2309/java.15-4-6.
Der volle Inhalt der QuelleAnnotation:
Abstract OBJECTIVE: The primary aim of this project is to reduce the incidence of 3 Fr. Groshong™ PICC occlusions through focused nursing education. BACKGROUND: The use of Peripherally Inserted Central Catheters (PICC) has become an essential tool in the care of pediatric patients. The small lumen and long length of PICCs requires specialized skill and knowledge in proper care, maintenance and flushing in order to prevent catheter occlusion and other complications. Occluded catheters compromise patient care and increase costs. Reducing the incidence of catheter occlusion, will have a significant impact on the quality of patient care; patient, family and nursing satisfaction, patient outcomes, and costs. METHODS: A pre-test/post-test design using a convenience sample of all the core staff nurses working on the medical/surgical unit at a Southern California Children's Hospital was utilized. Objective measures included a written assessment of nursing knowledge, direct observations of nurses' flushing technique, and retrospective chart review to determine the rate of total catheter occlusion. RESULTS: Mean written test scores improved from 0.78 to 0.93 (p=0.00) Mean observation scores improved from 0.88 to 0.95, (p=0.004). The pre-test occlusion rate was 21.11/1000 catheter days. The post test occlusion rate was 15.49/1000 catheter days (p=0.057). CONCLUSION: Focused nursing education contributed to reducing 3F Groshong™ PICC occlusions and the associated costs due to PICC occlusions.
12
Rokhayati, Tri, Tukiran Tanuredja und Akhmad Jazuli. „PENGARUH PERMAINAN CROSSWORD PUZZLE TERHADAP MOTIVASI DAN HASIL BELAJAR PESERTA DIDIK SD IT HARAPAN UMAT PURBALINGGA“. Tunjuk Ajar: Jurnal Penelitian Ilmu Pendidikan 3, Nr. 1 (28.02.2020): 65. http://dx.doi.org/10.31258/jta.v3i1.65-76.
Der volle Inhalt der QuelleAnnotation:
This research purpose to knowing affected of: 1) crosswords puzzle learning to learn motivation at third class in Harapan Umat Elementary School IT Purbalingga, 2) crosswords puzzle learning to learn result in third class. The research method was an experiment, with two group treatments that were the control group and experiment group. Group control was 3C class and the experiment group was 3F class. Data using in this research were primary and secondary data. And then data be analyzed by the Independent Sample t-test. Result of the research has shown: 1) crosswords puzzle learning significant affected to learning motivation at third class in Harapan Umat Elementary School IT Purbalingga; and 2) crosswords puzzle learning affected to learning result at third class
13
Scheiber, S. M., Carol D. Robacker und Orville M. Lindstrom. „Stem and Leaf Hardiness of 12 Abelia Taxa“. Journal of Environmental Horticulture 20, Nr. 4 (01.12.2002): 195–200. http://dx.doi.org/10.24266/0738-2898-20.4.195.
Der volle Inhalt der QuelleAnnotation:
Abstract Twelve taxa of Abelia were evaluated using laboratory procedures to determine maximum stem and leaf hardiness and to evaluate timing of acclimation and deacclimation over a two-year period. Among the 12 Abelia taxa evaluated, ‘John Creech’ was among the hardiest taxa for both stems and leaves on the majority of test dates. Stems and leaves of ‘John Creech’ survived to at least −26C (−15F) and −21C (−6F), respectively, in January 2001. ‘Edward Goucher’ and ‘Confetti’ had the least hardy stems and leaves, respectively. Stems of ‘Edward Goucher’ survived to at least −16C (3F) in January 2000, and ‘Confetti’ leaves survived to only −14C (7F) in December 2000. Abelia × grandiflora consistently ranked among the first to attain cold hardiness in the fall and among the last to lose cold hardiness in the spring in both test seasons. Stems were equal in hardiness or hardier than leaves on the majority of test dates in both test seasons. Laboratory results were consistent with field observations, but often differed from published hardiness ratings. Differences in lowest survival temperatures and attainment and retention of cold hardiness closely followed temperature fluctuations just prior to sampling dates.
14
Saravanabhavan, Munusamy, Ambason Franklin Ebenazer, Venkatesan Murugesan und Marimuthu Sekar. „Synthesis, Spectroscopic Characterization and Biological Evaluation of 1-(4'-Hydroxybenzamido)-Imine-1,2,3,4-Tetrahydrocarbazole Derivatives“. Journal of Advanced Physics 6, Nr. 1 (01.03.2017): 30–40. http://dx.doi.org/10.1166/jap.2017.1286.
Der volle Inhalt der QuelleAnnotation:
A facile synthetic approach towards 1-(4'-hydroxybenzamido)-imine-1,2,3,4-tetrahydrocarbazole derivatives 3a–g was reported via reaction of 1-oxo-1,2,3,4-tetrahydrocarbazoles 1a–g, with p-hydroxybenzhydrazide in ethanol in the presence of sufficient amount of acetic acid. The structure of all the compounds was confirmed by spectroscopic studies. The antioxidant properties of all the derivatives have also been checked against DPPH and OH radicals. Further, in vitro anticancer activities of all the synthesized compounds were investigated by MTT assay method. All the prepared analogues exhibited considerable anticancer properties especially, 3e and 3f which reveled the best anticancer activity among all the test compounds. Additionally, we carried out molecular docking studies using the protein kinase CK2 inhibitors. In all the biological assays, halogen substituted carbazole derivatives showed enhanced activities than the other derivatives.
15
Yasar, Zerbu, Susan Dewhurst und Lawrence D. Hayes. „Peak Power Output Is Similarly Recovered After Three- and Five-Days’ Rest Following Sprint Interval Training in Young and Older Adults“. Sports 7, Nr. 4 (25.04.2019): 94. http://dx.doi.org/10.3390/sports7040094.
Der volle Inhalt der QuelleAnnotation:
(1) Background: High-intensity interval training (HIIT) exerts effects indicative of improved health in young and older populations. However, prescribing analogous training programmes is inappropriate, as recovery from HIIT is different between young and older individuals. Sprint interval training (SIT) is a derivative of HIIT but with shorter, maximal effort intervals. Prior to prescribing this mode of training, it is imperative to understand the recovery period to prevent residual fatigue affecting subsequent adaptations. (2) Methods: Nine older (6M/3F; mean age of 70 ± 8 years) and nine young (6M/3F; mean age of 24 ± 3 years) participants performed a baseline peak power output (PPO) test. Subsequently, two SIT sessions consisting of three repetitions of 20 s ‘all-out’ stationary cycling bouts interspersed by 3 minutes of self-paced recovery were performed. SIT sessions were followed by 3 days’ rest and 5 days’ rest on two separate occasions, in a randomised crossover design. PPO was measured again to determine whether recovery had been achieved after 3 days or after 5 days. (3) Results: Two-way repeated measure (age (older, young) × 3 time (baseline, 3 days, 5 days)) ANOVA revealed a large effect of age (p = 0.002, n2p = 0.460), with older participants having a lower PPO compared to young participants. A small effect of time (p = 0.702, n2p = 0.022), and a medium interaction between age and time (p = 0.098, n2p = 0.135) was observed. (4) Conclusions: This study demonstrates both young and older adults recover PPO following 3 and 5 days’ rest. As such, both groups could undertake SIT following three days of rest, without a reduction in PPO.
16
Tian, Tao, Hanli Wang, Sam Kwong und C. C. Jay Kuo. „Perceptual Image Compression with Block-Level Just Noticeable Difference Prediction“. ACM Transactions on Multimedia Computing, Communications, and Applications 16, Nr. 4 (28.01.2021): 1–15. http://dx.doi.org/10.1145/3408320.
Der volle Inhalt der QuelleAnnotation:
A block-level perceptual image compression framework is proposed in this work, including a block-level just noticeable difference (JND) prediction model and a preprocessing scheme. Specifically speaking, block-level JND values are first deduced by utilizing the OTSU method based on the variation of block-level structural similarity values between two adjacent picture-level JND values in the MCL-JCI dataset. After the JND value for each image block is generated, a convolutional neural network–based prediction model is designed to forecast block-level JND values for a given target image. Then, a preprocessing scheme is devised to modify the discrete cosine transform coefficients during JPEG compression on the basis of the distribution of block-level JND values of the target test image. Finally, the test image is compressed by the max JND value across all of its image blocks in the light of the initial quality factor setting. The experimental results demonstrate that the proposed block-level perceptual image compression method is able to achieve 16.75% bit saving as compared to the state-of-the-art method with similar subjective quality. The project page can be found at https://mic.tongji.edu.cn/43/3f/c9778a148287/page.htm.
17
Liu, Weipeng, Fuyan He, Wenke Yang, Zhizhou Yang, Jinshui Yao und Hui Zhao. „Study on the Thermal Properties and Enzymatic Degradability of Chiral Polyamide-Imides Films Based on Amino Acids“. Applied Sciences 9, Nr. 3 (10.02.2019): 578. http://dx.doi.org/10.3390/app9030578.
Der volle Inhalt der QuelleAnnotation:
Six kinds of chiral polyamide-imides (PAI3a–3f) have successfully been synthesized via direct polycondensation. The thermal properties of the materials were evaluated by the gravimetric analysis (TGA) and differential scanning calorimetry (DSC). A thermal test was conducted and showed that the polymers have good thermal stability. The Tg values were affected by the volume effect of the side groups, the internal plasticizing effect and the isolation effect. Polyamide-imides (PAIs) with L configuration showed higher Tg values than PAIs with D configuration. In the enzymatic degradation experiments of PAI films, the results showed that the structure of amino acids have the greatest influence on the degradation performance of PAIs relative to chirality. The PAI films with simple side groups and L configurations were easier to degrade. The degradation rate of natural chiral PAIs were higher than those of non-natural chiral PAIs. This makes it possible to develop polymer materials with specific degradation rates.
18
Yang, Xiang, Wen Jin, Wang Yi, Zhu Cheng‐xin, Zhu Yu‐lin, Liu Rong‐jun und Cao Feng. „Degradation of Al 2 O 3f /SiO 2 composites exposed to Na 2 SO 4 environment and MMH/N 2 O 4 bipropellants test“. International Journal of Applied Ceramic Technology 17, Nr. 5 (07.06.2020): 2114–22. http://dx.doi.org/10.1111/ijac.13528.
Der volle Inhalt der Quelle
19
Fernandez, Sophie, Chrystèle Charles-Delobel, Angèle Geldreich, Georges Berthier, Francine Boyer, Cécile Collonnier, Géraldine Coué-Philippe et al. „Quantification of the 35S Promoter in DNA Extracts from Genetically Modified Organisms Using Real-Time Polymerase Chain Reaction and Specificity Assessment on Various Genetically Modified Organisms, Part I: Operating Procedure“. Journal of AOAC INTERNATIONAL 88, Nr. 2 (01.03.2005): 547–57. http://dx.doi.org/10.1093/jaoac/88.2.547.
Der volle Inhalt der QuelleAnnotation:
Abstract A highly sensitive quantitative real-time assay targeted on the 35S promoter of a commercial genetically modified organism (GMO) was characterized (sF/sR primers) and developed for an ABI Prism® 7700 Sequence Detection System and TaqMan® chemistry. The specificity assessment and performance criteria of sF/sR assay were compared to other P35S-targeted published assays. sF/sR primers amplified a 79 base pair DNA sequence located in a part of P35S that is highly conserved among many caulimovirus strains, i.e., this consensus part of CaMV P35S is likely to be present in many GM events. According to the experimental conditions, the absolute limit of detection for Bt176 corn was estimated between 0.2 and 2 copies of equivalent genome (CEG). The limit of quantification was reached below 0.1% Bt176 content. A Cauliflower Mosaic Virus control (CaMV) qualitative assay targeted on the ORF III of the viral genome was also used as a control (primers 3F/3R) to assess the presence of CaMV in plant-derived products. The specificity of this test was assessed on various CaMV strains, including the Figwort Mosaic Virus (FMV) and solanaceous CaMV strains. Considering the performance of sF/sR quantification test, the highly conserved sequence, and the small size of the amplicon, this assay was tested in a collaborative study in order to be proposed as an international standard.
20
ME Shelke. „Synthesis and evaluation of newly1-substituted-(2H)-2-thio-4-(3-substitutedthiocarbamido-1-yl)-6-(2-imino-4-thio-5- substitutedbiureto-1-yl) 1, 2-dihydro-S-triazines as potent antimicrobial agents“. GSC Biological and Pharmaceutical Sciences 13, Nr. 3 (30.12.2020): 109–12. http://dx.doi.org/10.30574/gscbps.2020.13.3.0245.
Der volle Inhalt der QuelleAnnotation:
The search for novel antibiotics is of immense importance in research areas around the world for agricultural, pharmaceutical, and industrial applications. The s-triazines are widely used as an important biological tool for the production of a wide range of novel secondary metabolites. In the present study, the series of 1-substituted-(2H)-2-thio-4-(3- substitutedthiocarbamido-1-yl)-6-(2-imino-4-thio- 5- substitutedbiureto-1-yl) 1,2-dihydro-s-triazine [4a(i) to 4f(iii)] have been obtained by the isomerisation of 2-(2-imino-4-thio-5- substitutedbiureto-1-yl)-4-(3- substitutedthio-carbamido-1-yl)-6- substitutedimino-1,3,5-thiadiazine [3a(i) to 3f(iii)] in presence of ethanolic sodium bicarbonate solution. The later were synthesized by the chemical action of 1, 3-bis-(N-phenylamidinothiocarbamido)-thiocarbamide and aryl/alkylisocyanodichlorides. On the basis of IR, PMR spectrum data and elemental analysis, the structures of all these compounds were established. The synthesized s-triazine were analyzed for antimicrobial activities by cup plate diffusion method and exhibited a broad spectrum of antimicrobial activity against test pathogens. The isolate was tested for the ability to grow in the presence of antibiotic, such as ciprofloxacin at the same concentration. Thus, the study concludes with the eco-friendly route for synthesizing s-triazine with antibacterial activity against clinically important pathogens.
21
Vola, Marco, Juan Pablo Maureira, Vito Giovanni Ruggieri, Jean-François Fuzellier, Salvatore Campisi, Jean-Pierre Favre, Antoine Gerbay und Thierry A. Folliguet. „Proof of Concept of an Endoscopic Sutureless Valve Sizer“. Innovations: Technology and Techniques in Cardiothoracic and Vascular Surgery 11, Nr. 5 (September 2016): 337–41. http://dx.doi.org/10.1097/imi.0000000000000313.
Der volle Inhalt der QuelleAnnotation:
Objective In this paper, we present an endoscopic expandable sizer conceived to allow thoracoscopic aortic valve replacement with a sutureless prosthesis using a dynamic sizing of the aortic annulus. Methods Ten aortic torsos were prepared using a five-trocar thoracoscopic setting. Once the aortotomy was performed and the aortic valve leaflets removed, the technical feasibility of the endoscopic sizing (introduction into the trocar, expansion into the aortic annulus, determination of the valve size, and retraction) with the device was assessed. In case of successful thoracoscopic sizing, endoscopic implantation of a sutureless valve (five LivaNova Perceval prosthesis and five Medtronic 3f Enable bioprosthesis) was performed. Before ascending aorta closure, we assessed the appropriate sealing of the bioprosthesis in the native annulus with camera visualization and a nerve hook inspection. Results All the 10 endoscopic sizings were technically feasible. The scheduled aortic sutureless valve implantations were successfully performed. In all cases, fitting and placement of the sutureless bio-prosthesis in the flaccid heart was satisfactory, with no paraprosthetic leakage detectable by the nerve hook. Conclusions The use of the endoscopic expandable sizer is technically possible. In this early-stage test in the flaccid heart, selection of the valve size was satisfactory during thoracoscopic sutureless aortic bioprosthesis implantation. Further laboratory evaluation with fluid dynamics (aortic root pressurization) will be performed before a clinical study is started.
22
Minosse, Claudia, Daniele Lapa, Antonio Coppola, Federica Rapagna, Gianpiero D’Offizi, Chiara Taibi, Raffaella Lionetti, Maria Rosaria Capobianchi, Fiona McPhee und Anna Rosa Garbuglia. „Anti-HEV IgG Avidity Testing: Utility for Diagnosing Acute and Resolved Genotype 3 Infections“. Viruses 13, Nr. 2 (03.02.2021): 236. http://dx.doi.org/10.3390/v13020236.
Der volle Inhalt der QuelleAnnotation:
European Association of the Study of the Liver (EASL) guidelines specify HEV RNA, as well as anti-HEV IgG and IgM as positive markers for acute HEV infection. HEV RNA assay sensitivity limitations may lead to false negative test results in patients with low levels of viremia. Moreover, anti-HEV IgM positivity is not a reliable indicator for distinguishing between acute and resolved infections given the ability of this antibody to persist several months after a resolved infection. Our study aims were to assess HEV IgG avidity for diagnosing acute and resolved infections, regardless of the anti-HEV IgM serostatus, and examine assay reliability when evaluating different genotype 3 (GT3) HEV subtypes. Patient serum samples (n = 104) were tested for HEV IgG avidity by utilizing the DIA.PRO kit on a DSX automated instrument. Among patients identified with acute HEV infections, 32 were infected with GT3: GT3c (n = 5), GT3e (n = 8), 3f (n = 17) and GT3-unsubtyped (n = 2). Avidity sensitivity was 91.2% and specificity was 100%. For patients with long-lasting anti-HEV IgM persistence, an Avidity Index >70% was observed. Thus, the DIA.PRO avidity assay may be utilized to distinguish between recently acquired and resolved HEV GT3 infections. However, for equivocal results (Avidity Index > 40–70%), HEV RNA molecular testing will be required to confirm a recent infection.
23
Kumar, Rakesh, Ritika Sharma, Inder Kumar, Pooja Upadhyay, Ankit Kumar Dhiman, Rohit Kumar, Rakesh Kumar, Rituraj Purohit, Dinkar Sahal und Upendra Sharma. „Evaluation of Antiplasmodial Potential of C2 and C8 Modified Quinolines: in vitro and in silico Study“. Medicinal Chemistry 15, Nr. 7 (14.10.2019): 790–800. http://dx.doi.org/10.2174/1573406414666181015144413.
Der volle Inhalt der QuelleAnnotation:
Background: Malaria remains a common life-threatening infectious disease across the globe due to the development of resistance by Plasmodium parasite against most antimalarial drugs. The situation demands new and effective drug candidates against Plasmodium. Objectives: The objective of this study is to design, synthesize and test novel quinoline based molecules against the malaria parasite. Methods: C2 and C8 modified quinoline analogs obtained via C-H bond functionalization approach were synthesized and evaluated for inhibition of growth of P. falciparum grown in human red blood cells using SYBR Green microtiter plate based screening. Computational molecular docking studies were carried out with top fourteen molecules using Autodoc software. Results: The biological evaluation results revealed good activity of quinoline-8-acrylate 3f (IC50 14.2 µM), and the 2-quinoline-α-hydroxypropionates 4b (IC50 6.5 µM), 4j (IC50 5.5 µM) and 4g (IC50 9.5 µM), against chloroquine sensitive Pf3D7 strain. Top fourteen molecules were screened also against chloroquine resistant Pf INDO strain and the observed resistant indices were found to lie between 1 and 7.58. Computational molecular docking studies indicated a unique mode of binding of these quinolines to Falcipain-2 and heme moiety, indicating these to be the probable targets of their antiplasmodial action. Conclusion: An important finding of our work is the fact that unlike Chloroquine which shows a resistance Index of 15, the resistance indices for the most promising molecules studied by us were about one indicating equal potency against drug sensitive and resistant strains of the malaria parasite.
24
Zhong, Sheng, und LaDora V. Thompson. „The roles of myosin ATPase activity and myosin light chain relative content in the slowing of type IIB fibers with hindlimb unweighting in rats“. American Journal of Physiology-Cell Physiology 293, Nr. 2 (August 2007): C723—C728. http://dx.doi.org/10.1152/ajpcell.00009.2007.
Der volle Inhalt der QuelleAnnotation:
We tested the hypothesis that slowing of shortening velocity generated by type IIB fibers from hindlimb-unweighted (HU) rats resulted from a reduced ATPase activity and/or a reduction in the relative content of myosin light chain 3f isoform content (MLC3f). After 2, 3, and 4 wk of HU, maximal unloaded shortening velocity ( Vo) of single permeabilized semimembranosus muscle fibers was determined by the slack test. Subsequently, the myosin heavy chain and the relative content of MLC were determined by SDS-PAGE. The ratio of MLC3f to MLC2f was determined by densitometric analysis. In addition, myofibrils were prepared from permeabilized fibers (soleus and semimembranosus muscles) and assayed for resting myosin ATPase and Ca2+-activated myosin ATPase. After HU, Vo declined by 28–40% and the MLC3f/MLC2f ratio decreased by 32 to 48%. A significant correlation between the relative amount of MLC3f and Vo was found ( r = 0.48, P < 0.05). Resting myosin ATPase rates were not different between myofibrils prepared from corresponding muscles of control and HU rats ( P = 0.86). Ca2+-activated myosin ATPase activities also were not different between myofibrils prepared from corresponding muscles of control and HU rats ( P = 0.13). These data suggest that the slowing of maximal unloaded shortening velocity in type IIB fibers with HU is, at least in part, due to a relative change in the essential light chain composition, a decrease in the relative amount of MLC3f and most likely a concomitant increase in MLC1f. However, this reduction in Vo is independent of myosin ATPase activity.
25
Rechul, D., und K. Rechul. „0708 A Study To Determine Efficacy Of A Device In Anticipating Obstructive Sleep Apnea Events“. Sleep 43, Supplement_1 (April 2020): A269—A270. http://dx.doi.org/10.1093/sleep/zsaa056.704.
Der volle Inhalt der QuelleAnnotation:
Abstract Introduction Current treatment options for obstructive sleep apnea pose multiple challenges ranging from issues with therapy adherence (i.e. PAP) to partial effectiveness (i.e. MAD) or invasiveness (i.e. implantable nerve stimulation devices). SleepMethods, Inc. designed a device that proposed to solve these issues. It consisted of two integrated mechanisms; one to anticipate the development of an obstructive event and the other to deliver therapeutic intervention to abort the process of airway collapse before it ensued. A clinical trial was conducted to test the efficacy of the system designed to anticipate obstructive sleep apnea events. Methods Ten adults (7M;3F) aged 18-80y/o (avg. 54.7y/o) with a known AHI ≥ 15/hr (avg. AHI = 42.6/hr) underwent 1 overnight PSG recording while wearing the device. Patients were required to forego their usual CPAP therapy on the night of study in efforts to expose the device to an adequate number of total obstructive events (defined as apneas and hypopneas; RERAs and snores were excluded). Standard PSG analysis was performed. Scoring rules were applied to determine whether signals were true/false positives and/or true/false negatives based on pre-clinical data showing anticipation accuracy for up to 45 seconds prior to an obstructive airway event. Results Preliminary results suggest the device functions with 96.9% sensitivity and about 67.1% PPV. Data analysis is ongoing to determine specificity, statistical significance, etc. Conclusion The device has shown promise in pre-clinical and clinical trials to accurately and consistently anticipate airway collapse; a possible breakthrough in designing more targeted therapies aimed at aborting obstructive sleep apnea events before they ensue to a clinically significant degree. Support N/A
26
Jarazo, J., A. Gambini, L. Muredas, R. Fernandez-Martin und D. Salamone. „151 HORSE EMBRYO BIOPSY: EFFECT ON PREGNANCY RATES AND SUCCESSFUL SEX DETERMINATION DEPENDING ON THE SIZE OF THE EMBRYO“. Reproduction, Fertility and Development 25, Nr. 1 (2013): 224. http://dx.doi.org/10.1071/rdv25n1ab151.
Der volle Inhalt der QuelleAnnotation:
Commercial horse embryo transfer centers in certain parts of the world are in need of different procedures to streamline their production, for instance, by transferring only sexed embryos. A possible method to do so is PCR sex determination of biopsied embryos. The aim of this study was to (1) evaluate the impact of embryo biopsy on pregnancy rates with regard to embryo size; and (2) assess the feasibility of determining the sex of the embryo with that sample. Horse embryos were produced by artificial insemination. Embryos were recovered by transcervical uterine flush on day 7 after ovulation, packaged in a warm insulated container in holding medium and shipped for a 1-hour transit to the laboratory. Upon arrival, embryos were measured using an eyepiece. Embryos were classified into three different groups based on their size: I, 150–350 µm; II, 350–550 µm; III, >550 µm (the largest being 1316 µm). Biopsy was performed on the lid of a 60-mm petri dish filled with 4 mL of TALP-H on an inverted microscope. Embryos were held with a holding pipette and biopsied with a 15 ± 5 µm pipette with a 45° angle and a spike. Trophoblastic cells were aspirated (5–15 cells) and then placed in a 5-µL drop of TALP-H. Samples were placed in a 0.5-mL tube and frozen for PCR sex determination analysis. Biopsied embryos were shipped back to the center in 1-mL equilibrated DMEM/F12 with 10% FBS and 1% antiobiotic-antimycotic. Each embryo was immediately transferred transcervically to a synchronized recipient mare. Pregnancies were evaluated by transrectal ultrasound 7 days post-transfer and reassessed at Day 60. A nested PCR was performed using primers for sex-determining region Y (SRY, 1F ACATACCGTTCTCGGCTCTG, 4R CTTCCGACGAGGTCGATATT, 2R TCTGTGCCTCCTCGAAGAAT, and 3F ATCCCTACTTTGGACGAGCA) and amelogenin (AME, 1F CTTGCAGCCTCATCACCATA, 4R GAGGCAGGTCAGGAAGCATA, 2R GAATATCGGAGGCAGAGGTG, and 3F AACCAATGATGCCACTTCCT) to determine the sex of the embryo. The PCR products were evaluated by agarose gel. The presence of both products indicated that the embryo was male and the presence of amelogenin only that was female. No differences in amelogenin amplicon size between both sexes were detected. Results were compared using chi-square test (P < 0.05). No statistical differences were observed in pregnancy rates among groups (I: 13/22, 59.1%; II: 15/20, 75%; III: 10/19, 52.6%), although a slight tendency was observed towards an increase in the pregnancy rate when group II embryos were biopsied compared to group III (P = 0.14). Successful sex determination showed statistical differences between group II and the others (I: 10/22, 45.5%; II: 16/20, 80%; III: 8/19, 42.1%), given that more embryos from group II could be sexed. This work suggests that horse embryo viability after damaging the capsule is independent of the size of the embryo before the biopsy, although it might be easier to collect a proper sample of trophoblastic cells from embryos between 350 and 550 µm to determine their sex since smaller embryos collapsed rapidly during aspiration, and trophoblastic cells are tightly attached to one another in larger embryos.
27
Okamura, Ken, Kaori Sato, Hiroshi Ikenoue, Mizuho Nakagawa, Takeo Kuroda, Mototaka Yoshinari und Masatoshi Fujishima. „Primary hypothyroidism manifested in childhood with special reference to various types of reversible hypothyroidism“. European Journal of Endocrinology 131, Nr. 2 (August 1994): 131–37. http://dx.doi.org/10.1530/eje.0.1310131.
Der volle Inhalt der QuelleAnnotation:
Okamura K, Sato K, Ikenoue H, Nakagawa M, Kuroda T, Yoshinari M, Fujishima M. Primary hypothyroidism manifested in childhood with special reference to various types of reversible hypothyroidism. Eur J Endocrinol 1994;131:131–7. ISSN 0804–4643 The clinical courses of 15 patients with overt primary hypothyroidism manifested in childhood were studied. Nine female patients with goitrous hypothyroidism due to chronic thyroiditis showed almost normal height and became euthyroid spontaneously during iodine restriction. The other 6 non-goitrous patients (3M and 3F) (atrophic thyroiditis in 2, lingual goiter in 2 and probable hypoplastic thyroid in 2) showed physical growth retardation and remained irreversibly hypothyroid requiring replacement therapy. In the reversible group, the characteristic findings were high thyroidal radio-active iodine uptake (58 ± 19%/24 h, N = 8) and positive perchlorate discharge test. Serum non-hormonal iodine levels were high in 4 of 6 patients measured. During the long-term follow-up period of 6 years in 6 patients, 2 patients remained euthyroid with normal growth and regular menstrual cycle and 4 patients became hypothyroid again (after eating seaweed in 1, despite iodine restriction in 2 and after the episode of painless thyroiditis in 1). Transient retardation of growth was observed during the second episode of hypothyroidism. In the irreversible group, one patient with blocking type TSH binding inhibitor immunoglobulin (TBII) became thyrotoxic 4 years later with the decrease in activity of blocking type TBII. These results suggested that reversible recovery of the thyroid function could be expected in patients with juvenile hypothyroidism due to chronic thyroiditis after (1) iodine restriction, (2) improvement of immunological perturbation, or (3) disappearance of blocking type TBII. However, careful follow-up is necessary, because hypothyroidism would recur again with transient retardation of growth in children. Ken Okamura, Second Department of Internal Medicine, Faculty of Medicine, Kyushu University, 3-1-1 Maidashi, Higashiku, Fukuoka 812, Japan
28
Apolzan, John W., Owen T. Carmichael, Krystal M. Kirby, Sreekrishna R. Ramakrishnapillai, Robbie A. Beyl und Corby K. Martin. „The effects of the form of sugar (solid vs. beverage) on body weight and fMRI activation: A randomized controlled pilot study“. PLOS ONE 16, Nr. 5 (17.05.2021): e0251700. http://dx.doi.org/10.1371/journal.pone.0251700.
Der volle Inhalt der QuelleAnnotation:
Objective To test if sugar sweetened beverages (SSBs) and sugar sweetened solids (SSSs) have differential effects on body weight and reward processing in the brain. Methods In a single blind randomized controlled pilot trial (RCT), twenty participants with BMI between 20 and 40 kg/m2 were randomized to consume a 20 fluid ounce soda (SSB, 248 kcal) or the equivalent in solid form (SSS; similar to thick gelatin or gummy candy) daily. At baseline and day 28, fasting body weight and fed-state BOLD fMRI of the brain were assessed. Differences in fMRI signals between views of low-fat (LF (<30%)) high sugar (HS (>30%)) food, and non-food images were calculated in brain regions implicated in energy homeostasis, taste, and reward. Results All participants in the SSB (6F 4M; 8 Caucasian; 36±14 y, 28.2±5.5 kg/m2; Mean±SD) and SSS (3F 7M; 6 Caucasian; 39±12; 26.3±4.4) groups completed the study. Weight change was 0.27±0.78 kg between SSB and SSS participants. Changes in the fMRI response to LF/HS foods in reward, homeostatic and taste regions tended to not be different between the groups over the four weeks. However, activation of the right substantia nigra increased following the SSB but decreased activation following the SSS in response to LF/HS foods over 28 days (-0.32±0.12). Ratings of wanting for LF/HS foods were correlated with activation in several brain regions, including the OFC. Conclusions Change in weight was modest between the groups in this study. Daily consumption of a SSB over 28 days led to mixed responses to LF/HS foods in areas of the brain associated with reward. Ratings of wanting are correlated with fMRI activation inside an MRI scanner.
29
Wang, Xiujian, Tao Sun, Yongxian Hu, Xiao Liu, Jian Yu, Pengfei Xu, Guoqing Wei et al. „Chimeric Antigen Receptor T-Cell Therapy Shapes T Cell Repertoire in Chinese Patients with B-Cell Acute Lymphocyte Leukemia“. Blood 132, Supplement 1 (29.11.2018): 1413. http://dx.doi.org/10.1182/blood-2018-99-115780.
Der volle Inhalt der QuelleAnnotation:
Abstract Introduction: Chimeric antigen receptor (CAR) T-cell therapy has displayed potent anti-leukemia activity in refractory/relapsed acute lymphocytic leukemia (ALL). However, the influence of CAR-T therapy on host systemic and local immunity has not been well examined. We therefore applied high-throughput T cell receptor β chain sequencing to track dynamic change of T-cell repertoire in vivo induced by CAR-T therapy in B-cell acute lymphocytic leukemia patients. Patients and Methods: Six patients with 45 samples were under observation. The samples obtained to be tested were the peripheral blood mononuclear cell (PBMC) samples and bone marrow mononuclear cell (BMMC) samples before and after CAR-T administration, as well as the CAR-transduced autologous T cell samples on the day when they were to be infused to patients. The information of samples and patients was summarized in Table 1. The TCR full length mRNAs of these samples were deeply sequenced using the ImmunHubTM TCR profiling system (ImmunQuad Biotech). Briefly, a 5'RACE unbiased amplification protocol was used. An algorithm was applied to raw sequencing data for PCR and sequencing errors correction and V, D, J, C gene segments mapping with IMGT®. The inverse Simpson index and the clonality index was calculated to estimate TCRβ clonotype diversity and the state of clonal proliferation of T cells. The donut chart and clone tracking heat map were generated by R. Result: Compared to preinfusion TCR diversity, we observed inverse Simpson's index of 4 of 6 patients' PBMC samples (Fig. 1A) and of 3 of 4 patients' BMMC samples (Fig. 1B) had been increasing to day 7 after CAR-T treatment. As time went by, a decline of TCR diversity from day 7 to day 28 was detected in both PBMC and BMMC samples (Fig. 1). Of note, a relative rising tide of TCR diversity was observed after the decline in PBMC samples (Fig. 1A). The decreased TCR diversity leaded us to test the change of TCR clonality. As shown by Fig. 2A and 2B, in comparison with the pre-treatment and the CAR-T samples, we detected highly clonal proliferation of T cells in both blood and bone marrow. Next, we applied the clonality index to quantitatively define T cell clonal expansion (Fig. 2C and 2D). The clonality index was raised from 0.16±0.07 and 0.14±0.05 before treatment to 0.27±0.09 and 0.3±0.15 at last time point post infusion in PBMCs and BMMCs, respectively (mean ± SD, student's t test, P=0.03 and P=0.17, respectively).CAR-T-induced T-cell clonal expansion triggered us to trace back the original clonal source. For tracking clonal evolution, we selected the 100 most prevalent T cell clonotypes found at the last time point in both PBMCs and BMMCs and tracked their frequencies at earlier time points. As was displayed by the heat map, the top 100 T cell clones dominating in PBMCs and BMMCs at the last time point were barely found in CAR-T cell pool and were the low-frequency clonotypes in preinfusion samples (Fig. 3A and 3B). In order to quantitatively describe this phenomenon, we compared the total frequency of top 10 T cell clones in PBMC and BMMC samples at the last time point to their corresponding total frequency in preinfusion samples and the infused CAR-T pool (Fig. 3C, 3D, 3E and 3F). The total frequency of the top 10 T cell clones was 23%±11% and 27%±14% at last time point, 4%±6% and 8%±7% before treatment and 0.05%±0.09% and 0.01%±0.01% in the infused CAR-T samples in PBMCs and BMMCs, respectively (mean ± SD, Fig. 3C, 3D, 3E and 3F; student's t test, P=0.01, P=0.01, P=0.08 and P=0.03, respectively). Only one patient's (patient 6's) top 10 T cell clones in PBMCs at last time point were not found in both CAR-T pool and preinfusion sample, which may be caused by the limitation of sequencing detection (Fig. 3C). Conclusion: For the first time, we demonstrated CAR-T therapy could stimulate the clonal proliferation of endogenous non-CAR T cells in patients. Along with other groups' animal results (Barber A et al. J Immunol. 2009) indicating that CAR-T therapy could facilitate the infiltrating of tumor antigen-specific T cells, these expanded T cell clones of patients in our trial are most likely tumor antigen specific, which could provide synergistic anti-tumor effect following CAR-T adoptive transfer. The trial was registered in Chinese Clinical Trial Registry and the registration number is ChiCTR-OCC-15007008. Disclosures No relevant conflicts of interest to declare.
30
Rubio-Martinez, Araceli, Valle Recasens, Maria D. Odero, Daniel Rubio-Felix, Maria J. Calasanz, Pilar Mayayo, Manuel Giralt und Pilar Giraldo. „CML and Imatinib Mesylate: Response Related to Karyotype.“ Blood 106, Nr. 11 (16.11.2005): 4866. http://dx.doi.org/10.1182/blood.v106.11.4866.4866.
Der volle Inhalt der QuelleAnnotation:
Abstract Background: Imatinib mesylate (STI571), as a specific inhibitor for tyrosine kinase product of oncoprotein Bcr/Abl. Efficacy of Imatinib is questioned when other cytogenetics abnormalities associated to t(9;22) are present. We describe our experience in CML patients treated with Imatinib in one centre, evaluating hematological (HR) and cytogenetic response (CR) related to kariotype. Patients and methods: 28 patients diagnosed as having CML, 1990–2005, Imatinib 400–800 mg/d, were stratified according to cytogenetic abnormalities: Group A: t(9;22) typical in 19 patients, Group B: patients with t(9;22) and different genomic rearrangement associated: 9. At diagnosis were classified in stages Kantarjian score and the cytogenetic study (kariotype, % metaphases Ph, FISH and PCR/RT-PCR in bone marrow (BM) and peripheral blood (PB)). HR was evaluated monthly and CR in BM every 3–6 months. In patient with complete cytogenetic response (CCR) we performed follow-up in PB by RT-PCR every 3 months and a cytogenetic study in BM once a year. Cytogenetic response (CR) was quantified by n° metaphases Ph in BM: 0% CCR, 1–35% partial (PCR), 36–95% minor (MCR) and > 95% failure (F). Molecular response (MR): normal kariotype (Bcr/Abl negative and RT-PCR<5 copies). Statistical analysis: Chi-cuadrado and Kaplan-Meier survival test. Results: 18 M /10 F (2 died by blast crisis), mean age 50 (range 30–72), Kantarjian score: A group (4: 2pts, 3: 5pts, 2: 5pts, 1: 7 pts). Mean time on therapy: 26.46 m (1–51 ). Previous therapy: α-interferon 7, α-interferon/pegilated 1, α-interferon/α-interferon+citarabine 3, α-interferon+citarabine 6. Imatinib as first line: 11. When Imatinib started: accelerated phase 3, chronic phase 23 and chronic phase post-blast crisis2. The results of therapy are in table I. We have not observed statistically significant differences (s.s.d) in MR (p=.577) and in OS (p=.581) between group A and B with the same doses. Two patients that had started therapy with Imatinib 800 mg/day (group A) reached MR three months later. In group B one patient 12 months after got MR surprisingly developed a ALL Ph’, he received chemotherapy plus Imatinib 800 mg/day and 6 months later he is in CCR. Conclusions: Three months after Imatinib therapy HR was 100% in both groups. One year undergoing therapy CR response was higher in A group (81% vs 50%). Nevertheless the n° of MR obtained in patients with complex karyotypes receiving Imatinib 400 mg/day has been high (33.3%) and without s.s.d.with those with classical translocation. Hematological and Cytogenetic response to Imatinib Months N.E.P. A Group (19) N.E.P. B Group (9) 1 19 HR : 100% 9 HR :78% 3 10 HR:100%. CR 7 (70%): 4CCR(2MR), 2PRC, 1MRC, 3F. 3 HR: 100%. CR 2 (67%): 2MCR, 1F 6 16 HR: 94%. CR: 12 (75%), 7CCR (3MR), 3PRC, 2MCR, 4F 6 HR: 86%. CR 4 (67%): 3CCR, 1MCR, 2F 12 16 HR: 94%. CR 13 (81%): 11CCR (6MR), 2PRC, 3 F 4 HR: 100%. CR 2 (50%): 2CCR (1MR), 2F 18 13 HR: 100%. CR 12 (92%): 10CCR (6MR), 2PRC, 1F 5 HR: 80%. CR 3(60%): 3CCR (2 MR), 2F 24 13 HR: 93%. CR 12 (92%): 10CCR (7MR), 2PRC, 1F 6 HR: 83%. CR : 4 (67%): 3CCR (3 MR*), 1PRC, 2F 36 4 HR: 100%. CR 3 (75%): 2CCR (1MR), 1PRC, 1F 5 HR: 60%. CR 2 (40%): 2CCR (2MR), 3F 48 2 HR: 100%. CR 1 (50%): 1 PRC,1F 0 MR:N 10 (52,6%). Mean time : 12 m (3–24 m). Imatinib : 488,88 mg/d, Months in MR : mean 15.8 (9–21m) 3 (33.3%). Mean time : 18 months (12–26 m). Imatinib : 400 mg/day. Months in MR : mean 18 (12–26 m)
31
Santiago-Bassora, Fernanda Dutra, Aline Barnabé, Andrey dos Santos, Marcelo F. Carazzolle, Gonçalo AG Pereira, Fernanda Loureiro de Andrade Orsi, Erich V. de Paula und Joyce M. Annichino-Bizzacchi. „Increased Expression of Secretory Leukocyte Protease Inhibitor (SLPI) In Mononuclear Cells From Patients with Deep Vein Thrombosis“. Blood 118, Nr. 21 (18.11.2011): 1232. http://dx.doi.org/10.1182/blood.v118.21.1232.1232.
Der volle Inhalt der QuelleAnnotation:
Abstract Abstract 1232 Deep venous thrombosis (DVT) is a common and potentially fatal condition affecting 1% to 2% of the population worldwide, with an annual incidence of 1 in 500. Several studies have demonstrated the association between inflammation and DVT. In this study, we performed a comparative analysis of gene expression from mRNA extracted from leukocytes of 20 patients with previous DVT of the lower limbs (14F/6M; mean age: 39.7 years). An array of inflammation-related genes was selected for this study. Patients were divided in subgroups: (1) spontaneous DVT (n=10; 7F/3M). (2) risk factor-associated DVT (n=6; 4F/2M), in whom risk factor included oral contraceptive, pregnancy, protein C or S deficiencies, and FV Leiden heterozigosity. (3) Patients with antiphospholipid syndrome (APS)-associated DVT (n=4; 3F/1M). Nine healthy volunteers (7F/2M) were used as controls. Using bioarray technology, 60 upregulated (UR) and 56 downregulated (DR) genes were found in DVT patients when compared to healthy volunteers. UR genes were related to immune response, inflammation and proteolysis, and DR genes were related to transcription regulation, signal transduction and inflammation. Gene expression of the SLPI, Caspase-4 precursor (CASP4), Cartilage-associated protein precursor (CRATP) and eukaryotic translation elongation factor 1 alpha 2 (EEF1A2) presented the most significant differences in expression and were then analyzed by qPCR for validation of the results. Statistical analysis was performed by the Mann-Whitney test. No significant differences were confirmed in the expression of CASP4, CRTAP and EEF1A2 between patients and controls. However, a three-fold increased in the expression of SLPI was confirmed in DVT patients compared to controls (p=0.0381). Secretory leukocyte protease inhibitor (SLPI) is synthesized and secreted by mononuclear cells to the site of inflammation in response to cytokines and TNF. Increased SLPI expression could be a result of the inflammatory response that follows DVT. SLPI, a protease inhibitor, could function as a protective mechanism that could neutralize any excess protease load and protect host tissue. Further studies to investigate the role of SLPI in the pathogeneis of DVT and its complications are warranted. Disclosures: No relevant conflicts of interest to declare.
32
Burgess, Keith R., Samuel J. E. Lucas, Katie M. E. Burgess, Kate E. Sprecher, Joseph Donnelly, Aparna S. Basnet, Michael M. Tymko et al. „Increasing cerebral blood flow reduces the severity of central sleep apnea at high altitude“. Journal of Applied Physiology 124, Nr. 5 (01.05.2018): 1341–48. http://dx.doi.org/10.1152/japplphysiol.00799.2017.
Der volle Inhalt der QuelleAnnotation:
Earlier studies have indicated an important role for cerebral blood flow in the pathophysiology of central sleep apnea (CSA) at high altitude, but were not decisive. To test the hypothesis that pharmacologically altering cerebral blood flow (CBF) without altering arterial blood gas (ABGs) values would alter the severity of CSA at high altitude, we studied 11 healthy volunteers (8M, 3F; 31 ± 7 yr) in a randomized placebo-controlled single-blind study at 5,050 m in Nepal. CBF was increased by intravenous (iv) acetazolamide (Az; 10 mg/kg) plus intravenous dobutamine (Dob) infusion (2–5 μg·kg−1·min−1) and reduced by oral indomethacin (Indo; 100 mg). ABG samples were collected and ventilatory responses to hypercapnia (HCVR) and hypoxia (HVR) were measured by rebreathing and steady-state techniques before and after drug/placebo. Duplex ultrasound of blood flow in the internal carotid and vertebral arteries was used to measure global CBF. The initial 3–4 h of sleep were recorded by full polysomnography. Intravenous Az + Dob increased global CBF by 37 ± 15% compared with placebo ( P < 0.001), whereas it was reduced by 21 ± 8% by oral Indo ( P < 0.001). ABGs and HVR were unchanged in both interventions. HCVR was reduced by 28% ± 43% ( P = 0.1) during intravenous Az ± Dob administration and was elevated by 23% ± 30% ( P = 0.05) by Indo. During intravenous Az + Dob, the CSA index fell from 140 ± 45 (control night) to 48 ± 37 events/h of sleep ( P < 0.001). Oral Indo had no significant effect on CSA. We conclude that increasing cerebral blood flow reduced the severity of CSA at high altitude; the likely mechanism is via a reduction in the background stimulation of central chemoreceptors.NEW & NOTEWORTHY This work is significant because it shows convincingly for the first time in healthy volunteers that increasing cerebral blood flow will reduce the severity of central sleep apnea in a high-altitude model, without the potentially confounding effects of altering partial pressure of arterial carbon dioxide or the ventilatory response to hypoxia. The proposed mechanism of action is that of increasing the removal of locally produced CO2from the central chemoreceptors, causing the reduction in hypercapnic ventilatory response, hence reducing loop gain.
33
Wilkie, JS, und KN Winzenberg. „Synthesis of the Fungicides 1-[3-(Para-Tert-Butylphenyl)-2-Methylpropyl]Thiolanium Perchlorate and 1-[3-(Para-Tert-Butylphenyl)-2-Methylpropyl]Thianium Perchlorate“. Australian Journal of Chemistry 45, Nr. 2 (1992): 457. http://dx.doi.org/10.1071/ch9920457.
Der volle Inhalt der QuelleAnnotation:
Reaction of 4-[3-(p-t-butylpheny1)-2-methylpropylthio]butan-1-ol(3e) and 5-[3-(p-t-butyl-pheny1)-2-methylpropylthio]pentan-1-ol (3f), each prepared from p-t- butylbenzoic acid, with thionyl chloride followed by treatment with silver perchlorate afforded 1-[3-(p-t-butylphenyl)-2-methylpropyl ] thiolanium perchlorate (4b) and 1-[3-(p-t-butylpheny1)-2-methylpropyl] thianium perchlorate (4d), respectively.
34
Balar, Arjun Vasant, Gopa Iyer, Andrea Borghese Apolo, Ashley Marie Regazzi, Ilana Rebecca Garcia-Grossman, Deepa Pendse, Irina Ostrovnaya et al. „Phase II trial of neoadjuvant gemcitabine (G) and cisplatin (C) with sunitinib in patients (pts) with muscle-invasive bladder cancer (MIBC).“ Journal of Clinical Oncology 30, Nr. 15_suppl (20.05.2012): 4581. http://dx.doi.org/10.1200/jco.2012.30.15_suppl.4581.
Der volle Inhalt der QuelleAnnotation:
4581^ Background: Response to neoadjuvant chemotherapy (NC) prior to radical cystectomy (RC) predicts improved overall survival (OS) in MIBC. Associations with enhanced survival include complete pathologic response (pT0; Grossman, NEJM 2003) and eradication of the muscle-invasive component (<pT2; Splinter, J Urol 1992). Sunitinib (S) is active in pretreated pts with advanced disease. We tested if S added to GC was safe, improved the rate of pT0, and improved the rate of <pT2. Methods: Cisplatin-eligible pts with cT2-4aN0 bladder cancer received G 1000 mg/m2 and C 35 mg/m2 on day (D) 1 and D8 with S 25 mg orally daily D1-14 of a 21D cycle for 4 cycles. RC plus pelvic lymph node dissection was required to assess response of pT0 or <pT2. A Simon’s Minimax 2-stage design was used to test a null (H0) pT0 rate ≤ 20% against alternative (H1) pT0 rate ≥ 40% with Type I and II error rates of 0.05 and 0.10 respectively. Enrollment to the 2nd stage of 45 patients was planned if ≥ 6 of the initial 24 evaluable pts achieved pT0. Primary endpoint was pT0N0 and secondary endpoints were: response defined as <pT2N0; safety; time to progression (TTP), and OS. Results: 18 pts (15M, 3F), median age 63 (54-76) were enrolled from 6/09 and 10/11 after which financial support was withdrawn. 3 pts were inevaluable for response endpoints due to: 1.) withdrawal of consent, 2.) declining any surgery, 3.) partial cystectomy instead of RC. All 18 were evaluable for safety, TTP and OS. 1 of 15 pts had pT0N0 (6.6%; 95% CI 0.34 – 29.8%) and 5 had <pT2N0 (33%; 95% CI 15-58%). 4 of 5 pts with status <pT2N0 were pTisN0. Median TTP was 10 months (95% CI 3.5-NR). 3 pts were deceased at time of analysis; median OS not reached. Neutropenia due to the 3 drug combination required routine GCSF support on day 8 of each cycle. Grade 3/4 toxicities were anemia (11 pts), neutropenia (6), thromboembolic events (2), febrile neutropenia (2) and infection (2). Conclusions: Despite incomplete accrual, the pT0 rate was low suggesting that S does not add to GC. Residual non-invasive disease (<pT2) was common, including a large proportion of pts with pTisN0. Given these findings, response criteria for future NC studies should consider either <pT2 or < pTis as the primary endpoint.
35
de Freitas, Maria Cristina Foss, Baris Akinci, Adam Neidert, Rita Hench und Elif A. Oral. „Inhibition of Angiopoietin-Like 3 (ANGPTL3) Reduces Adipose Tissue Insulin Resistance in Patients With Familial Partial Lipodystrophy“. Journal of the Endocrine Society 5, Supplement_1 (01.05.2021): A50—A51. http://dx.doi.org/10.1210/jendso/bvab048.100.
Der volle Inhalt der QuelleAnnotation:
Abstract Familial partial lipodystrophy (FPLD) is a rare disease characterized by selective loss of peripheral subcutaneous fat, usually affecting the trunk and limbs, but preservation in other areas, such as the face and neck. It is usually associated with dyslipidemia and diabetes mellitus, and currently, there are no approved specific therapies for this disease in the US. Reductions in circulating levels of ANGPTL3 either by homologous loss-of-function mutations in humans or by pharmacological inhibition in rodents are associated with reductions in triglyceride (and other atherogenic lipid) levels and protect from atherosclerosis, making it an attractive target for patients with FPLD and metabolic dyslipidemia. We performed a proof-of-concept study to assess the early efficacy and safety of targeting ANGPTL3 via antisense oligonucleotide ISIS-703802 (vupanorsen) in a small number of patients with FPLD. Four patients with FPLD (3F/1M; age range: 39–48; 1 with LMNA R482Q, 1 with LMNA R584H, and 2 with no causative genetic variant), diabetes (HbA1c>6.5%) and hypertriglyceridemia (>250 mg/dL at screening) were included. Patients received the study drug at a subcutaneous dose of 20 mg weekly for 26 weeks. The primary endpoint was the change in triglycerides at week 27. Other end-points of interest measured at the same time points included insulin secretion, sensitivity, lipid and hormonal changes in response to a 5 hour long mixed meal test and body composition measured by dual energy absorptiometry (DEXA). Treatment resulted in a 59.9±26.3 (mean±SD) % of reduction in triglycerides, 54.7±9.8% of reduction in serum ANGPTL3 levels and 50.8±27.4% of reduction in ApoCIII. Treatment with vupanorsen led to a reduction of 209.3±120.4 in adipose tissue insulin resistance (ADIPO-IR) from a baseline of 470.3±114.3 and the area under the curve (AUC) for circulating free fatty acid levels were decreased by 32.1±21.4 mmol/L/min from a baseline of 215.8±55.2 mmol/L/min. Glucose AUC and triglyceride AUC also decreased after treatment (-14.0±5.2 and -60.1±26.5 mg/dL/min, respectively). Analyzing body fat distribution using DEXA, we observed that the fat mass index (FMI) and trunk mass index (TMI) did not change from baseline, but the ratio of total fat mass/ fat mass from limbs decreased by 10.7±12.2. These data show a tendency for redistribution of central body fat to limbs. There were numerous adverse events observed that were related to common serious complications associated with diabetes and FPLD. Although limited, these results suggest that targeting ANGPTL3 with vupanorsen in patients with FPLD may have a therapeutic role by addressing multiple problems.
36
Dmoszynska, Anna, Krzysztof Giannopoulos, Malgorzata Kowal, Monika Podhorecka, Paulina Wlasiuk, Agnieszka Bojarska-Junak, Wioletta Trzesniewska und Jacek Rolinski. „Clinical Efficacy and Safety of Combined Thalidomide and Fludarabine Therapy in B-Cell Chronic Lymphocytic Leukemia Patients.“ Blood 108, Nr. 11 (16.11.2006): 4975. http://dx.doi.org/10.1182/blood.v108.11.4975.4975.
Der volle Inhalt der QuelleAnnotation:
Abstract Background: Targeting the tumor microenvironment through modulation of cytokines is a potential way to treat B-CLL. Thalidomide (THAL) is an immunomodulatory agent with pleiotropic activities, reported to exert antitumor activity through downregulation of cytokines. THAL may enhance proapoptotic activity of fludarabine (F) with resultant improvement of clinical responses. This preliminary study assesses the efficacy and safety of THAL+F combined therapy in B-CLL patients with focus on immune responses. Patients and methods: Twelve patients (pts) were included in this study. Seven of them (5M, 2F) were newly diagnosed and 5 (2M, 3F) pts were refractory (ref) or relapsed (rel). The median age was 59, range 50–72 yrs. The increased Zap70/CD38 expression had 7/3 pts respectively. All pretreated pts had short lymphocyte doubling time < 6 months. Median prior lines of therapy were 3, range 2–4. THAL 100 mg po, alone was given for the first 7 days of cycle 1 and continued a la longue for 6 months, F 25 mg/m2 iv, was given for 5 days every 28 days for up to 6 cycles, starting on the seventh day after initiating THAL. Acetylsalicylic acid 75 mg was used to prevent venous thromboembolism. Cytokine levels of TNF, IL-2, IL-4 and IL-10 were assessed before, after THAL and after F treatment (D0, D7 and D12) using ELISA test. T regulatory cells were identified as CD4+CD25highFOXP3+ and assessed by FACS analysis. Results:. Median duration of follow-up was 5.5, range 2–7 months. Pts completed 1–5 cycles (mean: 3). In 3 heavily pretreated pts we stopped therapy due to disease progression. Other 9 pts achieved partial remission (7 pts) or stabilization of disease (2 pts). Directly after 1 cycle of therapy 11 pts showed reduction in WBC (Fig. 1). One patient with anemia was transfusion dependent and after 6 weeks of THAL became transfusion free. Interestingly, we have observed increasing levels of TNF during the treatment. Additionally increase in IL-2, IL-4 and IL-10 was observed. We noted significant reduction in absolute count of Treg cells after treatment with THAL (in 9 evaluated patients), that was enhanced in 7 by addition of F to the treatment (mean cells/mL: 315 before treatment, 100 after THAL and 81 after F). Toxicity: A flare reaction with tenderness and rash of involved lymph nodes was observed during the first cycle in 3 pts. Moderate side effects including constipation and fatigue were noted in all patients. No of them required the additional therapy or discontinuation of THAL+F regimen. Granulocytopenia with WHO grade 4 after the first 2 cycles was noted in 1 patient. Inflammatory complications of respiratory tract with WHO grade 2/3 occured in 3 pts following the first courses of THAL+F. Conclusions: Results of our study suggests that THAL combined with F demonstrated significant efficacy in B-CLL patients not only as a first line treatment but also as a salvage therapy with good safety profile. THAL+F regimen should be tested on a larger group of patients. Figure 1. White Blood Count (WBC) values for 12 patients treated with THAL + F at days 0, +7 and +12. Figure 1. White Blood Count (WBC) values for 12 patients treated with THAL + F at days 0, +7 and +12.
37
Kupczyk, Daria, Renata Studzińska, Szymon Baumgart, Rafał Bilski, Tomasz Kosmalski, Renata Kołodziejska und Alina Woźniak. „A Novel N-Tert-Butyl Derivatives of Pseudothiohydantoin as Potential Target in Anti-Cancer Therapy“. Molecules 26, Nr. 9 (29.04.2021): 2612. http://dx.doi.org/10.3390/molecules26092612.
Der volle Inhalt der QuelleAnnotation:
Tumors are currently more and more common all over the world; hence, attempts are being made to explain the biochemical processes underlying their development. The search for new therapeutic pathways, with particular emphasis on enzymatic activity and its modulation regulating the level of glucocorticosteroids, may contribute to the development and implementation of new therapeutic options in the treatment process. Our research focuses on understanding the role of 11β-HSD1 and 11β-HSD2 as factors involved in the differentiation and proliferation of neoplastic cells. In this work, we obtained the 9 novel N-tert-butyl substituted 2-aminothiazol-4(5H)-one (pseudothiohydantoin) derivatives, differing in the substituents at C-5 of the thiazole ring. The inhibitory activity and selectivity of the obtained derivatives in relation to two isoforms of 11β-HSD were evaluated. The highest inhibitory activity for 11β-HSD1 showed compound 3h, containing the cyclohexane substituent at the 5-position of the thiazole ring in the spiro system (82.5% at a conc. 10 µM). On the other hand, the derivative 3f with the phenyl substituent at C-5 showed the highest inhibition of 11β-HSD2 (53.57% at a conc. of 10 µM). A low selectivity in the inhibition of 11β-HSD2 was observed but, unlike 18β-glycyrrhetinic acid, these compounds were found to inhibit the activity of 11β-HSD2 to a greater extent than 11β-HSD1, which makes them attractive for further research on their anti-cancer activity.
38
Berthiaume, Sylvie L., Brian L. Bray, Petr Hess, Yanzhou Liu, Michael L. Maddox, Joseph M. Muchowski und Markus E. Scheller. „Synthesis of 5-substituted pyrrole-2-carboxaldehydes. Part I. Generation of formal 5-lithiopyrrole-2-carboxaldehyde equivalents by bromine–lithium exchange of 2-bromo-6-(diisopropylamino)-1-azafulvene derivatives“. Canadian Journal of Chemistry 73, Nr. 5 (01.05.1995): 675–84. http://dx.doi.org/10.1139/v95-086.
Der volle Inhalt der QuelleAnnotation:
The first known lithiated 1-azafulvene derivatives, e.g., 8 and 13a, were generated by a low-temperature bromine–lithium exchange procedure with tert-butyllithium. These lithio species show substantial stability at ≤ −90 °C because, at these temperatures, the sterically demanding 6-diisopropylamino moiety, unlike the dimethylamino group, completely inhibits nucleophilic addition to C-6. At higher temperatures, the addition of tert-butyllithium to C-6 is significant and it can become the dominant process. The lithio species 8 is a useful formal equivalent of 5-lithiopyrrole-2-carboxaldehyde since, on reaction with electrophilic reagents and subsequent hydrolysis, a wide variety of regiochemically pure 5-substituted pyrrole-2-carboxaldehydes is formed. The 6-dialkylamino-1-azafulvenes described herein exist predominantly or exclusively as the syn conformer in solution at room temperature. This conformational preference is confirmed by a significance NOE effect between H-4 and H-6 in the parent diisopropylamino compound 3f. The origin of the syn conformational preference stems from a substantial contribution of the charge-separated form 16 to the ground state structure of these compounds, a phenomenon that is strongly supported by variable temperature NMR measurements on 2-bromo-6-diisopropylamino-1-azafulvene (3c). Keywords: 2-bromo-6-diisopropylamino-1-azafulvenes, stereochemistry, lithiation, pyrrole-2-carboxaldehydes.
39
Chaand, Mudit, Chris Fiore, Brian T. Johnston, Diane H. Moon, John P. Carulli und Jeffrey R. Shearstone. „Chromatin Accessibility Mapping of Primary Erythroid Cell Populations Leads to Identification and Validation of Nuclear Factor I X (NFIX) As a Novel Fetal Hemoglobin (HbF) Repressor“. Blood 134, Supplement_1 (13.11.2019): 812. http://dx.doi.org/10.1182/blood-2019-124337.
Der volle Inhalt der QuelleAnnotation:
Human beta-like globin gene expression is developmentally regulated. Erythroblasts (EBs) derived from fetal tissues, such as umbilical cord blood (CB), primarily express gamma globin mRNA (HBG) and HbF, while EBs derived from adult tissues, such as bone marrow (BM), predominantly express beta globin mRNA (HBB) and adult hemoglobin. Human genetics has validated de-repression of HBG in adult EBs as a powerful therapeutic paradigm in diseases involving defective HBB, such as sickle cell anemia. To identify novel factors involved in the switch from HBG to HBB expression, and to better understand the global regulatory networks driving the fetal and adult cell states, we performed transcriptome profiling (RNA-seq) and chromatin accessibility profiling (ATAC-seq) on sorted EB cell populations from CB or BM. This approach improves upon previous studies that used unsorted cells (Huang J, Dev Cell 2016) or that did not measure chromatin accessibility (Yan H, Am J Hematol 2018). CD34+ cells from CB and BM were differentiated using a 3-phase in vitro culture system (Giarratana M, Blood 2011). Fluorescence-activated cell sorting and the cell surface markers CD36 and GYPA were used to isolate 7 discrete populations, with each sorting gate representing increasingly mature, stage-matched EBs from CB or BM (Fig 1A, B). RNA-seq analysis revealed expected expression patterns of the beta-like globins, with total levels increasing during erythroid maturation and primarily composed of HBB or HBG transcripts in BM or CB, respectively (Fig 1C). Erythroid maturation led to progressive increases in chromatin accessibility at the HBB promoter in BM populations. In CB-derived cells, erythroid maturation led to progressive increases in chromatin accessibility at the HBG promoters through the CD36+GYPA+ stage (Pops 1-5). Chromatin accessibility shifted from the HBG promoters to the HBB promoter during the final stages of differentiation (Pops 6-7), suggesting that HBG gene activation is transient in CB EBs (Fig 1D). Hierarchical clustering and principal component analysis of ATAC-seq data revealed that cell populations cluster based on differentiation stage rather than by BM or CB lineage, suggesting most molecular changes are stage-specific, not lineage-specific (Fig 2A, B). To identify transcription factors driving cell state, and potentially beta-like globin expression preference, we searched for DNA binding motifs within regions of differential chromatin accessibility and found NFI factor motifs enriched under peaks that were larger in BM relative to CB (Fig 2C). Transcription factor footprinting analysis showed that both flanking accessibility and footprint depth at NFI motifs were also increased in BM relative to CB (Fig 2D). Increased chromatin accessibility was observed at the NFIX promoter in BM relative to CB populations, and in HUDEP-2 relative to HUDEP-1 cell lines (Fig 2E). Furthermore, accessibility at the NFIX promoter correlated with elevated NFIX mRNA in BM and HUDEP-2 relative to CB and HUDEP-1, respectively. Together these data implicated NFIX in HbF repression, a finding consistent with previous genome-wide association and DNA methylation studies that suggested a possible role for NFIX in regulating beta-like globin gene expression (Fabrice D, Nat Genet 2016; Lessard S, Genome Med 2015). To directly test the hypothesis that NFIX represses HbF, short hairpin RNAs were used to knockdown (KD) NFIX in primary erythroblasts derived from human CD34+ BM cells (Fig 3A). NFIX KD led to a time-dependent induction of HBG mRNA, HbF, and F-cells comparable to KD of the known HbF repressor BCL11A (Fig 3B-D). A similar effect on HbF was observed in HUDEP-2 cells following NFIX KD (Fig 3E). Consistent with HbF induction, NFIX KD also increased chromatin accessibility and decreased DNA methylation at the HBG promoters in primary EBs (Fig 3F, G). NFIX KD led to a delay in erythroid differentiation as measured by CD36 and GYPA expression (Fig 3H). Despite this delay, by day 14 a high proportion of fully enucleated erythroblasts was observed, suggesting NFIX KD cells are capable of terminal differentiation (Fig 3H). Collectively, these data have enabled identification and validation of NFIX as a novel repressor of HbF, a finding that enhances the understanding of beta-like globin gene regulation and has potential implications in the development of therapeutics for sickle cell disease. Disclosures Chaand: Syros Pharmaceuticals: Employment, Equity Ownership. Fiore:Syros Pharmaceuticals: Employment, Equity Ownership. Johnston:Syros Pharmaceuticals: Employment, Equity Ownership. Moon:Syros Pharmaceuticals: Employment, Equity Ownership. Carulli:Syros Pharmaceuticals: Employment, Equity Ownership. Shearstone:Syros Pharmaceuticals: Employment, Equity Ownership.
40
Veith, Michael, Johannes Hans, Lothar Stahl, Peter May, Volker Huch und Angelika Sebald. „Alkoxigermanate(II), -stannate(II) und -plumbate(II) zweiwertiger Metallionen, I [1] / Alkoxigermanates(II), -stannates(II) and -plumbates(II) of Two-Valent Metal Ions, I [1]“. Zeitschrift für Naturforschung B 46, Nr. 4 (01.04.1991): 403–24. http://dx.doi.org/10.1515/znb-1991-0401.
Der volle Inhalt der QuelleAnnotation:
Bis(tri-tert-butoxigermanates), -stannates and -plumbates of Mg (1a), Ca (1b, 2b, 3b), Sr (1c, 2c, 3c), Ba (1d, 2d, 3d), Cd (le, 2e, 3e), Eu (1f, 2f, 3f) and Pb (1g, 2g, 3g) have been synthesized by various procedures from starting materials such as sodium tri-tert-butoxigermanate (5) and -plumbate (6) and other analogous compounds. While in 1 g and 2g the lead atom is situated in the middle of the molecule, it can also occupy two different coordination sites as in Pb(OtBu)3Pb(OtBu)3Pb (3g) and in Ge(OtBu)3Pb(OtBu)3Pb (7). X-ray structure investigations on 1a, 1b, 1e, 1f, 1g, 2b, 2e, 2g, 3c, 3d and 3g reveal that all these molecules have a common ElO3MO3El cage unit. This cage unit can be visualized as two ElO3M trigonal bipyramids sharing the central metal M. Consequently in all structures the central element M is sixfold coordinated by oxygen while the outer metals (El) have three oxygen neighbours. The oxygen atoms are further bonded to tert-butyl-groups, which surround the whole ElO3MO3El frame. Four different structure types have been found to exist: a monoclinic type α (1a), an orthorhombic type β (1b, le, 2b, 2e), a rhombohedral type γ (1f, 1g, 3c, 3d, 3g) and a monoclinic type δ (2g). In the β-structure type the molecules are found to exist as three different isomers, depending on the arrangement of the alkoxy groups in a right- or left-handed manner within the El(OtBu)3 groups (RR, SS and RS). Solution equilibria between these isomers are observed by NMR. In the case of 1e a more detailed picture of this intramolecular motion, attributed to the inversion of the trigonal-pyramidally coordinated oxygen atoms, can be given. CP-MAS-NMR-spectra as well as solution spectra have been obtained for le (13C, 113Cd), 2e (13C, 113Cd, 119Sn), 2g (119Sn, 207Pb), 3g (13C). While δ113Cd values of 2e in solution and in the solid are comparable (92.8 vs 73.7 ppm), the 2J(119Sn/113Cd) values rise from 39 Hz to 295 Hz. Detailed comparison of bond lengths and angles in the different derivatives shows that the “softness” of the El(OtBu)3 groups (or the ability of the groups to accommodate a metal atom with respect to its size) follows the order Sn(OtBu)3 < Ge(OtBu)3 < Pb(OtBu)3. From these findings it can be explained, why the lead derivative 2g shows stereochemical activity of the lone pair, while 1g and 3g do not show this effect at room temperature. All compounds except the lead derivatives 1g, 2g, 3g and 7 are colourless.
41
Acharya, Poornima, M. M. V. Ramana, Manish Upadhyay und Ganesh Pavale. „Unveiling the anti-tubercular properties of Biscoumarins, through Biological Evaluation and Docking Studies“. Letters in Drug Design & Discovery 17 (24.07.2020). http://dx.doi.org/10.2174/1570180817999200724173656.
Der volle Inhalt der QuelleAnnotation:
Background: Biscoumarin scaffolds are known for their promising pharmacological properties. These compounds have not been studied for their activity against tuberculosis strains. Objective: Unveil the antitubercular properties of biscoumarin scaffolds. Methods: Biscoumarin derivatives (3a-3l) were synthesized using lemon juice as a catalyst and were investigated for their in-vitro anti-tubercular activity against H37Rv strain of Mycobacterium tuberculosis using Microplate Alamar Blue Assay Method (MABA). Their binding interaction was investigated by Molecular Docking Studies using InhA with PDB-ID: 2NSD as target receptors in H37Rv strain of Mycobacterium tuberculosis. These derivatives (3a-3l) were subjected to neutrophil function test. Results: The results revealed that compounds 3b, 3c, 3d, 3f, 3i, 3j showed excellent activity with MIC 1.6 µg/mL. Molecular docking interactions for their antitubercular activity proved that the derivatives (3a-3l) can easily bind into the pockets of InhA enzyme. Neutrophil function test signified that they exhibit moderate neutrophil functions assuring that they do not harm the functioning of Neutrophils. Conclusion: These studies have awakened the property of Biscoumarins as promising anti-tubercular scaffolds.
42
Sadat Halder, Md Anwar, und Saumen Kumar De. „EFFECTIVENESS OF COMPREHENSIVE CARDIAC REHABILITATION IN POST CORONARY ARTERY BYPASS GRAFTING PATIENTS“. INTERNATIONAL JOURNAL OF SCIENTIFIC RESEARCH, 01.07.2021, 35–40. http://dx.doi.org/10.36106/ijsr/0115609.
Der volle Inhalt der QuelleAnnotation:
Introduction: Cardiovascular disease is leading cause of mortality and morbidity throughout the world. Despite optimum medical and surgical management, a large number of patients became unable to maintain normal activity of daily living due to inadequate rehabilitation. Rehabilitation cannot be regarded as an isolated form or stage of therapy. Coronary artery bypass surgery, also known as coronary artery bypass graft surgery, is a surgical procedure to bypass the obstructed coronary artery (the "target vessel"). India has a large number of patients of coronary artery disease who needs CABG operation. Over few decades post-operative rehabilitation of CABG patients is done though there is no separate national level guidelines for Indian population even in post myocardial infarction patients like western countries though socio economic prole, health infrastructure and need are different from rest of the world. So, our study is a humble attempt to examine the efcacy of rehabilitation programme followed in western world. Material and methods: In this Open labelled parallel group prospective randomised trial, conducted in the Department of Physical Medicine and Rehabilitation in collaboration with the cardio-thoracic and vascular surgery (CTVS) unit of the Institute of Cardio-Vascular Sciences, at the Institute of Post Graduate Medical Education and Research (IPGMER) and SSKM Hospitals, Kolkata between January, 2014 to June, 2015 (18 months). Patients who undergone CABG operation in CTVS Department SSKM Hospital, Kolkata were included. Total 80 patients, 40 in each group were recruited. Patients were randomised to cardiopulmonary rehabilitation group (n=40); named as cases and usual care group (n=40); named as control. Institutional ethical committee clearance was taken. Informed consent was taken from each patient before including them in this study. Every patient was explained about the programme. Parameters used:1. Forced vital capacity (FVC), 2. Metabolic Equivalent (MET), 3. Functional assessment (6MWT). Patient will be assessed at the end of 1 week,6 week and 3month of operation. FVC and 6MWT were performed in each visit where MET assessment was done in 6 week and 3 months. Results: Data will be summarised by routine descriptive statistics. Numerical variables will be compared between groups by Student's Unpaired 't' test if normally distributed or by Mann-Whitney's 'U' test if otherwise. Variation over time would be assessed through repeated measures Analysis of Variance (ANOVA) or by Friedman's ANOVA if otherwise. Chi-Square test or Fisher's Exact test would be employed for inter-group comparison of categorical variance. Analysis will be two-tailed and p<0.05 would be considered statistically signicant. In both the groups maximum number of patients are in the age group of 51-60. Most of study population are male (90%). There is statistically signicant difference (Student unpaired T test p value <0.01) of MET between cases and controls at 6th week (4.41 vs 3.92) and 3 months (6.93vs 6.66). Result shows statistically signicant difference (Student unpaired T test p value <0.01) of 6MWT between cases and controls at 1 week, 6 week and 3 months. Improvement pattern of FVC over time in Rehabilitation group shows that FVC improves in each visit when compared to previous one by Repeated measures ANOVA followed by Tukey's Multiple Comparison Test (P < 0.001Number of time points 3F value 121.85). Comparison of FVC in usual care group in each visit shows FVC improves in each visit when compared to previous one by Repeated measures ANOVA followed by Tukey's Multiple Comparison Test as post hoc test if ANOVA returns p value < 0.05 (p<0.001 No. of point 3F value 243.38). Comparison of 6MWT in Rehabilitation group in each visit shows 6MWT improves in each visit when compared to previous one by Repeated measures ANOVA followed by Tukey's Multiple Comparison Test as post hoc test if ANOVA returns p vale < 0.05 (Repeated Measures ANOVA P < 0.001Number of time points 3 F value 1498.0). Comparison of 6MWT in usual care group in each visit shows 6MWT improves over time when compared with previous visit by Repeated measures ANOVA followed by Tukey's test as post hoc test if ANOVA returns p value < 0.05 (p value 0.001 Number of time points 3 F value 580.83). Comparison of MET in Rehabilitation group in each visit show MET improves signicantly (4.41 vs 6.93) when compared to earlier one by student paired t test (p <0.01). Comparison of MET in usual care group in each visit show MET improves signicantly (3.92 vs 6.66) when compared to earlier one by student paired t test (p <0.01). Conclusion: th Our study shows most of our patient is male of 5 decade. Both conventional care and comprehensive rehabilitation after CABG shows statistically signicant improvement in FVC and 6MWT throughout study. Rehabilitation group shows better improvement than usual care group FVC and 6MWT throughout study. Improvement pattern of MET is consistent from 6 week to 3 months in both the group. Rehabilitation group shows better improvement in METS from 6 week to 3 months.
43
Chatzistavrou, Xanthippi, Eleana Kontonasaki, Nikolaos Kantiranis, Lamprini Papadopoulou, Petros Koidis, Evripides Hatzikraniotis und Konstantinos Paraskevopoulos. „Characterization and In Vitro Bioactivity Study of Ternary Glass-ceramic Coatings“. MRS Proceedings 1054 (2007). http://dx.doi.org/10.1557/proc-1054-ff05-29.
Der volle Inhalt der QuelleAnnotation:
ABSTRACTThe aim of the present study was to test the in vitro bioactive behavior of two new ternary mixtures consisting of a glass-ceramic porcelain, a bioactive glass and alumina (PBA) as coatings on dental glass ceramic substrates. They consisted of bioactive glass- in the system SiO2-Na2O-CaO-P2O5−, powder from a leucite-fluorapatite glass ceramic and γ-Al2O3 in 50-42.5-7.5 wt % respectively, while coatings with the same two components in 50-50 wt % ratio, without Al2O3, served as control. The characterization of the coatings was performed by Scanning Microscopy (SEM-EDS), Fourier Transform Infrared Spectroscopy (FTIR) and X-Ray Diffraction (XRD). The in vitro bioactivity was tested in Simulated Body Fluid (SBF) and the surfaces of reacted specimens were examined by SEM and FTIR. All coatings presented rough surface, while FTIR spectra revealed the characteristic peaks of the crystallized phases in the bioactive glass network and dental glass ceramic, i.e. Sodium Calcium Silicate (Na4Ca4Si6O18), Leucite (KAlSi2O6) and Fluorapatite (Ca5(PO4)3F), and furthermore the very limited participation of Al3+ in the bioactive glass network. In the coatings the main phases detected by XRD were, also, Na4Ca4Si6O18 and Leucite, dispersed in an amorphous glassy matrix. Furthermore, a transformation of γ-Al2O3 to δ-Al2O3 was observed and a new phase of Nepheline (Na7.15Al7.2Si8.8O32) was detected in traces. Apatite was developed sporadically on the surfaces of the PBA coatings after 30 days in SBF. These results demonstrate a slight retardation of bioactive response of the coatings of the ternary mixtures compared to dual ones consisting of dental glass ceramic and bioactive glass. The incorporation of Al2O3 can enhance the mechanical properties without a substantial degradation of bioactivity. This finding renders these coatings as promising composite materials for potential dental applications.
44
Campbell, Michael J., Piers Barker und Jennifer Li. „Abstract O.55: Utility of Adenosine Cardiac Stress MRI to Evaluate Ischemia in Patients with Kawasaki Disease“. Circulation 131, suppl_2 (28.04.2015). http://dx.doi.org/10.1161/circ.131.suppl_2.o55.
Der volle Inhalt der QuelleAnnotation:
Background: Patients with Kawasaki Disease (KD) and a history of coronary artery disease (CAD) are at risk of myocardial ischemia/infarction. Adenosine stress cardiac MRI (CMR) has been increasingly used in adults to evaluate for atherosclerotic CAD. This modality has not been widely used in the evaluation of CAD in children and young adults, but may be useful in those with a history of KD. Methods: Patients with a history of Kawasaki disease and a clinical indication for a stress cardiac MRI were prospectively enrolled in the study. SSFP cine and delayed enhancement CMR (DE-CMR) were performed in a standard manner. Adenosine stress perfusion was performed with administration of adenosine (140 ug/kg/min) for 2-4 minutes and gadolinium (0.1 mmol/kg) using a standard adult protocol. Results: A total of 13 procedures were performed between 2010 and 2014 on 8 patients with a history of KD (ages 8 to 22, 3F/5M). Seven of eight patients presented with chest pain. Seven of eight patients had documented moderate to giant aneurysms and one had a previous coronary bypass operation. Scans were performed 3-16 years after initial episodes of KD. Three of 16 (19%) scans demonstrated inducible regional ischemia in the distribution of coronary abnormalities. Of these, all underwent cardiac catheterization and 1 patient subsequently underwent coronary bypass surgery. All patients with negative scans were followed clinically with no evidence of further symptoms. Conclusion: As a non-invasive imaging modality, adenosine cardiac stress MRI is feasible in patients with KD and coronary abnormalities and may obviate the need for invasive studies in order to rule out significant CAD. Further studies are needed to evaluate this imaging modality as a more definitive test in the evaluation of KD and chest pain.
45
Perosa, Valentina, Leon P. Munting, Whitney Freeze, Ashley A. Scherlek, Anand Viswanathan, Steven M. Greenberg und Susanne Van Veluw. „Abstract P342: Histopathological Correlates of MRI-Visible Perivascular Spaces in Cerebral Amyloid Angiopathy“. Stroke 52, Suppl_1 (März 2021). http://dx.doi.org/10.1161/str.52.suppl_1.p342.
Der volle Inhalt der QuelleAnnotation:
Perivascular spaces (PVS) are fluid-filled spaces surrounding cerebral blood vessels. MRI-visible, supposedly enlarged, PVS in the centrum semiovale (CSO) have been associated with cerebral amyloid angiopathy (CAA). PVS enlargement may be due to perivascular clearance impairments, potentially caused by increased amyloid-β (Aβ) accumulation in the walls of vessels in the overlying cortex. We test this hypothesis, using MRI-guided histopathological examination of PVS in CAA autopsy cases. The cohort included 19 CAA (74.1±8.2y, 7F) and 5 non-CAA control cases (88.0±4.9y, 3F). Formalin-fixed hemispheres were scanned on a 3T MRI scanner, including a 500μm T2-weighted sequence. PVS enlargement was assessed in the CSO on in vivo and ex vivo MRI. In addition, local score of PVS enlargement was assessed in four pre-defined juxtacortical areas (Fig.A), using a semiquantitative score and on the corresponding histological sections (Fig.B). Severity of leptomeningeal and cortical CAA were assessed on adjacent Aβ-stained sections, using a semiquantitative scale.PVS enlargement was more severe in CAA cases compared to controls, both on in vivo and ex vivo MRI (p<0.05). PVS enlargement on ex vivo MRI positively correlated with the severity of PVS enlargement on the corresponding histopathological samples (Fig.C). Within CAA cases, the degree of PVS enlargement on ex vivo MRI was positively associated with leptomeningeal CAA severity (n=52 samples, ρ=0.35, p=0.011), but not cortical CAA severity (n=52 samples, ρ=0.10, p=0.472). These preliminary findings confirm that the degree of MRI-visible PVS in juxtacortical brain areas reflects enlargement on histopathology. Moreover, they suggest that PVS enlargement in cases with CAA corresponds to increased CAA severity in the overlying leptomeningeal vessels, possibly as a result of impaired perivascular clearance. Future directions include characterization of individual blood vessels associated with PVS enlargement.
46
Dham, Niti, Kelly Lyons und Blachy Davila Saldana. „Abstract 17026: Pericardial Effusion in Children After Bone Marrow Transplant“. Circulation 142, Suppl_3 (17.11.2020). http://dx.doi.org/10.1161/circ.142.suppl_3.17026.
Der volle Inhalt der QuelleAnnotation:
Background: Bone marrow transplant (BMT) is necessary in varying diseases. However, it has known cardiac risks and complications, including pericardial effusions (PE). PE can be life threatening if not identified early, and its treatment can be invasive, ie pericardiocentesis. Our objective is to identify echocardiographic (echo) findings that could help identify high risk subsets for developing a PE post BMT. Methods: We retrospectively identified BMT patients from January 2011 - December 2019 in our institution that developed moderate to large PE requiring treatment. Our controls consisted of BMT patients that did not develop PE. Baseline demographics, BMT data, PE treatments, and echo data was obtained. Echo variables included markers of systolic function, diastolic function, and LV size prior to BMT in both sets of patients. We performed a t-test for comparison and Pearson correlation. Results: We performed over 180 BMTs in our institution during this time. Of these, 50 were noted to have any degree of pericardial effusion, but 15 patients developed symptomatic pericardial effusions requiring further interventions. Our study included 13 subjects and 12 controls. Our subjects ranged from 8 months to 17 years old, 3F/10M. Even though the left ventricle end diastolic diameter (LVIDd) z-scores were within normal, they were statistically larger (p 0.02) in the PE group. Both groups had the same average hemoglobin (9.2). There was no difference in the pre-BMT systolic function or diastolic function parameters between the two groups. The duration of the PE (after the BMT)correlated with LVIDd z-score (Figure 1; r 0.6, p 0.02) and MV septal E’ (r -0.6, p 0.03) and E/E’ (r 0.6, p 0.05) from the pre-BMT echo. Conclusions: Assessing LV size and LV diastolic markers pre-BMT could be simple yet important measurements to pay closer attention to, which can then help direct improved screening in pediatric post-BMT patients. These findings should be explored further in larger studies.
47
Obute, J. O., S. V. Irtwange und T. Vange. „Effect of Packaging Materials and Storage Periods on the Vigor Parameters of Some Selected Varieties of Soybeans in Makurdi, Benue State, Nigeria“. Asian Research Journal of Agriculture, 13.03.2019, 1–14. http://dx.doi.org/10.9734/arja/2018/v10i430044.
Der volle Inhalt der QuelleAnnotation:
This study was carried out in 2017 at the Federal University of Agriculture, Makurdi Nigeria. The study was aimed at evaluating the effect of packaging materials and storage period on the vigor parameters of some selected varieties of soybeans in Makurdi. The experimental design was 3x5x6 factorial CRD comprising 3 varieties, 5 storage periods and 6 packaging materials by 3 replicates. Samples were collected from National Cereal Research Institute, Yandev sub-station. The soybeans were cleaned, dried and the moisture content noted. Five hundred grams was measured into the various packaging material stored and at Strategic Grains Reserve, Federal Ministry of Agriculture Makurdi. The seeds in storage was sampled periodically (2, 4, 6 and 8 months) to determine quality by conducting standard germination test with 100 seeds (100 seeds/rep). The investigation revealed that V3 (TGx 1448-2E) stored for 2 months had the highest Shoot seedling length while V1 (TGx 923-3F) stored for 8 months had the least shoot seedling length. Soybeans stored in cloth had a very high Shoot seedling length at 2 months but dropped thereafter and turned out to be the lowest at the end of the storage period. V2 (TGx 1904-6F) stored in laminate paper produced the longest Shoot seedling length and also produced the shortest with V1. The seedling root length was longest in V3 stored for 2 months and least in V1 stored for 8months.Soybeans stored in cloth for 2 months produced very high SRL 2 months but dropped to 0.00 at the end of the storage period. V2 did better in LDPE than all the packaging materials. V1 had the shortest SRL in soybeans stored in bottle. The highest seedling vigor was recorded in V3 stored for 2 months while the lowest seedling vigor was recorded in V1 stored for 8 months. V2 in plastic container had the highest seedling vigor whileV1 in plastic had the lowest. However, significant differences were observed at (P< 0.05) in the interaction effect. In the present study, LDPE proved to be the best packaging material and the variety that had more resistance to deterioration was V2 (TGx 1904-6F). Soybeans that are stored at ambient should be in storage material that are impervious to air and moisture otherwise the seeds will lose viability and vigor. In addition, varieties that are prone to fast deterioration should not be stored longer.
48
Apolzan, John, Owen Carmichael, S. Nicole Fearnbach, Krystal Kirby, Sreekrishna Ramakrishnapillai, Robbie Beyl, Kishore Gadde, J. Jason Collier und Corby Martin. „The Effects of the Form of Sugar (Solid vs. Beverage) on Body Weight and Neuronal Activity: A 28 Day Randomized Pilot Study (P08-001-19)“. Current Developments in Nutrition 3, Supplement_1 (01.06.2019). http://dx.doi.org/10.1093/cdn/nzz044.p08-001-19.
Der volle Inhalt der QuelleAnnotation:
Abstract Objectives To test if sugar sweetened beverages (SSBs) and sugar sweetened solids (SSSs) have differential effects on body weight and food reward processing. Methods In a single blind RCT, twenty participants with a BMI between 20–40 kg/m2 were randomized to consume a 20 fl oz soda/d (SSB, 248 kcal) vs. the equivalent energy and nutrients in solid form (SSS; similar to a thick jello and/or gummy candy). At baseline and day 28, fasting body weight and fed state brain activation responses to low fat high sugar foods (LF < 30%, HS > 30%) and non-food objects were assessed. The fMRI scan began 30 min after initiation of consumption of the 248 kcal dose of their randomized treatment. Summary measures of differences in fMRI BOLD signals between LFHS vs non-food images were calculated in a set of a priori defined brain regions implicated in energy homeostasis, taste, reward, and motivation to eat. Results Ten participants in the SSB (6F 4 M; 80% White; 39 ±4 y, Mean ± SEM) and ten in the SSS (3F 7 M; 60% White; 36 ± 5) completed the study. Baseline BMI was 28.2 ± 1.7 kg/m2 and 26.3 ± 1.4 in the SSB and SSS groups, respectively. No difference in change in body weight for SSB vs. SSS (0.56 ± 0.43 kg; P = 0.22) was seen. Changes in fMRI activation in homeostatic and taste regions were not different. Among reward and motivation related regions, fMRI activation within the caudate nucleus, cingulate gyrus, and medial orbitofrontal cortex were not different at baseline, but increased in SSS and decreased in SSB group (mean group differences in activation change: –0.30 ± 0.15, –0.36 ± 0.11, and –0.60 ± 0.25, P ˂ 0.05; respectively). fMRI activation in the insula was greater at baseline in SSS compared to SSB but the two groups converged to similar values at day 28 (mean group differences in activation change: 0.19 ± 0.08, P ˂ 0.05). Conclusions Consumption of SSB vs. SSS products produced distinct changes to brain activity within specific brain regions that control eating behavior despite no change in body weight between groups. Understanding the neural and physiological consequences of consuming added sugar in different forms will better inform current efforts to reduce its consumption and help regulate policy. This pilot study provides promising data for a longer duration, well-powered follow-up study. Funding Sources NIH U54GM104940, P30DK072476, Pennington Biomedical Research Foundation.
49
Berkowitsch, A., K. Weipert, J. Hutter, S. Zaltsberg, P. Kahle, A. Hain, T. Neumann und M. Kuniss. „P1006Cryo-balloon ablation in elderly; Outcome and prediction of recurrence“. EP Europace 22, Supplement_1 (01.06.2020). http://dx.doi.org/10.1093/europace/euaa162.009.
Der volle Inhalt der QuelleAnnotation:
Abstract Background It is well known that prevalence of atrial fibrillation correlates with age, however the data on ablation of atrial fibrillation in elderly patients is poor. Aim of this study was analysis of outcome and prediction of recurrence after cryo-balloon ablation (CBA) in elderly patients based on available data in our registry. Methods The history of AF was assessed at admission. Additionally, all patients received echocardiographic examination and blood test. After a single trans-septal access and PV angiography PVI was performed using a 28-mm CBA. Mapping of PV signals before, during, and after each cryo application was performed with a 3F lasso catheter. The procedural endpoint after PVI was defined as complete elimination of all fragmented signals at the PV antrum with verification of entrance and exit block. Primary endpoint was first documented recurrence of AF, atrial tachycardia or atrial flutter (>30 sec.). All patients received a follow-up every 3 month within 1st year, once yearly thereafter and in case of symptoms. Seven days Holter ECG was recorded by every follow up. Results A total of 44 (39%) of enrolled patients were male, 48 (43%) suffered non- paroxysmal AF(nPAF), 93 (82%) had hypertension, CAD was diagnosed by 27 (24%), 28 (25%) had DM (Hb1AC > 6), Stroke/TIA was observed in 11 (10%). Median Age in elderly was 76 (75-78) y, BMI 25.77 (23.51-28.69), time since 1st diagnosis 40 (6-50) month, LA area index 11.36 (9.77-13.20), TAPSE 23 (19-26), GFR 74 (66-83) mL/min, LVEF 60 (57-62). A total of 44 patients (39%) reached endpoint within follow up of 20 (12-38) months. Univariate association with outcome was found by follows parameter: Time from 1st diagnosis > 3 y (HR = 3.22 (1.66-6.27), p=.001); LA area index (HR = 1.17 (1.03-1.32), p=.013); DM (HR = 1.89 (1.02-3.55), p=.042); nPAF (HR = 1.90 (1.04-3.47), p=.036). After multivariate analysis only time from 1st diagnosis > 3 y, (HR= 3.17 (1.62-6.16), p=.001 and nPAF (HR = 1.84 (1.01-3.36)), p=.048 were revealed to be predictive. The area under probability score calculated for these predictors was .731 (.638-8.25), p=.001. Follows complications were observed: 2 (2%) - pericard tamponades, 4 (4%) phrenicus nerve injury. Conclusion. PVI with cryo-balloon is effective for elderly patients providing freedom of arrhythmic events in 61% of patients. Longer history of AF over 3 years since 1st diagnosis was main predictor for post ablation recurrence. In elderly patients with shorter history of AF efficiency and safety of CBA is comparable with general population.
50
Nicholas, Lucy. „“What fucked version of hello kitty are you?”“. M/C Journal 6, Nr. 3 (01.06.2003). http://dx.doi.org/10.5204/mcj.2196.
Der volle Inhalt der QuelleAnnotation:
“Power often comes in deceptive packages” (Myers, 2002) Hello Kitty is the ultimate icon of Japanese cuteness. She/it is simply the image of a cat with black eyes, a button nose and no mouth wearing a pink bow on her head. A product without context, Hello Kitty is a blank signifier with the potential to be loaded with codes and meanings as diverse as the ideas of those who consume her/it. Yet Hello Kitty encompasses, and holds contradictory associations with, discourses as diverse as debates over reappropriation of symbols, consumerism and nationalism. As a symbol of cuteness, with her inability to communicate verbally and her pink bow, Hello Kitty has become a player in the wider debate on “girlie” culture and whether symbols traditionally (by feminists) held to play a part in the oppression of women, can now be used as tools of cultural subversion (Greer, 1999). Riot grrrl was a movement which came to prominence in the early 1990s with all-female punk rock bands such as Bikini Kill, L7 and Babes in Toyland, and incorporated gender politics in to rock music, creating a new girl-focused subculture. The scene is still going strong now, although it receives less mainstream media attention (see Live Journal riot_grrls on-line community). It is often associated with the “girlie” look and many current riot grrrls consider themselves third-wave feminists. Girlie culture and riot grrrl are not to be confused with the girl power propagated by pop music, which is seen to be “insipid spice girl shit” (Riot Grrrl London) by riot grrrl feminists. A common mistake of older feminist’s criticisms is to equate mainstream “girl power” with the sub-cultural movement of riot grrrl, incorporating within it girlie feminism (See for examples the chapter on Girl power in Greer, 1999). Girlie Feminism: Separate But Equal Within the riot grrrl movement there has been a reappropriation of girliness as demonstrated by the use of “grrrl” as opposed to “girl”, severing its connotations of weakness and femininity and, thus, transforming its meaning. Hello Kitty and the debate around her/its consumption by riot grrrls can been used to examine the debates, contradictions, criticisms, reappropriations and ironies which are central to third-wave feminisms. One more sympathetic reading of the current “girlie” culture and its use of Hello Kitty as a logo assumes that it is highly ironic and that the girls involved have all the cultural savvy natural to the third-wave generation who have been raised in a pop culture driven world. From this point of view, young women/girls are naturally wielding signifiers like semiotics professors in their everyday lives. For example see the on-line “What fucked version of hello kittie are you?” Quiz (Sarcasticwhore, 2003) which uses Hello Kitty as a blank signifier that can represent many different types of subcultural image (interestingly the username of the creator of this quiz, “sarcasticwhore” is itself reappropriation of the word “whore”). Certainly there are some self-professed third-wave riot grrrls who are aware of the meanings of their actions: like the hello kitty pink fluffy thing - on the one hand if you're 'grown up' it can be a way of going against what's expected of you - to be respectable, orderly, lookin like you stepped out of Gap. on another hand it's a way of 'reclaiming yr femininity' which i am dubious about . . . . i feel that wearing particular things to convey an idea such as in this case reinforces the whole girl = one thing boy = another. But i totally agree, whole - heartedly, that women shouldn't bow down to the way of the man and attempt to be/look like them (i.e. deny their 'femininity' or wear suits and attempt to charge around blowing up the world like george bush) (Sabotage, 2003) My research with the riot grrrl Birmingham collective suggests that many of the girls involved understand the political implications of their behaviour and that their aim is not assimilation in to the “male” identity but a “separate but equal” identity wherein femaleness does not equate to weakness. Riot Grrrl foremother Kathleen Hanna explains that the original philosophy of riot grrrl had the same basic principles as those expressed by Sabotage above: dressing like a little girl . . . was also about being people who are oppositional to the whole American system, and not wanting to look like adults and our parents, who we saw as fucking up the world. And it was also when that Carol Gilligan book came out about how girls lose their self-esteem around twelve or thirteen, so everyone was talking about being nine. Like trying to go back there, and remembering what it was like when we were friends with each other, and we weren't totally competitive, and we were creating our own weird games and ideas. (Hanna in Hex, 2000) As Hanna pointed out, psychological research which focused on the negative effects of adolescence on girls showed that “the secrets of the female adolescent pertain to the silencing of her own voice, a silencing enforced by the wish not to hurt others but also by the fear that, in speaking, her voice will not be heard” (Gilligan, 1982, 51). This lead to a return to, and positivisation of, girlhood, a “nod to our joyous youth” (Baumgardner & Richards, 2001, 136) and a rejection of hegemonic ways of adult female behaviour. In relation to this psychological context, the mouth-less Hello Kitty takes on even more interesting connotations as a logo for third-wave riot grrrl feminism, as a logo which could also be seen to represent the voicelessness of girls, a logo re-contextualised by parody. Criticisms: Irony and Context Linda Hutcheon, a postmodern / feminist theorist, sees parody and irony as defining features of postmodernism and feminisms in the age of post modernism: It seems to me that . . . women are often in the position of defining themselves AGAINST a dominant culture or discourse. One way to do that, a way with great subversive potential, is to speak the language of the dominant (which allows you to be heard), but then to subvert it through ironic strategies of exaggeration, understatement, or literalization (1998). The main criticism of reappropriating symbols of oppression is the question of who creates the meaning and whether it is redundant if misinterpreted by the majority of people who see it. Moreover does postmodernism in relation to feminism suggest an acceptance of post-feminism or even an acceptance that ideas of girliness are no longer symbols of patriarchal oppression? The wearers may not think so, but the majority of “readers” may be oblivious to the complex connotations of a Hello Kitty t-shirt. Thus, the issue of context creates some problems for the effective use of girliness and, specifically, for Hello Kitty as a subversive tool, “The test of irony is that people get the joke – and if they had enough understanding to ‘get it’ in the first place, then this type of humour wouldn’t need to exist” (Direct Action 23, 2002). In response to criticism that the ironic “girlie” use of Hello Kitty may be misinterpreted, I suggest juxtaposition of signifiers in order to upset hegemonic readings in a similar way to that suggested by Paul Sweetham (1990). That is, it seems more effective to confuse the signified of the reader by taking elements of, for example Hello Kitty with its connotations of girliness, and simultaneously incorporate signs of punk imagery. This serves to create a look which cannot be read as merely girly or as merely punk, which changes the function of both signifiers. Consumerism Another element of the use of Hello Kitty as a logo for third-wave riot grrrl feminists is that Hello Kitty is the ultimate symbol of pure irrational consumerism and commodity fetishism, a “trap of material slavery” (Ko, 2000, 9). The uniqueness of Hello Kitty as a commodity is that the logo is the product; there is no (or at least was not originally) any story or context. This is especially problematic for Hello Kitty as a logo for Riot Grrrl, as this is a culture which sets itself apart from, and as a critique of, mainstream culture. This does not necessarily entail, however, a complete rejection of material culture and could simply mean an alternate or subverted form of it. Conclusion Despite its flaws, Hello Kitty can be seen to effectively, semeiologically speaking, represent a subculture inextricably set within and created from a pop-culture driven society. And while this use of Hello Kitty is entirely reliant on its context, in the context I have suggested it seems to effectively symbolise the ideologies of third-wave riot grrrls. Works Cited Baumgardner, Jennifer and Richards, Amy. Manifesta: Young Women, Feminism and the Future. Farrar Straus & Giroux, 2000. Direct Action. ‘Travelling Backwards? (No, we're just being ironic)’ Direct Action 23, Culturejam. (http://www.directa.force9.co.uk/back%20issues/DA%2023/articl... ...es.htm), 2002. Gilligan, Carol. In a Different Voice. Massachusetts: Harvard, 1982. Greer, Germaine. The Whole Woman. London: Doubleday, 1999. Hex, Celina. Fierce, Funny, Feminists: Gloria Steinem and Kathleen Hanna talk shop, and prove that grrrls – and womyn - rule. (**from the Winter 2000 "Feminist" issue of BUST) cited on http://busygrrrl.homestead.com/files/Bust_Interview.doc, 2002. Hutcheon, Linda in O’Grady, Kathleen. Theorizing Feminism and Postmodernity: A conversation with Linda Hutcheon http://www.cddc.vt.edu/feminism/Hutcheon.html, 1998 Ko, Yu-Fen. Hello Kitty and Identity Politics in Taiwan. Hsih-Shin University, October 2000 http://www.international.ucla.edu/cira/paper/TW_Ko.pdf , Live Journal riot-grrls community http://www.livejournal.com/userinfo.bml?user=riot_grrls Myers, Holly. ‘Hello Kitty finally gets to talk back’. L.A. Times, Fri Oct 25 2002. Riot Grrrl London. Riot Grrrl: a manifesto. www.gurlpages.com/riotgirl.london. 2002. Sabotage. RGBham smartgroup. http://www.smartgroups.com/groups/rgbham. 2003. Sarcasticwhore. ‘What fucked version of hello kitty are you?’. Quizilla.com. http://quizilla.com/users/sarcasticwhore/quizzes/what%20fuck... ...ed%20version%20of%20hello%20kittie%20are%20you%3F/ Sweetman, Paul. ‘Marked Bodies, Oppositional Identities? Tatooing, Piercing and the Ambiguity of Resistance’.in Roseneil, S & Seymour, J (eds.) Practising Identities: Power and Resistance. London: Macmillan Press, 1999. Links http://busygrrrl.homestead.com/files/Bust_Interview.doc http://quizilla.com/users/sarcasticwhore/quizzes/what%20fucked%20version%20of%20hello%20kittie%20are%20you%3F/ http://www.cddc.vt.edu/feminism/Hutcheon.html http://www.directa.force9.co.uk/back%20issues/DA%2023/articles.htm http://www.gurlpages.com/riotgirl.london http://www.international.ucla.edu/cira/paper/TW_Ko.pdf http://www.livejournal.com/userinfo.bml?user=riot_grrls http://www.smartgroups.com/groups/rgbham Citation reference for this article Substitute your date of access for Dn Month Year etc... MLA Style Nicholas, Lucy. "“What fucked version of hello kitty are you?” " M/C: A Journal of Media and Culture< http://www.media-culture.org.au/0306/07-hellokitty.php>. APA Style Nicholas, L. (2003, Jun 19). “What fucked version of hello kitty are you?” . M/C: A Journal of Media and Culture, 6,< http://www.media-culture.org.au/0306/07-hellokitty.php>