Auswahl der wissenschaftlichen Literatur zum Thema „Sorokiniana“

Chlorella sorokiniana merupakan salah satu mikroalga penghasil astaxantin. Produksi astaxantin C. sorokiniana dapat meningkat pada kondisi kultur yang optimal. Penelitian ini bertujuan untuk memastikan identitas C. sorokiniana secara molekuler menggunakan ITS, dan 18S rDNA, serta untuk mengetahui pertumbuhan dan produksi astaxantin C. sorokiniana berdasarkan perlakuan cahaya. Metode yang digunakan pada penelitian ini meliputi kultivasi mikroalga C. sorokiniana, isolasi DNA, uji kuantitatif DNA, identifikasi molekuler melalui proses amplifikasi DNA dengan PCR (Polymerase Chain Reaction) menggunakan marka molekuler ITS dan 18S rDNA, visualisasi hasil PCR dengan elektroforesis menggunakan GelDoc diikuti sekuensing DNA. Produksi astaxantin mikroalga C. sorokiniana dihitung selama 10 hari dibawah perlakuan cahaya matahari dan sinar UV. Identifikasi molekuler C. sorokiniana menggunakan ITS memperoleh dengan ukuran fragmen sebesar 500 pb, sedangkan fragmen 18S rDNA sebesar 600 pb. Pertumbuhan mikroalga C. sorokiniana kontrol pada hari ke-10 dengan kerapatan 15×106 sel/ml, sedangkan pada perlakuan cahaya matahari dan sinar UV pada hari ke-10 dengan kerapatan 38,45×106 sel/ml. Konsentrasi astaxantin yang dihasilkan mikroalga C. sorokiniana pada perlakuan kontrol mencapai tertinggi 0.3306 mg/mL dan pada perlakuan cahaya matahari dan sinar UV meningkat mencapai 0,3874 mg/mL. Chlorella sorokiniana is one of the astaxanthin-producing microalgae. Astaxanthin production of C. sorokiniana can be increased under optimal culture conditions. This study aims to determine the molecular identity of C. sorokiniana using ITS and 18S rDNA, as well as to determine the growth and production of astaxanthin C. sorokiniana based light treatment. The methods used in this study included C. sorokiniana microalgae cultivation, DNA isolation, DNA quantitative testing, molecular identification through the process of DNA amplification with PCR (Polymerase Chain Reaction) using ITS and 18S rDNA molecular markers, visualization of PCR results by electrophoresis using GelDoc followed by sequencing DNA. The astaxanthin production of C. sorokiniana microalgae was calculated for 10 days under sunlight and UV light treatment. Molecular identification of C. sorokiniana using ITS obtained a fragment size of 500 bp, while the 18S rDNA fragment was 600 bp. The growth of C. sorokiniana microalgae was controlled on day 10 with a density of 15×106 cells/ml, whereas in the treatment of sunlight and UV light on day 10 with a density of 38,45×106 cells/ml. The concentration of astaxanthin produced by C. sorokiniana microalgae in the control treatment reached 0,3306 mg/mL and in the sunlight and UV light treatments it increased to 0,3874 mg/mL.

Wheat yield is greatly reduced because of the occurrence of leaf spot diseases. Bipolaris sorokiniana is the main pathogenic fungus in leaf spot disease. In this study, B. sorokiniana from wheat leaf (W-B. sorokiniana) showed much stronger pathogenicity toward wheat than endophytic B. sorokiniana from Pogostemon cablin (P-B. sorokiniana). The transcriptomes and metabolomics of the two B. sorokiniana strains and transcriptomes of B. sorokiniana-infected wheat leaves were comparatively analyzed. In addition, the expression levels of unigenes related to pathogenicity, toxicity, and cell wall degradation were predicted and validated by quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis. Results indicated that pathogenicity-related genes, especially the gene encoding loss-of-pathogenicity B (LopB) protein, cell wall-degrading enzymes (particularly glycosyl hydrolase-related genes), and killer and Ptr necrosis toxin-producing related unigenes in the W-B. sorokiniana played important roles in the pathogenicity of W-B. sorokiniana toward wheat. The down-regulation of cell wall protein, photosystem peptide, and rubisco protein suggested impairment of the phytosynthetic system and cell wall of B. sorokiniana-infected wheat. The up-regulation of hydrolase inhibitor, NAC (including NAM, ATAF1 and CUC2) transcriptional factor, and peroxidase in infected wheat tissues suggests their important roles in the defensive response of wheat to W-B. sorokiniana. This is the first report providing a comparison of the transcriptome and metabolome between the pathogenic and endophytic B. sorokiniana strains, thus providing a molecular clue for the pathogenic mechanism of W-B. sorokiniana toward wheat and wheat’s defensive response mechanism to W-B. sorokiniana. Our study could offer molecular clues for controlling the hazard of leaf spot and root rot diseases in wheat, thus improving wheat yield in the future.

Target of rapamycin (TOR) is a serine/threonine protein kinase that plays a central regulating role in cell proliferation, growth, and metabolism, but little is known about the TOR signaling pathway in Chlorella sorokiniana. In this study, a Chlorella sorokiniana DP-1 strain was isolated and identified, and its nutritional compositions were analyzed. Based on homologous sequence analysis, the conserved CsTOR protein was found in the genome of Chlorella sorokiniana. In addition, the key components of TOR complex 1 (TORC1) were present, but the components of TORC2 (RICTOR and SIN1) were absent in Chlorella sorokiniana. Pharmacological assays showed that Chlorella sorokiniana DP-1 was insensitive to rapamycin, Torin1 and KU0063794, whereas AZD8055 could significantly inhibit the growth of Chlorella sorokiniana. RNA-seq analysis showed that CsTOR regulated various metabolic processes and signal transduction pathways in AZD8055-treated Chlorella sorokiniana DP-1. Most genes involved in photosynthesis and carbon fixation in Chlorella sorokiniana DP-1 were significantly downregulated under CsTOR inhibition, indicating that CsTOR positively regulated the photosynthesis in Chlorella sorokiniana. Furthermore, CsTOR controlled protein synthesis and degradation by positively regulating ribosome synthesis and negatively regulating autophagy. These observations suggested that CsTOR plays an important role in photosynthesis and cellular metabolism, and provide new insights into the function of CsTOR in Chlorella sorokiniana.

Rising oil prices and climate change have resulted in more emphasis on research into renewable biofuels. In this study, different water samples were collected from local vicinities for the isolation of local isolates of microalgae to check their potential towards the production of biofuel by the addition of different chemical substrates. Five different concentrations of ascorbic acid and iron (III) chloride (0, 1, 2.5, 5 & 10 µM) are used as substrates. Microscopic analysis evaluated that samples belong to genus Chlorella and further molecular identification showed that the samples are C. sorokiniana. Among all the concentrations of ascorbic acid 2.5 µM is most effective against the C. sorokiniana strain 1 (Safari Wildlife Park, Lahore) and C. sorokiniana strain 2 (Bahria Town, Lahore) while C. sorokiniana Strain 3 (SukhChane Society, Lahore) responded at 2.5 & 5 µM in term of biomass production. FeCl3 (2.5 µM) is effective against C. sorokiniana strain 1 while the growth of C. sorokiniana strain 2 and C. sorokiniana Strain 3 is inhibited. Lipid content analysis showed that only the C. sorokiniana strain 1 shows effective results at 1 & 2.5 µM of ascorbic acid and FeCl3, respectively. Those concentrations which give the significant results of lipid production were preceded for fatty acid profiling. Results indicate that the C. sorokiniana strain 1 can be considered as a source of alpha-linolenic acid; the basic constituent of biofuel production. In this study, it is concluded that C. sorokiniana strain 1 is useful for the production of environment friendly biofuel.

Spot blotch of wheat caused by Bipolaris sorokiniana is an important disease of wheat, especially in slightly warm (25 ± 1 °C) and humid weather conditions. A quick and reliable PCR-based diagnostic assay has been developed to detect B. sorokiniana using a pathogen-specific marker derived from genomic DNA. A PCR-amplified band of 650 bp obtained in B. sorokiniana isolates using universal rice primer (URP 1F) was cloned in pGEMT easy vector and sequenced. Based on sequences, six primers were designed, out of which a primer pair RABSF1 (GGTCCGAGACAACCAACAA) and RABSR2 (AAAGAAAGCGGTCGACGTAA) amplified a sequence of 600 bp in B. sorokiniana isolates. The specificity of the marker when tested against 40 isolates of B. sorokiniana, seven isolates of other species of Bipolaris, and 27 isolates of other pathogens infecting wheat and other crops showed a specific band of 600 bp only in B. sorokiniana. The detection limit was 50 pg of genomic DNA. The marker could detect the pathogen in soil and wheat leaves at presymptomatic stage. This sequence characterized amplified region (SCAR) marker designated as SCRABS600 could clearly distinguish B. sorokiniana from other fungal plant pathogens, including Bipolaris spp. The utilization of this diagnostic PCR assay in analysis of field soil and wheat leaves will play a key role in effective management of the disease.

The domain of unknown function 26 (DUF26), harboring a conserved cysteine-rich motif (C-X8-C-X2-C), is unique to land plants. Several cysteine-rich repeat proteins (CRRs), belonging to DUF26-containing proteins, have been implicated in the defense against fungal pathogens in ginkgo, cotton, and maize. However, little is known about the functional roles of CRRs in the important staple crop wheat (Triticum aestivum). In this study, we identified a wheat CRR-encoding gene TaCRR1 through transcriptomic analysis, and dissected the defense role of TaCRR1 against the soil-borne fungi Rhizoctonia cerealis and Bipolaris sorokiniana, causal pathogens of destructive wheat diseases. TaCRR1 transcription was up-regulated in wheat towards B. Sorokiniana or R. cerealis infection. The deduced TaCRR1 protein contained a signal peptide and two DUF26 domains. Heterologously-expressed TaCRR1 protein markedly inhibited the mycelia growth of B. sorokiniana and R. cerealis. Furthermore, the silencing of TaCRR1 both impaired host resistance to B. sorokiniana and R. cerealis and repressed the expression of several pathogenesis-related genes in wheat. These results suggest that the TaCRR1 positively participated in wheat defense against both B. sorokiniana and R. cerealis through its antifungal activity and modulating expression of pathogenesis-related genes. Thus, TaCRR1 is a candidate gene for improving wheat resistance to B. sorokiniana and R. cerealis.

Fusarium pseudograminearum and Bipolaris sorokiniana are causal agents of Fusarium crown rot and common root rot, respectively, of wheat and cause significant losses worldwide. Understanding the population dynamics between these two pathogens at late stages of wheat development is needed. The effect of F. pseudograminearum and B. sorokiniana inocula applied singly or in mixtures at seeding to spring wheat ‘Hank’ was measured using seedling stand, grain yield, and pathogen populations in the first internode at heading, milk, and harvest stage of wheat development using real-time quantitative polymerase chain reaction. High and low rates of F. pseudograminearum inoculum reduced B. sorokiniana populations in field trials but B. sorokiniana inoculations did not affect F. pseudograminearum populations. Populations of both pathogens increased from heading until harvest, with F. pseudograminearum colonizing lower internodes earlier than B. sorokiniana. Neither pathogen prevented infection by the other in the first internode of wheat stems. Inoculations increased incidence of infection and co-infection relative to natural settings observed for both pathogens. At the seedling stage, both fungi, individually or combined, reduced the seedling stands when compared with a noninoculated control for the three location–years. Grain yield and F. pseudograminearum populations were inversely correlated, while B. sorokiniana populations were not correlated with yield.

Spot blotch, caused by Bipolaris sorokiniana, is a damaging disease of barley in Canada, especially in the prairie region (Manitoba, Saskatchewan, and Alberta) where most of Canadian crops are produced. Considerable interaction between isolates of the pathogen and barley genotypes necessitates the evaluation of the virulence diversity in the B. sorokiniana population in order to deploy effective resistance against the pathogen. The virulence diversity of 127 B. sorokiniana isolates from Canada and other countries was evaluated on 12 barley genotypes. Different virulence patterns were detected across B. sorokiniana isolates and eight virulence groups were identified using qualitative analysis of the virulence data. Results indicate broader virulence diversity in the pathogen population in the eastern prairie region of Canada, especially in Manitoba, compared with that previously reported. One group of isolates collected from Manitoba displayed a virulence pattern which had not been reported previously. This group was moderately virulent on most differential lines, including American six-rowed barley genotypes considered to possess durable resistance against B. sorokiniana. Although the classical method of pathotype identification can be exploited to analyze interactions in the barley-B. sorokiniana pathosystem, the continuous range of infection phenotypes found suggests that a quantitative analysis of the complex interactions occurring may be warranted.

Common root rot caused by Bipolaris sorokiniana infestation in wheat is one of the main reasons for yield reduction in wheat crops worldwide. The bacterium strain JK-25 used in the current investigation was isolated from wheat rhizosphere soil and was later identified as Bacillus halotolerans based on its morphological, physiological, biochemical, and molecular properties. The strain showed significant antagonism to B. sorokiniana, Fusarium oxysporum, Fusarium graminearum, and Rhizoctonia zeae. Inhibition of B. sorokiniana mycelial dry weight and spore germination rate by JK-25 fermentation supernatant reached 60% and 88%, respectively. The crude extract of JK-25 was found, by Matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS), to contain the surfactin that exerted an inhibitory effect on B. sorokiniana. The disruption of mycelial cell membranes was observed under laser scanning confocal microscope (LSCM) after treatment of B. sorokiniana mycelium with the crude extract. The antioxidant enzyme activity of B. sorokiniana was significantly reduced and the oxidation product malondialdehyde (MDA) content increased after treatment with the crude extract. The incidence of root rot was significantly reduced in pot experiments with the addition of JK-25 culture fermentation supernatant, which had a significant biological control effect of 72.06%. Its ability to produce siderophores may help to promote wheat growth and the production of proteases and pectinases may also be part of the strain’s role in suppressing pathogens. These results demonstrate the excellent antagonistic effect of JK-25 against B. sorokiniana and suggest that this strain has great potential as a resource for biological control of wheat root rot strains.

O fungo filamentoso Bipolaris sorokiniana é um fitopatógeno que causa moléstias em cereais de inverno, tais como a mancha marrom, a ponta preta dos grãos e a podridão comum da raiz. O controle deste fungo é dificultado pelo fato do mesmo apresentar uma ampla variabilidade morfológica, fisiológica e genética. Assim sendo, os objetivos deste trabalho foram estudar a variabilidade fisiológica, genética e virulência de isolados de B. sorokiniana. Foram utilizados 35 isolados de B. sorokiniana e um isolado de B. orizae, provenientes de diferentes regiões geográficas do Brasil e de outros países. Inicialmente foi realizado o agrupamento dos isolados, conforme as características morfológicas e a medida da taxa de crescimento dos mesmos, separando-os em grupos morfológicos. Os isolados foram avaliados quanto à atividade enzimática em meio sólido, a virulência em sementes e plântulas de trigo e perfil de proteínas totais em gel SDS-PAGE. Com os resultados obtidos, cinco grupos morfológicos foram formados, com diferenças na coloração micelial e crescimento. Foram encontradas variações entre os isolados quanto à atividade enzimática, sendo a esterase a enzima que apresentou os mais altos índices de atividade. Os resultados do ensaio de virulência mostraram diferenças na porcentagem de sementes e plântulas infectadas, entre isolados da mesma região geográfica e grupo morfológico. O perfil de proteínas totais apresentou uma variação no número e intensidade das bandas no gel, onde algumas destas podem ser características da espécie. Também foi avaliada a incompatibilidade vegetativa entre os isolados, a influência de diferentes meios de cultivo sobre a incompatibilidade e a análise eletroforética de proteínas totais dos isolados, quando crescidos isoladamente e em reações de incompatibilidade e compatibilidade. Dos 31 cruzamentos de incompatibilidade realizados, 18 mostraram-se totalmente incompatíveis e essas reações apresentaram alterações nos diferentes meios de cultivo utilizados, evidenciando a influência do substrato nesta reação. Alguns isolados quando crescidos em condição de pareamento mostraram bandas mais intensas na eletroforese, sugerindo que algumas proteínas poderiam ser expressas em níveis mais elevados durante o co-cultivo.
Bipolaris sorokiniana is a phytopathogenic fungus that causes diseases in cereal crops, such as leaf spot disease, black point of the grain and common root rot. Because of its high morphological, physiological and genetic variability, the fungus control is a difficult task. The aim of this work was to study the physiological and genetic variability and the virulence of B. sorokiniana isolates. For this, 35 B. sorokiniana and one B. orizae isolates were used, proceeding from different geographic regions in Brazil and other countries. Initially, the isolates were evaluated for their morphological variability, considering mycelia color, sector formation, and growth rate. With this result the isolates were grouped by their morphologic characteristics. Extra-cellular enzymatic activity was analyzed in solid medium for all isolates, pathogenicity in wheat seeds and seedlings and analysis of total proteins by SDS-PAGE was done. Five morphological groups were formed with the results obtained with the morphological and growth characteristics. Variations among the isolates were found for enzymatic activity, and esterase was the enzyme that presented highest activity indices. The results obtained from infection of seeds and seedlings showed that isolates from the same geographic region and morphologic group had different degrees of virulence. The total protein profile presented by the isolates showed a variation in the bands number and intensity, where some of them can be characteristic of the specie. The vegetative incompatibility between the isolates was evaluated and the influences that different media culture in this reaction. The total proteins profile of the isolates was analyzed when the isolates were cultivated separately and in compatibility and incompatibility reactions. Thirty one crossings were realized and 18 out of them showed vegetative incompatibility, and theses reactions had presented alterations with different media culture. This result strongly suggests the influence of the substratum in this reaction. The isolates when pareated shown more intense protein bands in SDS-PAGE, suggesting that some proteins could be expressed in higher levels during co culture of the fungus.

Submitted by Alison Vanceto (alison-vanceto@hotmail.com) on 2017-08-08T16:54:32Z No. of bitstreams: 1 TeseAEM.pdf: 3699711 bytes, checksum: 3b2fdf705faaa9314eeacec123aa76fd (MD5)
Approved for entry into archive by Ronildo Prado (ronisp@ufscar.br) on 2017-08-08T17:28:23Z (GMT) No. of bitstreams: 1 TeseAEM.pdf: 3699711 bytes, checksum: 3b2fdf705faaa9314eeacec123aa76fd (MD5)
Approved for entry into archive by Ronildo Prado (ronisp@ufscar.br) on 2017-08-08T17:28:30Z (GMT) No. of bitstreams: 1 TeseAEM.pdf: 3699711 bytes, checksum: 3b2fdf705faaa9314eeacec123aa76fd (MD5)
Made available in DSpace on 2017-08-08T17:38:21Z (GMT). No. of bitstreams: 1 TeseAEM.pdf: 3699711 bytes, checksum: 3b2fdf705faaa9314eeacec123aa76fd (MD5) Previous issue date: 2017-06-09
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
In aquatic environments, phytoplankton consists mostly of photosynthetic microorganisms that serve as the basis of food chains. However, besides photoautotrophy, it is widely reported in the literature that many microalgae can take up dissolved organic matter present in the environment concomitantly with the photosynthesis, a metabolic pathway known as mixotrophy. Little is known about the ecophysiology of mixotrophy in microalgae, and almost all studies are focused on the use of this metabolic pathway to increase the production of algal biomass and stimulate the production of specific biomolecules. Another important issue, considering the current anthropic activity, is that most of the contaminants eliminated in aquatic environments, such as metals and nanoparticles, affect the phytoplankton. However, so far, no ecotoxicological study involving mixotrophic metabolism was found in the literature. To better understand mixotrophy in microalgae, this work chose the chlorophycean freshwater Chlorella sorokiniana as test organism. We divided the study into two parts: the first focused on the physiological/biotechnological interest through the study of growth, photosynthetic parameters, changes in cellular volume, and production of biomolecules (proteins, carbohydrates and lipids); the second part focused on the ecotoxicological effects of cadmium (Cd) and titanium dioxide nanoparticles (NPs-TiO2). To stimulate mixotrophy, glucose (1.0 g.L-1 or 5 x 10-3 mol.L-1) was used as the organic carbon source. The results showed that during mixotrophy, the microalga C. sorokiniana presented higher population growth and production of biomolecules, such as chlorophyll a and lipids, when compared to photoautotrophic cultures. It was also observed that the photosynthetic parameters were affected by mixotrophy, although they did not interfere in the growth of the microalga, and that the presence of bacteria in the cultures acted as a stimulant factor in the production of algal biomass. Regarding the ecotoxicological effects of contaminants, microalgae in mixotrophy were more resistant to both Cd and NPs-TiO2 than those in photoautotrophy, but with changes in the biochemical composition what can affected the energy transfer in the environment. In general, we can conclude that mixotrophy should be considered in studies with phytoplankton, since aquatic environments present a myriad of organic carbon that can be used by these microorganisms. As general conclusions, we can mention that organic carbon acted as an extra source of structural carbon and energy for microalgae, not necessarily relying solely on photosynthesis to survive, so stimulating the growth and production of biomolecules of biotechnological interest, and increased cellular viability in environments contaminated with metals and nanoparticles. This study is a contribution to the understanding of mixotrophy and photoautotrophy metabolisms in a freshwater Chlorophyta with biotechnological potential.
Nos ambientes aquáticos, o fitoplâncton é formado basicamente de microrganismos fotossintetizantes que servem como base das cadeias alimentares. Entretanto, além da fotoautotrofia, é vastamente citado na literatura que muitas microalgas alimentam-se de matéria orgânica dissolvida presente no ambiente concomitantemente à realização da fotossíntese, uma via metabólica conhecida como mixotrofia. Sabe-se pouco sobre a ecofisiologia em metabolismo mixotrófico nas microalgas, sendo os estudos, em sua quase totalidade, voltados ao uso dessa via metabólica para aumentar a produção de biomassa algal e estimular a produção de biomoléculas específicas. Outra questão importante, considerando a atividade antrópica atual, é que a maioria dos contaminantes eliminados nos ambientes aquáticos, como metais e nanopartículas, são estudados em fitoplâncton sob metabolismo fotoautotrófico, não sendo encontrados trabalhos ecotoxicológicos envolvendo o metabolismo mixotrófico na literatura. Para entender melhor o metabolismo algal em mixotrofia, este trabalho escolheu a microalga Chlorophyta de água doce Chlorella sorokiniana como organismo-teste. Para melhor organizá-lo, foi dividido em duas partes: a primeira focou no interesse fisiológico/biotecnológico através do estudo do crescimento, parâmetros fotossintéticos, volume celular, e produção de biomoléculas (proteínas, carboidratos e lipídeos); a segunda parte focou nos efeitos ecotoxicológicos de cádmio (Cd) e de nanopartículas de dióxido de titânio (NPs-TiO2). Para estimular a mixotrofia, glicose (1.0 g.L-1 ou 5 x 10-3 mol.L-1) foi utilizada como fonte de carbono orgânico. Os resultados mostraram que durante a mixotrofia, a microalga C. sorokiniana apresentou maiores crescimento populacional e produção de biomoléculas, como clorofila a e lipídeos, quando comparada com as culturas em fotoautotrofia. Também foi observado que os parâmetros fotossintéticos foram afetados em mixotrofia, porém não interferindo no crescimento da microalga, e que a presença de bactérias pode ter atuado como fator estimulante na produção de biomassa algal. Em relação aos efeitos ecotoxicológicos dos contaminantes, as microalgas em mixotrofia foram mais resistentes tanto ao Cd quanto às NPs-TiO2 do que em fotoautotrofia, porém com mudanças na composição bioquímica, podendo afetar a transferência de energia nos ecossistemas aquáticos. De modo geral, podemos concluir que a mixotrofia deve ser considerada em estudos com fitoplâncton, visto que os ambientes aquáticos apresentam uma miríade de fontes de carbono orgânico para esses microrganismos. Na mixotrofia, o carbono orgânico funciona como uma fonte extra de carbono estrutural e de energia para as microalgas, não dependendo obrigatoriamente somente da fotossíntese para sobreviver, estimulando o crescimento e produção de biomoléculas de interesse biotecnológico, além de aumentar a viabilidade celular em ambientes contaminados tanto com Cd quanto com NPs-TiO2. Este estudo é uma contribuição ao entendimento dos metabolismos mixotróficos e fotoautotróficos em uma Chlorophyta de água doce com potencial biotecnológico.
CNPq: 302175/2015-6
FAPESP: 2014/15894-0

Chapter 1: Introduction Wheat is the second most widely grown and consumed food crop of the world after rice, and is the staple food of around 35% of the world’s population. The present wheat production is about 749 million tons (FAO, 2016; http://www.fao.org/faostat) and to feed the world’s ever-growing population with annual growth rate of 2.6%, there will be a requirement to produce about 1040 million tons of wheat in 2020. To reach this target, it is crucial to keep the crop free from various biotic as well as abiotic stresses. In recent years, spot blotch caused by Bipolaris sorokiniana has emerged as a serious threat for wheat cultivation in warmer and humid regions of the world. It causes foliar spot blotch, root rot, black point on grains, head blight and seedling blight of wheat and barley. Estimates of yield losses due to spot blotch are reported to vary from 30-80% and can reach up to 100% under severe infection conditions. In spite of several efforts world over, no wheat variety highly resistant to spot blotch has been released for field cultivation. One of the main reasons for this is that the molecular mechanism behind resistance to spot blotch has not yet been fully understood. In order to develop measures to control plant diseases, it is very important to understand not only the characteristic features of the pathogen, but also the molecular mechanism behind the disease progression. With this purpose, the thesis encompasses the following objectives: Objectives of the study 1. To explore the mechanism of plant-pathogen interaction during spot blotch in susceptible and moderately resistant wheat varieties 2. To understand the mechanism of survival of Bipolaris sorokiniana on exposure to the fungicide propiconazole Chapter 2: Isolation and characterization of Bipolaris sorokiniana isolates from different geographical regions of India B. sorokiniana is a phytopathogenic fungus causing diseases in wheat, barley and other winter cereals. Previous studies involving large numbers of strains collected from around the globe suggest that B. sorokiniana exist as numerous forms of isolates varying in virulence and aggressiveness with specific and nonspecific interactions. B. sorokiniana has high morphological as well as pathological variations. We collected or isolated 12 strains of B. sorokiniana from three different wheat growing geographical regions of India. During microscopic examinations, some cultures were found to be polysporic and hence needed to be purified. Thus, monoconidial cultures were established for seven sporulating isolates of B. sorokiniana. These cultures were characterized at morphological level as well as by sequencing the ITS region of the isolates and confirmed to be B. sorokiniana. Like previous reports, our results also showed high morphological variability among the isolates. However, the morphological variation had no relationship with the geographical background. No correlation was observed between genetic similarity of the isolates and their geographical origin, concluding that the morphological characteristics expression is not conditioned solely by genes. Light microscopy and scanning electron microscopy of the spores showed several variations in conidial size, level of melanization and number of septa. For evaluation of disease reaction, the following reported methods of pathogen inoculation were attempted: leaf painting, sterile seed inoculation and inoculation at Zadok’s scale 12 stage. All these methods had some or other limitations for pathogenicity testing and hence another method, inoculation of germinated seeds, was developed. This method was found to be the best method for high throughput evaluation of pathogenicity as well as screening of germplasms. Our study showed that isolates from the same geographic region and morphological group could show differences in virulence levels. Chapter 3: Exploring the molecular interaction of wheat-Bipolaris sorokiniana during spot blotch disease Triticum dicoccum (emmer wheat) has superior organoleptic, therapeutic and nutritional qualities. However, dominance by high yielding hexaploid wheat varieties has restricted its cultivation to some niche areas in Europe and other regions including the peninsular India. T. dicoccum is resistant to various biotic stresses and rust diseases but highly susceptible to stripe rust and spot blotch. Spot blotch has become a major constraint in T. dicoccum cultivation in India. The hemibiotrophic disease cycle of this pathogen is observed only in the susceptible host. Interactive transcriptome sequencing is gaining importance in plant pathogen interaction studies and has enabled simultaneous analysis of expression of plant as well as pathogen genes. Similarly, next generation sequencing has enabled genome sequencing of organisms to a great extent. With the availability of the reference genome sequences from plants as well as pathogen, it has become much easier to align the reads from RNA-seq data and hence expression quantification. In order to explore the interaction, we performed global transcriptome analysis of spot blotch susceptible variety, DDK 1025 and a moderate resistant variety, Chirya 3 upon pathogen inoculation using Illumina HiSeq platform. To understand the infection process and mechanism of disease progression, we performed differential gene expression analysis of spot blotch susceptible variety, DDK 1025 upon pathogen inoculation. A time series comparative study was performed to understand the biotrophic (1 dpi, days post inoculation), early necrotrophic (4 dpi) and necrotrophic phase (6 dpi) responses. The numbers of differentially expressed genes (DEGs) from three stages were 1810, 1562 and 2908 individually. GO annotations were obtained using Blast2GO for 75.63%, 70% and 73.89% of these DEGs respectively. GO enrichment was performed using agriGo online tool (http://bioinfo.cau.edu.cn/agriGO/analysis.php) using Triticum aestivum transcript ID v2.2 as the reference. Biological processes associated with carbohydrate metabolic process, response to abiotic stress, photosynthesis, cell death, regulation of gene expression, secondary metabolic process and generation of precursor metabolites were enriched. Under molecular function category carbohydrate binding, catalytic activity, enzyme regulator activity, protein binding and hydrolase activity was enriched. Although cellular component distribution showed all cellular parts including endoplasmic reticulum, plastid etc., extracellular region was profoundly enriched. Since acceptable annotation of T. aestivum genome was not available, insights into functional annotation were achieved using blast against Oryza sativa japonica group using the STRING platform v10.5 (https://string-db.org/). Pfam enrichment was performed to gain comprehensive understanding about the gene families involved in the infection process. Pathways intricate to this interaction mechanism were explored by KEGG enrichment of DEGs using ClueGo (cytoscape plugin) using O. sativa blast hits. After several enrichments and annotations, major components involved in the interaction were recognized as glycolysis, phenylpropanoid biosynthesis, protein processing in endoplasmic reticulum, photosynthesis, glyoxylate and dicarboxylate metabolism, heat shock proteins, protein kinases and defense response genes like chitinases and hydrolases. Down-regulation of several defense responsive genes in biotrophic phase suggests the contribution of effector mediated susceptibility. Glutathione metabolism mediated regulation of glycolysis and pentose phosphate pathway was identified. Differential expressions of multiple components of ubiquitin mediated proteolysis emphasize their role in hormone signal transduction during spot blotch. Of these DEGs, 177 genes were differentially expressed across all the three time points irrespective of the phases. Co-expression analysis using k-means clustering showed six patterns. Annotations showed that these genes had activities like chitin catabolic process, defense response to fungus, Bowman-Birk proteinase inhibitor and phenylalanine ammonia-lyase. Further information about the significance of these genes during interaction with the pathogen needs to be revealed using over/under expression experiments. Likewise, to recognize the resistance phenomenon, we sequenced the transcriptome of spot blotch resistant (T. aestivum) hexaploid variety, Chirya 3 upon B. sorokiniana inoculation. Differential expression analysis was performed for three stages i.e. 1 dpi, 4 dpi and 6 dpi, which depicts the biotrophic, early necrotrophic and necrotrophic phases in the spot blotch susceptible variety. Our results showed that the number of upregulated genes was higher than downregulated genes. GO annotation was obtained for 64.38%, 66.6% and 64.25% genes from the DEGs. A higher number of genes were unannotated and were found to have significantly higher fold change expression. This suggests that these genes with unknown function could be novel defense responsive genes from wheat. Comparison of gene ontology enrichment showed that biological processes like photosynthesis and cell death were affected in susceptible variety but not in the resistant variety. Whereas, enhanced activity of extracellular proteinase inhibitors and peroxidases was observed in the resistant variety. Thus, early recognition and activation of defense pathways in resistant variety appears to hinder pathogen growth, survival and hence infection. The results from transcriptome sequencing analyses demand confirmation using other complementary techniques like the quantitative reverse transcriptase polymerase chain reaction (qRT PCR), which is an indispensable tool for gene expression analyses. The most adopted method for relative quantification of gene expression in qRT PCR is based on the DDCt method. However, accurate quantification by this method requires an appropriate internal reference gene with stable expression across all or most of the experimental tissues. Selecting an appropriate internal reference gene is very important to elucidate the target gene expression reliably. Several housekeeping genes including 18S rRNA, ACTIN, GAPDH and EF-1α have been proposed as standard reference genes for qRT PCR studies. However, in case of plant pathogen interaction analyses, selection of an appropriate reference gene is even more crucial due to the presence of RNA from both the plant as well as the pathogen in the infected tissues. As several of these genes are also present in the fungal pathogen genome, this could result in unintended cross amplification; which can cause improper quantification of the target genes. Hence, we aimed to identify a wheat gene with the most stable expression and unique primers, which would selectively amplify only the wheat gene and not the pathogen gene, providing accurate quantification of the target genes. Hence, we evaluated six previously reported genes with expression stability under different conditions using the wheat-Bipolaris sorokiniana system. We employed various statistical analysis methods, based on which, we identified two most stable genes, ubiquitin conjugation enzyme (ULE) and phytochelatin synthase (PCS) as the best reference genes for qRT-PCR based quantification in wheat pathosystem. We further confirmed the expression of several candidate defense genes in wheat using ULE as the reference gene. However, both the genes can be used either individually or together as internal reference genes. Chapter 4: Global gene expression analysis of Bipolaris sorokiniana after exposure to propiconazole Integrated disease management has been proposed to control the spot blotch disease. However, due to the unavailability of spot blotch resistant wheat varieties, the application of foliar fungicide is the most widely practiced measure. Propiconazole is a commonly used azole fungicide to manage the spot blotch disease in the field. However, due to its fungistatic mode of action, there is a possibility of emergence of fungicide resistant pathogen strains. Several mechanisms are reported for azole resistance in fungi. However, the strategies vary in different fungi. Resistance to the fungicide could be attributed to multiple molecular components in the fungus. Moreover, azoles have multiple modes of action out of which few are not explored yet. Global transcriptomics analysis of the pathogen after exposure to sub-lethal doses of the fungicide can reveal the mechanism of survival as well as the mode of action of the azoles in the fungi. Hence, a time series gene expression analysis was performed using RNA-seq. Transcriptome analysis using various tools showed overexpression of the target genes in the sterol biosynthesis pathway of the pathogen. In addition, this study also revealed altered expression of several metabolic pathways, transporters and stress regulators in the pathogen. The use of multiple analysis tools for transcriptomics analysis provided additional confidence on the observed results. The observed results were validated using qRT-PCR. We explored three strategies in B. sorokiniana against propiconazole stress: i) overexpression of target enzymes, ii) increased expression of transporter genes, and iii) expression modulation of stress responsive factors. This study revealed several novel putative targets such as ent-kaurene oxidase, ligninase lg6 precursor and spore germination protein. These genes help the fungi to overcome stresses and survive. Hence, the drugs targeting these genes can be developed, which are expected to impair the stress tolerance and hence survival of the pathogen. However, resistance is a polygenic phenomenon and to understand the functional contribution of each gene, knockout/knockdown studies are suggested. Chapter 5: Conclusions and Future Prospects Spot blotch is an emerging disease causing yield losses of economically important cereals. The worldwide distribution of the causal agent, B. sorokiniana makes it of global concern. In the present study, we aimed to explore the mechanism of interaction of the pathogen with spot blotch susceptible and resistant wheat varieties. Initially, we established monoconidial cultures of seven isolates of B. sorokiniana collected from three different wheat growing regions of India and characterized them at morphological and molecular level. Although pathogenicity cannot directly be correlated with morphology on culture media, melanization level might be considered an important aspect in determining the level of virulence. Effector mediated downregulation of innate immunity and delayed response by plants leads to successful establishment of the pathogen in susceptible variety. We found that differential expression of ubiquitin mediated proteolysis played a key role in development of the disease in susceptible variety. On the contrary, proteinase inhibitors and peroxidase secretion led to effective elimination of pathogen in the resistant variety. Genotypes with higher expression of these genes are likely to provide improved resistance against the spot blotch disease. As integrated disease management is a sustainable approach which also includes judicial use of fungicides to control the disease; we explored novel targets for developing efficient fungicides. However, essentiality of these genes for the pathogen survival needs to be confirmed through knock-out/down studies. Overall, this study helped in understanding the molecular paradigm of spot blotch disease in wheat. The outcome of this study will assist in advancement of controlling measures against spot blotch.
AcSIR

O trigo é o principal cereal componente dos produtos amiláceos atualmente consumido pela população. Além das limitações econômicas e políticas, a produção brasileira de trigo encontra obstáculos como a incidência de doenças, muitas delas causadas por fungos. O fitopatógeno Bipolaris sorokiniana é o agente etiológico da helmintosporiose, cujo controle é baseado principalmente em antifúngicos sintéticos. O fungo não é o principal causador de patologias em trigo, mas é importante do ponto de vista fitossanitário nas plantações, pois se mantém no solo por longo período de tempo podendo atacar as plantações em climas úmidos e quentes. O presente estudo teve objetivos avaliar a maior atividade antifúngica de três isolados de Bacillus sp. contra 34 isolados B. sorokiniana, selecionar uma linhagem de Bacillus sp., elucidar sua atividade inibitória in vivo e avaliar as melhores condições de cultivo, propriedades físicoquímicas do cultivo filtrado obtido e a atividade antifúngica in vitro do mesmo. A bactéria com a melhor ação antagonista foi analisada quanto à produção das enzimas caseinase e lipase, produção e atividade do filtrado de cultivo em diferentes meios e após tratamento térmico e variação de pH. Também foi realizado um teste in vivo do antagonista conta o isolado 98031 do fungo. Os três isolados de Bacillus foram capazes de inibir in vitro os isolados de B. sorokiniana, mas destacaram-se os isolados E164 e C98017. Quando testado in vivo, o isolado Bacillus E164 causou efeitos sobre a morfologia da planta, como redução significativa no comprimento das raízes. No entanto, não foi possível observar um nível elevado de proteção visto que mesmo as plantas infectadas não apresentaram os sintomas da doença. A produção do filtrado foi baseada em caldo triptona de soja, uma vez que a inibição foi similar ao meio com palha de milho e maior que o meio com extrato de malte. O filtrado antifúngico apresentou resistência à fervura por até 90 minutos, mas a atividade foi significativamente diminuída nesse tratamento quando comparada aos tratamentos de 50 a 80ºC e temperatura ambiente. A refrigeração e o congelamento não causaram diminuição na atividade do filtrado. A influência do grau de ionização foi percebida nos pHs 5, 6, 8 e 10. O isolado de Bacillus E164 apresentou atividade proteolítica e lipolítica em meios específicos. O controle exercido pelo isolado Bacillus E164 sobre B. sorokininana foi relevante nos testes in vitro. Porém, a influência e a importância da ação do(s) metabólito(s) produzido(s) por esse microrganismo devem ser mais estudados para uma possível aplicabilidade in vivo.
Wheat is the main cereal component of starch products consumed by the population. Brazilian wheat production has many limitations such as government policies, economic problems, and apart from there is a large loss in production due to diseases caused by fungi. Bipolaris sorokiniana is a phytopathogen that causes helminthosporiosis in cereal crops, whose control is mainly rely on synthetical antifungal agents. It has phytossanitary importance, since it can live for a long period in the soil, and attack crops on wet and warm weather conditions. The objectives of this work were to evaluate the antifungal activity of three Bacillus sp. Strains against 34 B. sorokiniana isolates, to select the best inhibitor of them, to elucidate its action in vivo and evaluate the best cultive conditions, physic and chemical properties of the filtrated obtained and in vitro antifungal capacity. The best bacterial strain was chosen and analyzed for the proteolytic and lipolytic activities, productions and activity of the cultive filtrated after growing on different culture media and after thermal treatment or pH variation. In vivo test was made on wheat infected by 98031 isolate. All bacterial isolates were active against B. sorokiniana but E164 and C98017T were better than OR13. On in vivo test the isolate E164 caused morphological effects on the plant as significant root length reduction. Increase of plants protection was not observed, as even infected ones did not presented disease symptoms. Filtrated production was based in tryptic casein soy broth as the inhibition degree was similar to the corn straw culture and greater than malt extract broth culture. The antifungal filtrated resisted until 90 minutes at 100ºC, but significant decrease of activity was observed in this treatment when compared to 50ºC to 80ºC and environment temperature. Refrigeration and freezing did not cause loss on filtrated activity. Ionization degree influence was observed in pH 5, 6, 8 and 10. Bacillus E164 showed proteolytic and lipolytic activities in specific media. Control exerted by Bacillus E164 over B. sorokiniana isolates was relevant in vitro, nevertheless the influence and importance of the metabolites produced must be elucidated for the application in vivo.

Growth media recycling during algae cultivation is necessary to increase the efficiency and reduce the cost of biofuel production from algae feedstocks. Without recycling media, the cost of algae based biofuel production would be prohibitively high and large scale algae based biofuel production would not be economically viable. The ratio of media recycled to media wasted assumed for algae farms is generally calculated to maintain salt concentrations below growth inhibitory levels, ignoring the influence of secondary metabolites which might decrease productivity. Secondary metabolites, which include allelopathic or auto-inhibitory biological contaminants, might lead to the accumulation of growth-inhibiting compounds in recycled media used in algae production. Chlorella sorokiniana (strain DOE1412) was a leading algae biofuel feedstock candidate and has not previously been evaluated for inhibitor production. To test the effects of water recycling on the growth of DOE1412, media was recycled through multiple rounds of algae cultivation. DOE1412 was grown in modified BG11 culture media until reaching the end of linear growth phase, at which point the biomass was removed, nutrients replenished to their initial concentrations, and the recycled culture media used for a subsequent round of growth. The culture media was recycled through five rounds of growth with cultures grown on recycled media compared to controls grown on freshly prepared growth media. Biomass density was monitored via optical density and the specific and productivity growth rates were used to quantify the extent of inhibition. Exploratory work was performed with the goal of identifying potential inhibitory substances produced by DOE1412 during cultivation. Samples of recycled media were analyzed for polyunsaturated fatty acids which have been demonstrated to be inhibitory. The carbohydrates content of used media was analyzed to assess the amount of organic materials shed by DOE1412 into recycled media during growth. The log phase growth rate (day-1) of DOE1412 was inhibited by 3±2%, 8±1%, 10±2%, and 18.6±0.9% when grown in media recycled 1-4 times, respectively, with a 99% level of confidence that inhibition was observed in each round of regrowth. The productivity growth rate (OD750/day) of DOE1412 was not inhibited in media recycled 1-3 times. The productivity growth rate of DOE1412 was inhibited by 13±3% when grown in media recycled 4 times with a 99% level of confidence that inhibition was observed. Zinc was found to accumulate in the recycled media to potentially toxic levels (>0.09 mg/L), therefore it is uncertain if the observed inhibition was due to an accumulation of inhibitory secondary metabolites or the accumulation of zinc. Two inhibitory polyunsaturated acids, linoleic and linolenic acid, were identified in media recycled 4 times. The carbohydrate content of recycled media fluctuated between 8-10% of total fixed carbon in media recycled 1-3 times and increased to 18% in media recycled 4 times. However, changes observed in media recycled 4 times may have been due to improper storage of used media.

Neste trabalho de mestrado, investigou-se o desempenho de membranas poliméricas de microfiltração para retenção de microalgas (Chlorella sorokiniana) em um fotobiorreator com capacidade volumétrica de 3,5 L, alimentado por um fluxo contínuo de nutrientes com pH 7,0 em condições controladas de temperatura (21°C no meio de cultura e 24°C no meio), borbulhamento de ar e luminosidade (2500 lux, em fotoperíodo de 12/12 horas claro/escuro). Membranas comerciais de tamanho médio de poros 0,8, 1,2, 3,0 e 5,0 μm foram testadas pelo tempo suficiente para esgotamento do limite da permeação da membrana. A concentração das microalgas no fotobiorreator foi analisada através de densidade óptica (espectofotometria) ao número de células (contagem de unidades de células em lâminas do tipo Fuchs Rosenthal - Microscopia Óptica) das amostras de concentrado e permeado. O fenômeno físico de polarização sobre a superfície da membrana está diretamente relacionado ao desempenho da mesma na retenção de microalgas, portanto, fotomicrografias (MEV) da membrana antes e após a microfiltração foram analisadas e comparadas. Para analisar a composição química das microalgas, bem como sua afinidade com as membranas, foram investigadas a composição e a caracterização do fenômeno químico sobre a superfície da membrana, por análise de Energia Dispersiva de Raio-X (EDX). Análises das diferentes fases de crescimento das algas e seus componentes foram feitas em amostras secas a 40°C, através de análise elementar e análises térmicas (TG- Análise Termogravimétrica e DTA- Análise Térmica Diferencial). Os resultados experimentais obtidos neste trabalho permitiram concluir que o uso de membranas de microfiltração em fotobiorreator proporciona a retenção das microalgas, o que contribui para o aumento da concentração da biomassa algal, permitindo a manipulação da sua composição de acordo com as condições pelas quais estes microrganismos são submetidos.
This dissertation investigates the performance of polymeric microfiltration membranes for microalgae retention (Chlorella sorokiniana) in photobioreactor with a volumetric capacity of 3.5 L. The reactor is fed by a continuous flow of nutrients under controlled conditions of pH (7,0) and the temperature (21°C in culture medium and 24°C in the environment), bubbling air and light (2500 lux, with a photoperiod of 12/12 hour light/dark). Commercial membranes of the average pore sizes of 0.8, 1.2, 3.0 and 5.0 μm were tested by depletion of time sufficient to limit the permeation of the membranes. The microalgae concentration in the photobioreactor was analyzed by optical density (spectrophotometry) and number of cells (cell units count on Fuchs Rosenthal type plates-Optical Microscopy). The physical phenomenon of polarization on the surface of the membrane is directly related to its performance in the retention of microalgae therefore micrographs (SEM) of the membrane before and after the microfiltration were compared to identify the chemical affinity between the membranescomposition and the microalgae. The chemical phenomenon on the membrane surface was characterized by Energy Dispersive Analysis of X-ray (EDX). The different phases of the growth of algae and their components were measured in samples dried at 40°C, by elemental analysis and thermal analysis (TG-DTA-Thermogravimetric analysis and differential thermal analysis). The experimental results indicate that the use of microfiltration membranes provides the retention of microalgae, contributing to the increase in the concentration of algal biomass and allowing the manipulation of the composition according to the conditions under which these microrganisms are subjected.

Made available in DSpace on 2014-06-11T19:27:25Z (GMT). No. of bitstreams: 0 Previous issue date: 2003-07-25Bitstream added on 2014-06-13T20:16:40Z : No. of bitstreams: 1 oki_cs_me_rcla.pdf: 401222 bytes, checksum: 906f2bd0a42ac566c29e10600105efc6 (MD5)
Microalgas quando se desenvolvem intensamente recebem o nome de florações. Como conseqüência formam-se flocos ou cobertura laminar que podem obstruir os sistemas de tratamento de água para uso industrial ou doméstico. Tratamentos convencionais por insumos químicos no sentido de inibir o crescimento nem sempre são eficientes. Na busca de métodos alternativos para o controle da população de microalgas, procurou-se aplicar ondas ultra-sônicas para destruir as células destes microrganismos. As espécies Selenastrum capricornutum e Chlorella sorokiniana foram cultivadas em meio mineral sólido e líquido por cerca de cinco dias. Amostras de 50 mL foram irradiadas com ultra-som de freqüência 20 KHz com amplitude de 80 % e sonda de 9 mm de diâmetro nos tempos: 30 segundos; 01; 10; 12 e 15 minutos. As células foram quantificadas em Câmara de Neubauer procedendo-se cinco contagens para cada tempo de sonicação. Os resultados com a S. capricornutum demonstraram que o ultra-som promove a desagregação celular após irradiação de 30 segundos identificado pelo aumento do número de células, permitindo que se infira que em algumas situações os resultados das contagens podem não ser totalmente exatas. Entretanto, a sonicação após dez minutos produziu 88% e 82% de morte da Chlorella sorokiniana e S. capricornutum respectivamente.
Micro-algae when developing intensely under favorable conditions is said to be flourishing. As consequence, flakes or laminar layer formations can obstruct industrial or domestic water treatment plant installations. Conventional treatments utilizing chemicals are not always very efficient in inhibiting these formations. In the search for alternative methods to control the micro-algae population we tried the application of ultra-sound for the destruction of the cells of these microorganisms. Selenastrum capricornutum and Chlorella sorokiniana were cultivated in solid and liquid mineral media for about 5 days. 50 mL samples were irradiated with ultra-sound with a frequency of 20 KHz, 80% amplitude and a 9 mm probe for: 30 seconds; 01; 10; 12 and 15 minutes. The cells were quantified in a Neubauer Chamber with 5 counts being done for each individual exposure time. The results with the S. capricornutum showed that a 30 seconds application of ultra-sound promotes cellular desegregation, evidenced by the results from counts are not reliable. We were able to determine though that the application of ultra-sound for 10 minutes was able to kill 88% and 82% of the Chlorella sorokiniana and S. capricornutum respectively.

Philosophiae Doctor - PhD
Biofuel production from microalgae is currently not economically competitive with fossil fuels due to high operational costs. A sustainable system needs to be developed which considers cultivation, harvesting and conversion to fuels as a single loop. The harvesting step has been identified as a major bottleneck within the biofuel production process, contributing to a significant proportion of the operational cost (20-30%). Chemical flocculation is a more affordable alternative to centrifugation and filtration. Chemical flocculants however negatively impact the quality of biomass and conversion efficiency to biofuel by increasing biomass ash content. Bioflocculation with biopolymers or microbes have a minimal impact on the quality of biomass. In this study, the interaction between the filamentous fungus Isaria fumosorosea and the microalgae C. sorokiniana is investigated. Under strict autotrophic conditions at pH 7-8, co-culture of microalgae (2-20 μm) with fungal blastospores resulted in theidevelopment of large pellets (1-2 mm) which may be easily harvested by sedimentation or filtration at 95% harvesting efficiency. Fungal assisted bioflocculation was compared to other harvesting methods with respect to cost and impact on the hydrothermal conversion process. Low cost carbon sources, including waste hydrothermal nutrients, minimal sugar concentrations and algal exudate may reduce fungal cultivation costs. Waste products, such as organic carbon, N, P, CO₂ and trace metals can be recycled and used for algae and fungal cultivation, closing the loop to make the system sustainable.
National Research Foundation; Swiss Government

Microalgas quando se desenvolvem intensamente recebem o nome de florações. Como conseqüência formam-se flocos ou cobertura laminar que podem obstruir os sistemas de tratamento de água para uso industrial ou doméstico. Tratamentos convencionais por insumos químicos no sentido de inibir o crescimento nem sempre são eficientes. Na busca de métodos alternativos para o controle da população de microalgas, procurou-se aplicar ondas ultra-sônicas para destruir as células destes microrganismos. As espécies Selenastrum capricornutum e Chlorella sorokiniana foram cultivadas em meio mineral sólido e líquido por cerca de cinco dias. Amostras de 50 mL foram irradiadas com ultra-som de freqüência 20 KHz com amplitude de 80 % e sonda de 9 mm de diâmetro nos tempos: 30 segundos; 01; 10; 12 e 15 minutos. As células foram quantificadas em Câmara de Neubauer procedendo-se cinco contagens para cada tempo de sonicação. Os resultados com a S. capricornutum demonstraram que o ultra-som promove a desagregação celular após irradiação de 30 segundos identificado pelo aumento do número de células, permitindo que se infira que em algumas situações os resultados das contagens podem não ser totalmente exatas. Entretanto, a sonicação após dez minutos produziu 88% e 82% de morte da Chlorella sorokiniana e S. capricornutum respectivamente.
Micro-algae when developing intensely under favorable conditions is said to be flourishing. As consequence, flakes or laminar layer formations can obstruct industrial or domestic water treatment plant installations. Conventional treatments utilizing chemicals are not always very efficient in inhibiting these formations. In the search for alternative methods to control the micro-algae population we tried the application of ultra-sound for the destruction of the cells of these microorganisms. Selenastrum capricornutum and Chlorella sorokiniana were cultivated in solid and liquid mineral media for about 5 days. 50 mL samples were irradiated with ultra-sound with a frequency of 20 KHz, 80% amplitude and a 9 mm probe for: 30 seconds; 01; 10; 12 and 15 minutes. The cells were quantified in a Neubauer Chamber with 5 counts being done for each individual exposure time. The results with the S. capricornutum showed that a 30 seconds application of ultra-sound promotes cellular desegregation, evidenced by the results from counts are not reliable. We were able to determine though that the application of ultra-sound for 10 minutes was able to kill 88% and 82% of the Chlorella sorokiniana and S. capricornutum respectively.
Orientador: Antonio Carlos Simões Pião
Coorientador: Dejanira de Franceschi de Angelis
Coorientador: Roberto Naves Domingos
Banca: Antonio Carlos Simões Pião
Banca: Ana Paula de Arruda Geraldes Kataoka
Banca: Lucia Helena de Mendonça Vargas
Mestre

Uncovering the structure of bacterial communities in wastewater, which is an alternative growth medium for microalgae, is necessary to improve the quality of algal products. The results of the work indicate the sustainability of the growth of Chlorella sorokiniana in distinct non-sterile domestic wastewaters, both in terms of bioremediation and the production of valuable products.

Helminthosporiosis caused by the fungus Drechslera sorokiniana (Sacc.) causes significant crop and quality losses to Triticum aestivum L. in agroecological conditions with extreme humidity. Increasing the resistance is considered the most cost-effective and sustainable approach to disease control. The aim of this study was to determine the genetic effects involved in the inheritance of resistance, using the ge-netic model of character reproduction in descendants of wheat. Generations F1, F2, BCP1 and BCP2, de-scended from the mutual crossing of the parents Basarabeanca / Moldova 30 and Moldova 30 / Moldova 3 (P1 and P2) were evaluated for the response of callus characters to the action of D. sorokiniana culture filtrate on the medium Murashige Skoog. Fungal metabolites have decreased the effects of gene actions and epistatic interactions, but also their variance. The phenomenon corresponds to the decrease of callus indices. A great importance for the heredity of the character of the surface of the callus manifested the epistatic effects of additive-dominant (ad) type. In the case of callus biomass comparable to the mean val-ues were the a actions, but also the ad and dd epistatic effects. The predominant involvement of epistatic effects indicates the need for resistance selections to helminthosporiosis in late generations of wheat.

The article presents data on the effects of the interaction of common wheat with the fungus Drechslera sorokiniana on grain vigor. Its differentiated action on germination and seedling length (LP) was found. The vigor index (VI) depended more on LP (r = 0.90 *) than on the germination 278 level (r = 0.52 *, p≤0.05). The coefficient of heritability in the broad sense (h2) was 71.3% for LP and 60.1% – for VI. The association of h2 and genetic progress with high values reveals the pronounced contribution of additive genetic variance in the control of the vigor index, which offers increased opportunities in the selection of wheat plants resistant to this pathogen in restricted terms.

The study established different reactions of the growth characters of the autumn common wheat seedlings to the treatment of seeds of genotypes Moldova 614, Moldova 66 and L Selania / Accent with the culture filtrates of the strains of Alternaria alternata, Drechslera sorokiniana and Fusarium solani. The 3 strains of the F. solani pathogen produced concomitant repression of root and stem in Moldova 614 and Moldova 66, but differentiated in L Selania / Accent, being identified as the most aggressive in this study. The highest sensitivity was recorded by L Selania / Accent in the case of the root under the action of Alternaria alternata strains.