Auswahl der wissenschaftlichen Literatur zum Thema „Identity Testing in Number Fields“

Geben Sie eine Quelle nach APA, MLA, Chicago, Harvard und anderen Zitierweisen an

Wählen Sie eine Art der Quelle aus:

Machen Sie sich mit den Listen der aktuellen Artikel, Bücher, Dissertationen, Berichten und anderer wissenschaftlichen Quellen zum Thema "Identity Testing in Number Fields" bekannt.

Neben jedem Werk im Literaturverzeichnis ist die Option "Zur Bibliographie hinzufügen" verfügbar. Nutzen Sie sie, wird Ihre bibliographische Angabe des gewählten Werkes nach der nötigen Zitierweise (APA, MLA, Harvard, Chicago, Vancouver usw.) automatisch gestaltet.

Sie können auch den vollen Text der wissenschaftlichen Publikation im PDF-Format herunterladen und eine Online-Annotation der Arbeit lesen, wenn die relevanten Parameter in den Metadaten verfügbar sind.

Zeitschriftenartikel zum Thema "Identity Testing in Number Fields"

1

Mérai, László. „Values of rational functions in small subgroups of finite fields and the identity testing problem from powers“. International Journal of Number Theory 16, Nr. 02 (18.09.2019): 219–31. http://dx.doi.org/10.1142/s1793042120500128.

Der volle Inhalt der Quelle
Annotation:
Motivated by some algorithmic problems, we give lower bounds on the size of the multiplicative groups containing rational function images of low-dimensional affine subspaces of a finite field [Formula: see text] considered as a linear space over a subfield [Formula: see text]. We apply this to the recently introduced algorithmic problem of identity testing of “hidden” polynomials [Formula: see text] and [Formula: see text] over a high degree extension of a finite field, given oracle access to [Formula: see text] and [Formula: see text].
APA, Harvard, Vancouver, ISO und andere Zitierweisen
2

Karpinski, Marek, László Mérai und Igor E. Shparlinski. „Identity testing and interpolation from high powers of polynomials of large degree over finite fields“. Journal of Complexity 49 (Dezember 2018): 74–84. http://dx.doi.org/10.1016/j.jco.2018.07.006.

Der volle Inhalt der Quelle
APA, Harvard, Vancouver, ISO und andere Zitierweisen
3

MacKenzie, Tyler D. B., Manphool S. Fageria, Xianzhou Nie und Mathuresh Singh. „Effects of Crop Management Practices on Current-Season Spread of Potato virus Y“. Plant Disease 98, Nr. 2 (Februar 2014): 213–22. http://dx.doi.org/10.1094/pdis-04-13-0403-re.

Der volle Inhalt der Quelle
Annotation:
The current-season spread of Potato virus Y (PVY) was monitored in 19 fields under various management practices in New Brunswick, Canada, through the 2011 and 2012 growing seasons. The focus of this study was to evaluate the role of seedborne PVY inoculum, aphid vector abundance, and the numbers, timing, and types of insecticide and mineral oil sprays, and to confirm the reliability and forecasting capacity of midseason PVY testing. In each field, 100 to 110 virus-free plants were identified shortly after emergence and were assessed four times from early July to early September (after top-kill) with enzyme-linked immunosorbent assay (ELISA) and reverse-transcription polymerase chain reaction (RT-PCR) to track PVY spread. In addition, tubers harvested during development in August and after top-kill were grown-out in the greenhouse for ELISA testing. PVY spread to selected virus-free plants varied widely, ranging from 0 to 76.2% across all studied fields. Of the 19 fields over two seasons, 10 fields were planted with no detectable seedborne PVY, and they showed 0 to 8.7% (mean 2.9%) PVY spread by harvest. The remaining nine study fields with 0.9 to 5.8% seedborne PVY showed 1 to 76.2% (mean 15.2%) PVY spread by harvest. PVY spread was detected in most fields during midseason testing with ELISA and RT-PCR; all tests correlated well with final PVY rates after top-kill, though RT-PCR detection in developing tubers was most sensitive and correlated. Logistic regression modeling was used to identify major factors in PVY spread, including seedborne PVY, early-season aphid abundance, and the numbers of insecticide and mineral oil sprays. The best-fitting model, constructed using these factors as well as a measurement of July PVY incidence (ELISAJuly), strongly explained PVY spread by harvest, with the most significant management factor being the number of mineral oil sprays supplemented with insecticide used during the growing season. A similar model fitted without the ELISAJuly did not adequately predict ultimate PVY spread. The analysis suggests that mineral oil alone was effective at lowering PVY spread, and more effective when combined with insecticide, particularly when used early in the season. No evidence was found for differences in PVY spread across the eight cultivars used or across the range of mineral oil application rates, whereas some evidence was found for differences in the effectiveness of different insecticide types.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
4

Agussalim, Muliana Djafar und Andi Syam Rizal. „Analisis Potensi Debit Air Tanah Melalui Pumping Test Metode Step Draw Down pada Sumur Bor Irigasi di Desa Bonto Rannu, Kecamatan Kajang, Kabupaten Bulukumba, Sulawesi Selatan“. JFT: Jurnal Fisika dan Terapannya 9, Nr. 2 (31.12.2022): 127–37. http://dx.doi.org/10.24252/jft.v9i2.32277.

Der volle Inhalt der Quelle
Annotation:
The rice fields in Bonto Rannu Village, Kajang District, Bulukumba Regency are dominated by rainfed rice fields. This species has limitations in the dry season because irrigation/agricultural irrigation completely depends on rainwater. Therefore, it is necessary to identify alternative irrigation sources to sustain farmers' farming activities in Bonto Rannu Village. This study aims to analyze the number of groundwater wells by testing in the form of a pump test (pumping test) with the step draw-down method. The optimum discharge (Qopt) of well 1 is 0.01876 m3/s or 67.53 m3/hour with an optimum Sw of 2.891 m. This shows that groundwater in well one can be pumped at 67.53 m3/hour with a decreased water level of 2.891 m, with the pump condition still technically safe. As for well 2, the optimum discharge (Qopt) is 0.00318 m3/s or 11.45 m3/hour with an optimum Sw of 2.100 m. These data indicate that there are limited groundwater reserves.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
5

Bazanova, E. M., A. V. Gorizontova, N. N. Gribova, T. M. Chikake und A. V. Samosyuk. „Development and Prospects of National Intelligent System for Testing General Language Competencies Deployed Through Neural Network Solutions“. Vysshee Obrazovanie v Rossii = Higher Education in Russia 32, Nr. 8-9 (13.09.2023): 147–66. http://dx.doi.org/10.31992/0869-3617-2023-32-8-9-147-166.

Der volle Inhalt der Quelle
Annotation:
The article presents the results of approbation of the intellectual system for testing general language competences (ISTOK) developed by testologists, linguists, specialists in methodology of teaching foreign languages and in artificial intelligence. This system includes a range of tests assessing language ability at levels from A2 to C1 of the Common European Framework of Reference (CEFR), as well as an adaptive placement test. All test materials are calibrated according to the CEFR. ISTOK is an adaptive testing system deployed through neural network solutions and providing assessment of receptive and productive language skills (reading, listening, speaking and writing) by using artificial intelligence and/or neurolinguistic models. The process of ISTOK development implied, apart from writing test items, putting together databases of writing and speaking assignments marked by professional assessors and assessment criteria for productive skills, as well as algorithms to identify various types of mistakes with the help of artificial intelligence. The results of various testing cohorts with the total number of test takers exceeding 5,000 demonstrated high reliability and objectified test validity. The new approach to language skills testing can be used for various purposes in higher education institutions, as well and to identify and/or confirm language proficiency of personnel in different organisations and businesses, while the principles of training and practical use of neurolinguistic models will find wide application in various fields of applied research.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
6

Kotsiubivska, Kateryna, Olena Tymoshenko, Kostiantyn Bulyha und Ihor Yarokhno. „Application of Pseudo-Random Numbers in System Design“. Digital Platform: Information Technologies in Sociocultural Sphere 6, Nr. 1 (10.07.2023): 53–62. http://dx.doi.org/10.31866/2617-796x.6.1.2023.283945.

Der volle Inhalt der Quelle
Annotation:
The purpose of the article is to study and search for optimal strategies for modelling information systems using pseudo-random numbers to improve the performance of information systems and to determine the optimal parameters of random number distributions; to analyze efficient algorithms for generating pseudo-random numbers. The research methods are based on the application of a systematic approach to analyzing the benefits of using pseudorandom numbers in the design of information systems. Scientific novelty. The article analyses the advantages of stochastic modelling of information systems using different approaches to generating pseudorandom numbers, and for the first time considers the application of a random decision tree forest for modelling queuing systems. Conclusions. The application of pseudorandom numbers in system design is an urgent problem that requires further research and development of methods. The design of efficient algorithms for generating, validating, and using pseudorandom values plays an essential role in many fields of science and technology. This approach allows for optimization and planning in the process of designing the system and is essential for validating and testing the system. By generating random variables, you can create different test scenarios and check how the system reacts to various conditions, which helps to identify potential errors, flaws, and problems in the system and ensures the quality of the design. Thus, the use of pseudo-random numbers in system design allows for randomness, risk analysis, optimization and planning, validation, and testing. This is an important aspect of system development that helps to ensure their reliability, performance, and efficiency.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
7

Kurbanismailov, Z. M., A. T. Tarlanov und E. M. Akimov. „The technique of point visualization of the electric field in space and time“. Russian Technological Journal 9, Nr. 3 (28.06.2021): 58–65. http://dx.doi.org/10.32362/2500-316x-2021-9-3-58-65.

Der volle Inhalt der Quelle
Annotation:
Testing of electronic devices is an integral part of the technological process of any manufacturer of such equipment. In this case, an electronic device is understood as an energy-intensive unit such as a mobile phone, data center or spacecraft. One of the key stages of testing is to identify the effect of electric fields on various electronic components of the device. This stage often requires making a mock-up of some part of an unfinished device in order to fix interference with special equipment. This requires time, financial and human resource costs. In order to reduce these costs in the modern world, the use of mathematical modeling tools for testing noise immunity and electromagnetic compatibility is becoming popular. In this paper, it is proposed to use an algorithm for visualizing electric fields in three-dimensional space and time. The algorithm is easily embedded into applications as a component of a mathematical modeling system. The work considered three ways of visualizing the electric field strength: starting from a simple setting of points in space, on the basis of which the electric field will be built, around the source of electric field radiation, to the use of algorithms that make it possible to arrange points equidistantly based on a given number of points in space for the formation of an electric field. The performance and visual implications of these methods were analyzed. The proposed methodology will be useful to the developer community as an embedded solution for point visualization of the electric field in any project in any algorithmic language with the ability to animate in time.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
8

Fajri, Muhammad. „Penerapan Digital Signature Untuk Identitas File Audio Dengan Metode Snefru“. Management of Information System Journal 1, Nr. 1 (03.12.2022): 19–28. http://dx.doi.org/10.47065/mis.v1i1.397.

Der volle Inhalt der Quelle
Annotation:
In the era of information technology that is developing very rapidly, the use of signatures has been widely applied digitally through digital signatures. Digital signatures along with the times have led to the need for authentication of data or files that are used digitally. Its use also aims to avoid counterfeiting or interference. Currently, the use of digital signatures has been widely applied to software distribution, financial transactions, file transfers. The crime of falsifying audio files is a serious problem in various fields. Audio authenticity testing is important and significant in all social areas, especially when audio is used as evidence for conclusions in courts, the basis for judicial decision-making, and corporate reports. Forgery of audio files will cause losses that cannot be estimated. One solution to the problems mentioned above is to perform the process of assigning an identity to the audio file, so that it can be seen that the audio cannot be manipulated. The SNEFRU method is a hash function to detect changes in digital audio. SNEFRU has several variants, varying in number of operands and hash size. The supported hash sizes are 128 and 256 bits. The number of passes in the final 2-pass variant source of SNEFRU is two passes, while a more secure 4-pass version is also available. After the previous attack was published, the 8-pass version was introduced as well. This 8-pass version is still considered safe.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
9

Nuthakki, Siddhartha, Sai Kalyana pranitha buddiga und Sonika Koganti. „Exploring Deep Learning Models for Image Recognition: A Comparative Review“. Signal & Image Processing : An International Journal 15, Nr. 3 (28.06.2024): 01–10. http://dx.doi.org/10.5121/sipij.2024.15301.

Der volle Inhalt der Quelle
Annotation:
Image recognition, which comes under Artificial Intelligence (AI) is a critical aspect of computer vision, enabling computers or other computing devices to identify and categorize objects within images. Among numerous fields of life, food processing is an important area, in which image processing plays a vital role, both for producers and consumers. This study focuses on the binary classification of strawberries, where images are sorted into one of two categories. We Utilized a dataset of strawberry images for this study; we aim to determine the effectiveness of different models in identifying whether an image contains strawberries. This research has practical applications in fields such as agriculture and quality control. We compared various popular deep learning models, including MobileNetV2, Convolutional Neural Networks (CNN), and DenseNet121, for binary classification of strawberry images. The accuracy achieved by MobileNetV2 is 96.7%, CNN is 99.8%, and DenseNet121 is 93.6%. Through rigorous testing and analysis, our results demonstrate that CNN outperforms the other models in this task. In the future, the deep learning models can be evaluated on a richer and larger number of images (datasets) for better/improved results.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
10

Martin, R. R., I. E. Tzanetakis, J. E. Barnes und J. F. Elmhirst. „First Report of Strawberry latent ringspot virus in Strawberry in the United States and Canada“. Plant Disease 88, Nr. 5 (Mai 2004): 575. http://dx.doi.org/10.1094/pdis.2004.88.5.575a.

Der volle Inhalt der Quelle
Annotation:
Strawberries in southern California have shown decline symptoms during the last 2 years. More than 70% of plants tested in California were infected with two newly identified criniviruses that infect strawberry (Strawberry pallidosis and Beet pseudo-yellows). Strawberry cultivars are usually symptomless when infected with one virus, and testing for other strawberry viruses is performed to identify any other viruses that may be involved in the symptomatology. Primers SLRSV F (5′ CCTCTCCAACC-TGCTAGACT 3′) and SLRSV R (5′ AAGCGCATGAAGGTGTAACT 3′) that amplify a 497-bp fragment of RNA 2 of Strawberry latent ringspot virus (SLRSV) were developed and utilized for reverse transcription-polymerase chain reaction (RT-PCR) detection. SLRSV belongs to the family Sequiviridae and is transmitted by nematodes of the genus Xiphinema. The virus has a broad host range (4) and is usually symptomless in strawberries. Strawberry plants from commercial fields in California, Oregon, Washington, and British Columbia, Canada were tested. SLRSV was identified in 17% of plants tested from California and 4% of plants tested from British Columbia, while all samples from Oregon and Washington tested negative. The fragment amplified (GenBank Accession No. AY461735, isolate from British Columbia, Canada) shares 84% nucleotide and 94% amino acid sequence identity with the previously published sequence of SLRSV from strawberry (GenBank Accession No. X77466) (3). The virus was transmitted mechanically from strawberry samples from Canada to Chenopodium quinoa, and the infected C. quinoa plants tested positive for SLRSV with RT-PCR, while no amplicons were obtained from noninoculated control plants. To our knowledge, this is the first report of SLRSV in strawberry in North America, although it has been previously reported in a single cherry tree in Ontario, Canada (1) and in an imported seed lot of parsley in California (2). The number of plants that tested positive as well as the geographic distribution of the virus indicates that the virus is widespread in California, but further testing is needed to identify its distribution in other states. References: (1) W. R. Allen et al. Phytopathology 60:1262, 1970. (2) C. M. Hanson and R. N. Campbell. Plant Dis. Rep. 63:142, 1979. (3) S. Kreiah et al. J. Gen. Virol. 75:2527, 1994. (4) K. Schmelzer. Phytopath. Z. 66:1, 1969.
APA, Harvard, Vancouver, ISO und andere Zitierweisen

Dissertationen zum Thema "Identity Testing in Number Fields"

1

Nosan, Klara. „Zero problems in polynomial models“. Electronic Thesis or Diss., Université Paris Cité, 2024. http://www.theses.fr/2024UNIP7008.

Der volle Inhalt der Quelle
Annotation:
Les modèles polynomiaux sont omniprésents en informatique, dans l'étude des automates et des langages formels, de l'optimisation, de la théorie des jeux, de la théorie du contrôle et de nombreux autres domaines. Dans cette thèse, nous considérons des modèles décrits par des systèmes d'équations polynomiales et des équations différentielles, où le système évolue à travers un ensemble discret de pas de temps avec des mises à jour polynomiales à chaque pas. Nous explorons trois aspects des « problèmes de zéros » pour les modèles polynomiaux : le test d'identité pour les expressions algébriques données par des polynômes, la détermination de l'existence de racines pour les systèmes polynomiaux et la détermination de l'existence de zéros dans les suites satisfaisant des récurrences à coefficients polynomiaux. Dans la première partie, nous étudions les tests d'identité pour les expressions algébriques impliquant des radicaux. En d'autres termes, étant donné un polynôme à k variables représenté par un circuit algébrique et k radicaux réels, nous examinons la complexité de déterminer si le polynôme s'annule sur l'entrée. Nous améliorons la borne PSPACE existante, en plaçant le problème dans coNP en supposant l'hypothèse de Riemann généralisée (HRG). Nous considérons ensuite une version restreinte du problème, où les entrées sont des racines carrées de nombres premiers impairs, montrant qu'il peut être résolu en temps polynomial randomisé en supposant HRG. Nous considérons ensuite les systèmes d'équations polynomiales et étudions la complexité de déterminer si un système de polynômes à coefficients polynomials a une solution. Nous présentons une approche du problème basée sur la théorie des nombres, généralisant les techniques utilisées pour les tests d'identité, et montrons que le problème appartient à la classe de complexité AM en supposant HRG. Nous analysons le lien entre ce problème et le problème de la détermination de la dimension d'une variété complexe, dont l'appartenance à AM a déjà été prouvé supposant HRG. Dans la dernière partie de cette thèse, nous analysons les suites satisfaisant des récurrences à coefficients polynomiaux. Nous étudions la question de savoir si zéro appartient d'une suite récursive polynomiale résultant d'une somme de deux suites hypergéométriques. Plus précisément, nous considérons le problème pour les suites dont les coefficients polynomiaux se décomposent dans le corps des rationnels Q. Nous montrons sa relation avec les valeurs de la fonction Gamma évaluées en des points rationnels, ce qui permet d'établir la décidabilité du problème supposant la conjecture de Rohrlich-Lang. Nous proposons une nouvelle approche basée sur l'étude des diviseurs premiers de la suite, ce qui nous permet d'établir la décidabilité inconditionnelle du problème
Polynomial models are ubiquitous in computer science, arising in the study of automata and formal languages, optimisation, game theory, control theory, and numerous other areas. In this thesis, we consider models described by polynomial systems of equations and difference equations, where the system evolves through a set of discrete time steps with polynomial updates at every step. We explore three aspects of "zero problems" for polynomial models: zero testing for algebraic expressions given by polynomials, determining the existence of zeros for polynomial systems and determining the existence of zeros for sequences satisfying recurrences with polynomial coefficients. In the first part, we study identity testing for algebraic expressions involving radicals. That is, given a k-variate polynomial represented by an algebraic circuit and k real radicals, we examine the complexity of determining whether the polynomial vanishes on the radical input. We improve on the existing PSPACE bound, placing the problem in coNP assuming the Generalised Riemann Hypothesis (GRH). We further consider a restricted version of the problem, where the inputs are square roots of odd primes, showing that it can be decided in randomised polynomial time assuming GRH. We next consider systems of polynomial equations, and study the complexity of determining whether a system of polynomials with polynomial coefficients has a solution. We present a number-theoretic approach to the problem, generalising techniques used for identity testing, showing the problem belongs to the complexity class AM assuming GRH. We discuss how the problem relates to determining the dimension of a complex variety, which is also known to belong to AM assuming GRH. In the final part of this thesis, we turn our attention to sequences satisfying recurrences with polynomial coefficients. We study the question of whether zero is a member of a polynomially recursive sequence arising as a sum of two hypergeometric sequences. More specifically, we consider the problem for sequences where the polynomial coefficients split over the field of rationals Q. We show its relation to the values of the Gamma function evaluated at rational points, which allows to establish decidability of the problem under the assumption of the Rohrlich-Lang conjecture. We propose a different approach to the problem based on studying the prime divisors of the sequence, allowing us to establish unconditional decidability of the problem
APA, Harvard, Vancouver, ISO und andere Zitierweisen
2

Vishnoi, Nisheeth Kumar. „Theoretical Aspects of Randomization in Computation“. Diss., Georgia Institute of Technology, 2004. http://hdl.handle.net/1853/6424.

Der volle Inhalt der Quelle
Annotation:
Randomness has proved to be a powerful tool in all of computation. It is pervasive in areas such as networking, machine learning, computer graphics, optimization, computational number theory and is "necessary" for cryptography. Though randomized algorithms and protocols assume access to "truly" random bits, in practice, they rely on the output of "imperfect" sources of randomness such as pseudo-random number generators or physical sources. Hence, from a theoretical standpoint, it becomes important to view randomness as a resource and to study the following fundamental questions pertaining to it: Extraction: How do we generate "high quality" random bits from "imperfect" sources? Randomization: How do we use randomness to obtain efficient algorithms? Derandomization: How (and when) can we "remove" our dependence on random bits? In this thesis, we consider important problems in these three prominent and diverse areas pertaining to randomness. In randomness extraction, we present extractors for "oblivious bit fixing sources". In (a non-traditional use of) randomization, we have obtained results in machine learning (learning juntas) and proved hardness of lattice problems. While in derandomization, we present a deterministic algorithm for a fundamental problem called "identity testing". In this thesis we also initiate a complexity theoretic study of Hilbert's 17th problem. Here identity testing is used in an interesting manner. A common theme in this work has been the use of tools from areas such as number theory in a variety of ways, and often the techniques themselves are quite interesting.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
3

Grenet, Bruno. „Représentations des polynômes, algorithmes et bornes inférieures“. Phd thesis, Ecole normale supérieure de lyon - ENS LYON, 2012. http://tel.archives-ouvertes.fr/tel-00770148.

Der volle Inhalt der Quelle
Annotation:
La complexité algorithmique est l'étude des ressources nécessaires -- le temps, la mémoire, ... -- pour résoudre un problème de manière algorithmique. Dans ce cadre, la théorie de la complexité algébrique est l'étude de la complexité algorithmique de problèmes de nature algébrique, concernant des polynômes.Dans cette thèse, nous étudions différents aspects de la complexité algébrique. D'une part, nous nous intéressons à l'expressivité des déterminants de matrices comme représentations des polynômes dans le modèle de complexité de Valiant. Nous montrons que les matrices symétriques ont la même expressivité que les matrices quelconques dès que la caractéristique du corps est différente de deux, mais que ce n'est plus le cas en caractéristique deux. Nous construisons également la représentation la plus compacte connue du permanent par un déterminant. D'autre part, nous étudions la complexité algorithmique de problèmes algébriques. Nous montrons que la détection de racines dans un système de n polynômes homogènes à n variables est NP-difficile. En lien avec la question " VP = VNP ? ", version algébrique de " P = NP ? ", nous obtenons une borne inférieure pour le calcul du permanent d'une matrice par un circuit arithmétique, et nous exhibons des liens unissant ce problème et celui du test d'identité polynomiale. Enfin nous fournissons des algorithmes efficaces pour la factorisation des polynômes lacunaires à deux variables.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
4

Boucher, Thomas Francis. „On cyclotomic primality tests“. 2011. http://trace.tennessee.edu/utk_gradthes/949.

Der volle Inhalt der Quelle
Annotation:
In 1980, L. Adleman, C. Pomerance, and R. Rumely invented the first cyclotomicprimality test, and shortly after, in 1981, a simplified and more efficient versionwas presented by H.W. Lenstra for the Bourbaki Seminar. Later, in 2008, ReneSchoof presented an updated version of Lenstra's primality test. This thesis presents adetailed description of the cyclotomic primality test as described by Schoof, along withsuggestions for implementation. The cornerstone of the test is a prime congruencerelation similar to Fermat's little theorem" that involves Gauss or Jacobi sumscalculated over cyclotomic fields. The algorithm runs in very nearly polynomial time.This primality test is currently one of the most computationally efficient tests and isused by default for primality proving by the open source mathematics systems Sageand PARI/GP. It can quickly test numbers with thousands of decimal digits.
APA, Harvard, Vancouver, ISO und andere Zitierweisen

Bücher zum Thema "Identity Testing in Number Fields"

1

Paliy, Irina. Probability theory and mathematical statistics. ru: INFRA-M Academic Publishing LLC., 2021. http://dx.doi.org/10.12737/1065828.

Der volle Inhalt der Quelle
Annotation:
The tutorial is an introductory course in probability theory and mathematical statistics. Elements of combinatorics, basic concepts and theorems of probability theory, discrete random variables, continuous random variables, some limit theorems, one-dimensional and two-dimensional samples, point and interval estimation of parameters of the general population, testing of statistical hypotheses, elements of queuing theory are considered. The presentation of the theoretical material is accompanied by a large number of detailed examples of problem solving. For students of technical and economic fields of study and specialties, studying under the bachelor's and specialty programs.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
2

Cernat, Alexandru, und Joseph W. Sakshaug, Hrsg. Measurement Error in Longitudinal Data. Oxford University Press, 2021. http://dx.doi.org/10.1093/oso/9780198859987.001.0001.

Der volle Inhalt der Quelle
Annotation:
Understanding change is essential in most scientific fields. This is highlighted by the importance of issues such as shifts in public health and changes in public opinion regarding politicians and policies. Nevertheless, our measurements of the world around us are often imperfect. For example, measurements of attitudes might be biased by social desirability, while estimates of health may be marred by low sensitivity and specificity. In this book we tackle the important issue of how to understand and estimate change in the context of data that are imperfect and exhibit measurement error. The book brings together the latest advances in the area of estimating change in the presence of measurement error from a number of different fields, such as survey methodology, sociology, psychology, statistics, and health. Furthermore, it covers the entire process, from the best ways of collecting longitudinal data, to statistical models to estimate change under uncertainty, to examples of researchers applying these methods in the real world. The book introduces the reader to essential issues of longitudinal data collection such as memory effects, panel conditioning (or mere measurement effects), the use of administrative data, and the collection of multi-mode longitudinal data. It also introduces the reader to some of the most important models used in this area, including quasi-simplex models, latent growth models, latent Markov chains, and equivalence/DIF testing. Further, it discusses the use of vignettes in the context of longitudinal data and estimation methods for multilevel models of change in the presence of measurement error.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
3

Desai, Ashwin, und Goolam Vahed. A History of the Present. Oxford University Press, 2019. http://dx.doi.org/10.1093/oso/9780199498017.001.0001.

Der volle Inhalt der Quelle
Annotation:
While small in number, the place of the Indian in South Africa has historically loomed large because of their strong commercial and professional middle class, international influence through India, the commitment of many Indians to the anti-apartheid struggle and the prominent role that they have played in political and economic life post-apartheid. A History of the Present is the first book-length overview of Indian South Africans in the quarter century following the end of apartheid. Based on oral interviews and archival research it threads a narrative of the lives of Indian South Africans that ranges from the working class men and women to the heady heights of the newly minted billionaires; the changes wrought in the fields of religion and gender; opportunities offered on the sporting fields; the search for roots both locally and in India that also witnesses the rise of transnational organizations. Indians in South Africa appear to be always caught in an infernal contradiction; too traditional, too insular, never fitting in, while also too modern, too mobile. While focusing on Indian South Africans, this study makes critical interventions into several charged political discussions in post-apartheid South Africa, especially the debate over race and identity, while also engaging in discussions of wider intellectual interest, including diaspora, nation, and citizenship.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
4

Dubber, Markus D., Frank Pasquale und Sunit Das, Hrsg. The Oxford Handbook of Ethics of AI. Oxford University Press, 2020. http://dx.doi.org/10.1093/oxfordhb/9780190067397.001.0001.

Der volle Inhalt der Quelle
Annotation:
This book explores the intertwining domains of artificial intelligence (AI) and ethics—two highly divergent fields which at first seem to have nothing to do with one another. AI is a collection of computational methods for studying human knowledge, learning, and behavior, including by building agents able to know, learn, and behave. Ethics is a body of human knowledge—far from completely understood—that helps agents (humans today, but perhaps eventually robots and other AIs) decide how they and others should behave. Despite these differences, however, the rapid development in AI technology today has led to a growing number of ethical issues in a multitude of fields, ranging from disciplines as far-reaching as international human rights law to issues as intimate as personal identity and sexuality. In fact, the number and variety of topics in this volume illustrate the width, diversity of content, and at times exasperating vagueness of the boundaries of “AI Ethics” as a domain of inquiry. Within this discourse, the book points to the capacity of sociotechnical systems that utilize data-driven algorithms to classify, to make decisions, and to control complex systems. Given the wide-reaching and often intimate impact these AI systems have on daily human lives, this volume attempts to address the increasingly complicated relations between humanity and artificial intelligence. It considers not only how humanity must conduct themselves toward AI but also how AI must behave toward humanity.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
5

Baron, Alan, John Hassard, Fiona Cheetham und Sudi Sharifi. Conclusions. Oxford University Press, 2017. http://dx.doi.org/10.1093/oso/9780198813958.003.0011.

Der volle Inhalt der Quelle
Annotation:
The final chapter brings together a series of conclusions based on the preceding study of workplace attitudes, behaviour, and experiences within an English hospice. Initially it examines the nature of relationships between the three concepts that form the analytical core of this study—culture, identity, and image. This includes a wide-ranging critical review of these concepts in relation to the relevant fields of literature in management and organization theory. Subsequently a number of limitations are considered with regard to the use of Schein’s well-known three-level model of culture as a framework for guiding empirical research. The chapter ends by discussing some metaphorical issues relevant to the study and specifically makes proposals for perceiving organization culture as something that is philosophically fluid, uncertain, and in flux.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
6

Jonker, Louis C., Angelika Berlejung und Izak Cornelius, Hrsg. Multilingualism in Ancient Contexts: Perspectives from Ancient Near Eastern and Early Christian Contexts. African Sun Media, 2021. http://dx.doi.org/10.52779/9781991201171.

Der volle Inhalt der Quelle
Annotation:
Multilingualism remains a thorny issue in many contexts, be it cultural, political, or educational. Debates and discourses on this issue in contexts of diversity (particularly in multicultural societies, but also in immigration situations) are often conducted with present-day communicational and educational needs in mind, or with political and identity agendas. This is nothing new. There are a vast number of witnesses from the ancient West-Asian and Mediterranean world attesting to the same debates in long past societies. Could an investigation into the linguistic landscapes of ancient societies shed any light on our present-day debates and discourses? This volume suggests that this is indeed the case. In fourteen chapters, written and visual sources of the ancient world are investigated and explored by scholars, specialising in those fields of study, to engage in an interdisciplinary discourse with modern-day debates about multilingualism. A final chapter – by an expert in language in education – responds critically to the contributions in the book to open avenues for further interdisciplinary engagement – together with contemporary linguists and educationists – on the matter of multilingualism.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
7

Avis, Paul, Hrsg. The Oxford Handbook of Ecclesiology. Oxford University Press, 2018. http://dx.doi.org/10.1093/oxfordhb/9780199645831.001.0001.

Der volle Inhalt der Quelle
Annotation:
This Handbook is a comprehensive resource for the scholarly study of the self-understanding of the church through the centuries—its theological identity. Nearly thirty expert contributions describe the continuities and discontinuities in the changing understanding of the church. The scope of ecclesiology is defined by the manifold self-understanding and action of the church in relation to a number of research fields, including its historical origins, structures of authority, doctrine, ministry and sacraments, unity and diversity, and mission, as well as its relation to the state, to civil society, and to culture. The book covers the main sources of such ecclesiological research and reflection, namely the Bible, church history from the apostolic age to the present, the wealth of the Christian theological traditions, the experience and practice of the churches today, together with the information and insights that emerge from other relevant academic disciplines. Ecclesiology has also been the main focus of the intense ecumenical engagement, study, and dialogue of the past century and is the area where the most intractable differences remain to be resolved. In particular, generous space is allocated to the New Testament sources of ecclesiology and to some of the most influential shapers of modern ecclesiology.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
8

Rosewarne, Lauren. Cyberbullies, Cyberactivists, Cyberpredators. ABC-CLIO, LLC, 2016. http://dx.doi.org/10.5040/9798400636516.

Der volle Inhalt der Quelle
Annotation:
Written by an expert in media, popular culture, gender, and sexuality, this book surveys the common archetypes of Internet users—from geeks, nerds, and gamers to hackers, scammers, and predators—and assesses what these stereotypes reveal about our culture's attitudes regarding gender, technology, intimacy, and identity. The Internet has enabled an exponentially larger number of people—individuals who are members of numerous and vastly different subgroups—to be exposed to one other. As a result, instead of the simple "jocks versus geeks" paradigm of previous eras, our society now has more detailed stereotypes of the undesirable, the under-the-radar, and the ostracized: cyberpervs, neckbeards, goths, tech nerds, and anyone with a non-heterosexual identity. Each chapter of this book explores a different stereotype of the Internet user, with key themes—such as gender, technophobia, and sexuality—explored with regard to that specific characterization of online users. Author Lauren Rosewarne, PhD, supplies a highly interdisciplinary perspective that draws on research and theories from a range of fields—psychology, sociology, and communications studies as well as feminist theory, film theory, political science, and philosophy—to analyze what these stereotypes mean in the context of broader social and cultural issues. From cyberbullies to chronically masturbating porn addicts to desperate online-daters, readers will see the paradox in popular culture's message: that while Internet use is universal, actual Internet users are somehow subpar—less desirable, less cool, less friendly—than everybody else.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
9

Gregory, Jeremy, Hrsg. The Oxford History of Anglicanism, Volume II. Oxford University Press, 2017. http://dx.doi.org/10.1093/oso/9780199644636.001.0001.

Der volle Inhalt der Quelle
Annotation:
The Oxford History of Anglicanism is a major new and unprecedented international study of the identity and historical influence of one of the world’s largest versions of Christianity. This global study of Anglicanism from the sixteenth century looks at how Anglican identity was constructed and contested at various periods since the sixteenth century; and its historical influence during the past six centuries. It explores not just the ecclesiastical and theological aspects of global Anglicanism, but also the political, social, economic, and cultural influences of this form of Christianity that has been historically significant in Western culture, and a burgeoning force in non-Western societies today. The chapters are written by international experts in their various historical fields which includes the most recent research in their areas, as well as original research. The series forms an invaluable reference for both scholars and interested non-specialists. Volume II of The Oxford History of Anglicanism explores the period between 1662 and 1829 when its defining feature was arguably its establishment status, which gave the Church of England a political and social position greater than before or since. The contributors explore the consequences for the Anglican Church of its establishment position and the effects of being the established Church of an emerging global power. The volume examines the ways in which the Anglican Church engaged with Evangelicalism and the Enlightenment; outlines the constitutional situation and main challenges and opportunities facing the Church; considers the Anglican Church in the regions and parts of the growing British Empire; and includes a number of thematic chapters assessing continuity and change.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
10

Stankovic, Dusan. Youth, Guns and Safety: Analysis of the Response to the Multiple Murders of 3 and 4 May. Belgrade Centre for Security Policy, 2023. http://dx.doi.org/10.55042/dtsn3219.

Der volle Inhalt der Quelle
Annotation:
After the multiple murders that took place on 3 and 4 May 2023, the Government of Serbia adopted a series of measures to improve gun control and increase safety in schools and among youth. The aim of this study is to evaluate the implementation and effectiveness of these measures. The research was based on different sources of data: the state authorities’ official reports, expert literature, media reports, interviews conducted with police officers, the Armed Violence Monitoring Platform (AVMP) database, and a survey of the citizens’ satisfaction with measures, their perception of security and trust in institutions. Most of the measures that have been adopted are related to firearms, while a smaller part refers to the safety of young people and education. Also, measures related to firearms have been implemented more than others, and some are still in effect (gun control, moratorium on the issuance of gun permits). The public call for handing over arms produced results in terms of a large number of collected weapons (significantly larger than before), but there is a question of why previous such actions were not accompanied by appropriate media campaigns, which would have produced similar results. Another question is why there are no current campaigns that would educate citizens about the dangers of firearms, their misuse and the way they are to be kept and handled, as these things are very important for the prevention of armed violence. Also, the collection of firearms showed problems regarding their transport, accommodation and disposal after handing over. Measures for the safety of young people were mostly of declarative (tougher penal policy) and formal nature (establishment of councils and working groups). The only measure that was immediately implemented and visible to citizens was the placement of police officers in schools. It is possible that some students, school staff or parents did feel safer because of this, but there is no evidence that the presence of police managed to reduce violence. This measure, as well as the measures related to gun control, significantly increased the scope of work of the general jurisdiction police, creating a situation in which other forms of crime may flourish. Most of the measures were not implemented even though more than six months have passed since their adoption. Some of them, like tougher penalties for firearms-related offences or lowering the threshold for criminal liability, require legislative changes. In addition, the research and experience of other countries do not support the idea that tougher penal policies would decrease criminality. The conclusions show that the measures were motivated by political interests to satisfy the public and that they were not adopted by professionals from the fields of public security, justice or education, which is why some have turned out to be impossible to implement (restricting access to the Dark Net, reducing the threshold for criminal responsibility, gun control in the short term) or are unsustainable for the system (police presence in schools, testing students for the presence of psychoactive substances). Analysis of data from the regional Armed Violence Monitoring Platform, which records media-covered incidents involving firearms, indicates that the number of such incidents did not change much after 3 and 4 May. Also, other data sources show that levels of violence and incidents involving firearms are not decreasing and that implemented measures have not changed anything in this sense. The results of the public opinion survey show that the number of citizens who are not satisfied with the measures is slightly higher than the number of those who are. Satisfaction with safety measures in schools (47% of the respondents) is a bit higher than satisfaction with measures related to gun control (54% of the respondents). Six months after the adoption of these measures, the satisfaction of citizens is visibly decreasing - 44% of them are satisfied with the measures, while 56% are not. Comparing the results of public opinion polls in 2023 with those from 2022, it is evident that citizens’ trust in institutions has dropped significantly: 63% trust the police (76% in 2022), 49% trust the courts (57%), and 50% trust the prosecutor’s office (56%). Also, the perception of citizens’ safety considering the environment has decreased at all levels: in their homes, neighbourhoods and in Serbia in general. Finally, the survey also showed that more citizens now feel threatened by phenomena such as murder (56%) and illegal possession of firearms (61%) than was the case in 2022 (murder 49%, illegal possession of firearms 54%). It should be noted here that we are talking about two different public opinion surveys here, and their comparison should be viewed with some reservation. Although both were conducted using a national, representative sample, the 2023 survey was conducted online and was not conducted on a random sample, while the 2022 survey was conducted face-to-face on a random sample.
APA, Harvard, Vancouver, ISO und andere Zitierweisen

Buchteile zum Thema "Identity Testing in Number Fields"

1

Colleran, Heidi. „22. A Theory of Culture for Evolutionary Demography“. In Human Evolutionary Demography, 517–50. Cambridge, UK: Open Book Publishers, 2024. http://dx.doi.org/10.11647/obp.0251.22.

Der volle Inhalt der Quelle
Annotation:
Evolutionary demography is a community of researchers in a range of different disciplines who agree that “nothing in evolution makes sense except in the light of demography” (Carey and Vaupel 2005). My focus here is a subset of this research (henceforth ‘evolutionary demography’ or ‘evolutionary anthropology’) that originated in anthropology in the late 1970s and which typically examines micro-level phenomena concerning reproductive decision-making and the evolutionary processes generating observed patterns in reproductive variation. Scholars in this area tend to be more involved in long-term anthropological fieldwork than any other area of the evolutionary sciences. But card-carrying anthropologists are declining among their number as researchers increasingly come from other backgrounds in the biological and social sciences, with an associated decline in the contribution of ethnographic work. Most practitioners identify with the sub-field of human behavioral ecology – the application of sociobiological principles to human behavior – and distinguish themselves from the sister fields of evolutionary psychology and cultural evolution. Human behavioral ecology has been criticized for abstracting away the details of both culture and psychology in its focus on adaptive explanations of reproductive behavior, and for its commitment to ultimate over proximate causation. This chapter explores these critiques. Inspired by EA Hammel’s seminal paper “A theory of culture for demography” (Hammel 1990), I examine how the culture concept is used in evolutionary research. Like Hammel, I argue that a theory of culture for evolutionary demography requires engaging more seriously with (and in) ethnographic work. I highlight some challenging examples to motivate discussion about adaptive reproduction and natural fertility. Going further, I advocate for cultural evolution as an integrative framework for bringing both culture and psychology into the core of evolutionary demography research. This will involve expanding our theoretical and conceptual toolkits: (1) building and testing proximate mechanistic models, (2) delineating and evaluating causal claims at multiple levels of analysis and time scales, and (3) exploring co-evolution or feedback between demography and culture.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
2

Asante, Michael Oduro, Sudeepika Wajirakumari Samarathunga Liyanapathiranage und Rómulo Pinheiro. „Public Service Resilience in a Post-COVID-19 World: Digital Transformation in Nordic Higher Education“. In The Impact of Covid-19 on the Institutional Fabric of Higher Education, 245–67. Cham: Springer International Publishing, 2023. http://dx.doi.org/10.1007/978-3-031-26393-4_10.

Der volle Inhalt der Quelle
Annotation:
AbstractThis chapter draws on seminal contributions from the crisis management and resilience literature to develop and test a new framework for organisational resilience in higher education in the context of digital transformation. The study unpacks developments before and during the COVID-19 crisis and sheds light on crucial endogenous and exogenous factors likely to determine resilience outcomes. It does so by developing and testing a novel analytical framework centred on resilient antecedents, processes and outcomes. The empirical findings suggest that, in the Nordic countries, higher education institutions denote a high ability to adapt to new situations whilst retaining both function and identity, that is, they are resilient. We identify and unpack a number of key resilient drivers and reflect on the implications for research and practice going forward.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
3

Honor, Richard, und Robert I. Colautti. „EICA 2.0: a general model of enemy release and defence in plant and animal invasions.“ In Plant invasions: the role of biotic interactions, 192–207. Wallingford: CABI, 2020. http://dx.doi.org/10.1079/9781789242171.0192.

Der volle Inhalt der Quelle
Annotation:
Abstract Plants and animals have evolved a variety of strategies to limit the negative fitness consequences of natural enemies (i.e. herbivores, predators, parasites and pathogens). Demographic bottlenecks occurring during the invasion process reduce the number of co-introduced natural enemies, providing opportunities to study rapid evolution in environments with different or reduced enemy loads. Enemy release theory provides a set of hypotheses and predictions about the role of natural enemies in the proliferation of invasive species. This body of theory includes the Enemy Release Hypothesis (ERH) and the related Evolution of Increased Competitive Ability Hypothesis (EICA), but there is often confusion about these hypotheses and the data needed to test them. We introduce a simple, general model of enemy release to identify and clarify some of the key assumptions and predictions implicit in enemy release theory and its impacts on invasion. Although introduced populations likely benefit from a reduction in the direct fitness impacts of natural enemies in the early stages of invasion, an evolutionary shift in resource allocation from defence to growth and reproduction is much less likely and depends on a delicate balance between the fitness costs and benefits of defence and the fitness impacts of natural enemies in both the native and introduced ranges. Even when the abundance of natural enemies is lower in the introduced range, the majority of scenarios do not favour evolution of less defended genotypes that are more competitive or more fecund, contrary to predictions of EICA. Perhaps surprisingly, we find that the level of damage by natural enemies in field surveys is not generally a good parameter for testing enemy release theory. Instead, common garden experiments characterizing fitness reaction norms of multiple genotypes from the native and introduced range are crucial to estimate the historic rate of adaptive evolution or predict it into the future. Incorporating spatial autocorrelation and methods from population genetics can further improve our understanding of the role of enemy release and evolution in the proliferation of invasive species.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
4

Kumar, Sanjay, K. V. Sripathy, K. Udaya Bhaskar und Banoth Vinesh. „Principles of Quality Seed Production“. In Seed Science and Technology, 109–31. Singapore: Springer Nature Singapore, 2023. http://dx.doi.org/10.1007/978-981-19-5888-5_6.

Der volle Inhalt der Quelle
Annotation:
AbstractPlant breeding and seed technology are the two arms of crop improvement programmes. The ultimate goal of any plant breeding programme is to make available quality seeds of new improved varieties in adequate quantity to farmers. Modern plant breeding techniques have enabled the development of crop varieties with desired traits at a much higher pace than ever before, addressing the challenges of food and nutritional security. A large number of new crop varieties are being bred continuously to address specific needs viz. productivity, quality, tolerance against abiotic and biotic stresses, cropping intensity, etc. However, to the farmers, all these scientific achievements would be of little use unless they have access to seeds of these varieties, which are genetically pure, physiologically sound (germination, vigour), free from physical impurities and seed-borne diseases. The pace of progress in food production largely depends upon the speed with which a country is able to multiply quality seeds of high-yielding varieties. Hence, the quality seed supply chain must be supported by desired policy and technically sound systems both in national and international domains. In order to achieve this, every country needs a well-established infrastructure for seed production, quality assurance, storage and marketing. Similarly, the regulatory framework for the variety testing, release and notification, and regulation of the seed market are also important to preserve the interests of the farming community. Successful seed production requires establishing variety identity, adherence to maintaining variety purity, and the application of good farming practices along with careful management of crops, following widely accepted production technologies, and quality standards.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
5

Tezcan, Arda, und Debbie Richards. „A Comparative Study of Platforms for Multi-User Virtual Environments“. In Multi-Agent Systems for Education and Interactive Entertainment, 137–70. IGI Global, 2011. http://dx.doi.org/10.4018/978-1-60960-080-8.ch008.

Der volle Inhalt der Quelle
Annotation:
Multi-User Virtual Environments (MUVEs) have been found to be engaging and provide an environment in which the elements of discovery, exploration and concept testing, fundamental to the field of science, can be experienced. Furthermore, MUVEs accommodate lifelike experiences with the benefit of the situated and distributed nature of cognition; they also provide virtual worlds to simulate the conditions that are not doable or practicable under real world circumstances making them very relevant to many other fields of study such as history, geography and foreign language learning. However, constructing MUVEs can be expensive and time consuming depending on the platform considered. Therefore, providing the most appropriate platform that requires minimal effort, cost and time will make MUVE deployment in the classroom faster and more viable. In this chapter, the authors provide a comparative study of prominent existing platforms for MUVEs that can be used to identify the right balance of functionality, flexibility, effort and cost for a given educational and technical context. A number of metrics are identified, described and used to enable the comparison. Platform assessment was done in four main metric groups: communication and interaction, characters, features and education. Communication and interaction metrics are used to assess how the communication and interaction is done within the examined platform. Character metrics are employed to measure avatar and agent affordances. Features metrics are defined to compare what the platform offers in terms of technology. Lastly, education metrics are used to identify the value of the associated platform for educational purposes.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
6

Hirschfeld, J. W. P. „Finite Fields“. In Projective Geometries over Finite Fields, 3–30. Oxford University PressOxford, 1998. http://dx.doi.org/10.1093/oso/9780198502951.003.0001.

Der volle Inhalt der Quelle
Annotation:
Abstract 1.1 Definitions and existence (i) A field is a set K closed under two operations+, × such that (a) (K, +) is an abelian group with identity O; (b) (Ko, ×) is an abelian group with identity 1, where Ko= K\{O); (c) x(y + z) = xy + xz, (x + y)z = xz + yz, for all .r,y, z in K. (ii) A finite field is a field with only a finite number of elements. (iii) The characteristic of a finite field K is the smallest positive integer (and hence a prime) p such that px = 0 for all x in K.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
7

Tariq, Muhammad, Naveed Altaf Malik, Ilyas Ahmad, Syeda Seema Waseem und Shahid Mahmood Baig. „Genetic Testing for Rare Genetic Disorders“. In Omics Technologies for Clinical Diagnosis and Gene Therapy: Medical Applications in Human Genetics, 14–28. BENTHAM SCIENCE PUBLISHERS, 2022. http://dx.doi.org/10.2174/9789815079517122010005.

Der volle Inhalt der Quelle
Annotation:
Rare genetic disorders affect a significant proportion of the global population. A large number of these patients are either misdiagnosed or remain undiagnosed which can have potentially adverse effects, including failure to provide anticipatory prognosis and identify potential treatment. With the completion of HGP, genetic testing has fast grown into a diagnostic discipline introducing new and cost.effective diagnostic tests with reasonable accuracy and specificity. NGS technologies, in particular, changed the field of genetic diagnosis by sequencing the entire genome or subset thereof in a single test and accomplishing diagnosis of virtually all diseases, either congenital or late-onset. These technologies have opened up new opportunities and unique challenges. This chapter discusses the importance of genetic testing, its scope, various technologies and approaches and, finally, the opportunities and challenges accompanying the new age genetic tests.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
8

Ellis, Graham. „Construction of projective planes“. In Rings and Fields, 25–48. Oxford University PressOxford, 1992. http://dx.doi.org/10.1093/oso/9780198534556.003.0003.

Der volle Inhalt der Quelle
Annotation:
Abstract In this chapter we turn our attention to rings with only a finite number of elements, and in particular to finite fields. (Recall that a field is a commutative ring with identity 1≠0 in which each non-zero element has a multiplicative inverse.) Finite fields play an important role in many branches of mathematics. We begin by showing how the existence of certain finite fields leads, via projective geometry, to the solution of a particular problem in combinatorial mathematics. We then go on to investigate the existence of finite fields. Several of the concepts that we introduce in connection with finite fields will be of use when we later turn our attention to infinite fields. For this reason we give definitions in more generality than at first glance seems necessary.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
9

Furlong, Yulia. „Autism and Gender Identity“. In Autism Spectrum Disorder - Profile, Heterogeneity, Neurobiology and Intervention [Working Title]. IntechOpen, 2021. http://dx.doi.org/10.5772/intechopen.97517.

Der volle Inhalt der Quelle
Annotation:
Since the turn of the century, we are witnessing a dramatic surge in the numbers of children and adolescents referred to gender clinics, this is happening in the context of general increase in numbers of individuals identifying as non-binary. The chapter ahead will initially address the shifting landscape of gender dysphoria (GD), and provides a comprehensive overview of the latest findings in the fields of autism and GF. The higher rates of autism’ diagnosis among gender diverse samples prompted the development of several hypotheses that attempt to explain the link between autism spectrum and gender spectrum, as well as development of relevant clinical guidelines that contain strong advocacy for adolescents with neurodiversity not to be precluded from gaining access to gender-related services. In the public arena, a highly publicised UK High Court’s case that is commonly referred to as Bell v Tavistock highlighted the growing concerns regarding the unexplained surge in the number of adolescents identifying as having GF, as well as pointed to the lack of evidence that hormones and surgery improve long-term outcomes. The chapter explored the recommendations that came out of this ruling and highlighted the implications for Australian jurisdiction by illustrating medico-legal changes on Perth-based gender services.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
10

Goldstein, Inge F., und Martin Goldstein. „Breast Cancer, Part 2: Testing The Pesticide Hypothesis“. In How Much Risk? Oxford University Press, 2002. http://dx.doi.org/10.1093/oso/9780195139945.003.0011.

Der volle Inhalt der Quelle
Annotation:
We do not yet know how much of the excess rates of breast cancer on Long Island or on Cape Cod will ultimately be explained by the known risk factors. We do know that pesticides have been sprayed in both these areas, and toxic chemicals carelessly disposed in them. Has breast cancer been increased by such exposures? The studies in progress on Long Island and Cape Cod are not the only ones that have tried to answer this question: a number of completed studies, carried out in other locations, have also done so, and we will describe them in this chapter. These studies rely to a considerable extent on recent discoveries in molecular biology. This rapidly advancing field has already contributed enormously to our understanding of cancer as well as other diseases, and it will contribute even more in the future. We have learned from it how to identify certain individuals who have genetic sensitivities to particular environmental agents. It may in some cases provide means to determine which environmental hazards have caused a particular case of cancer, from the genetic makeup of the cancer cells. With knowledge of that genetic makeup, physicians who treat cancer are helped to choose the most effective therapy in any given case of the disease, without having to go through a process of trial and error. Future research into the causes, prevention, and treatment of cancer and other diseases, whether in the clinic, the research laboratory, or in the epidemiological field study, will rely more and more on the perspectives and techniques of molecular biology. We will review briefly some of the basic concepts of this field before we describe the studies, completed or in progress, of environmental agents and breast cancer. In general, even when dramatic increases in the rate of some disease have been clearly linked to an environmental agent, only a fraction of the people exposed ever suffer the disease. Most people who survived the bombing of Hiroshima and Nagasaki have not suffered health effects from their radiation exposure. Cigarette smoking causes 90% of lung cancer today, but only 10% of heavy smokers will die of lung cancer.
APA, Harvard, Vancouver, ISO und andere Zitierweisen

Konferenzberichte zum Thema "Identity Testing in Number Fields"

1

Barber, Hali, Isaac Tabachnich, Alanna Wall, Sukriti Kumar und Richard McKercher. „Wind Tunnel Testing of RPAS in Representative Urban Flow Fields“. In Vertical Flight Society 80th Annual Forum & Technology Display, 1–22. The Vertical Flight Society, 2024. http://dx.doi.org/10.4050/f-0080-2024-1137.

Der volle Inhalt der Quelle
Annotation:
This paper describes wind tunnel testing of small remotely piloted aircraft systems (RPAS) to understand better the maximum wind speeds in which they can be safely operated. Urban flow fields can contain complex flow structures such as speed changes, direction changes, shear layers, turbulence and vorticity; all of these can impact the safety of urban RPAS operations. The work described in this paper is part of an ongoing effort to provide Canadian regulators with knowledge to guide safe RPAS operations in urban environments. In the wind tunnel, flow fields representative of urban flows were created using simple flow manipulators like bluff bodies and vanes. The flow manipulators and the resulting flow fields, in relation to representative urban flows, are described in this paper. Wind tunnel testing of a number of RPAS in these representative airflows was conducted to evaluate the sustained wind speed limit at which the vehicle could maintain a stable hover. These tests enabled a step in the understanding of the wind speed limit for various RPAS in different flows. The paper shows a clear impact of turbulence level on the maximum safe operating wind speed of RPAS.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
2

Loureiro, W. C., V. Gasparetto, F. P. dos Santos, G. C. Campello, A. H. da Silva, D. M. Rocha, S. C. Teixeira, E. G. Chaves und R. F. de Souza. „Reuse of Flexible Pipes in Revitalization of Brown Fields“. In Offshore Technology Conference. OTC, 2024. http://dx.doi.org/10.4043/35180-ms.

Der volle Inhalt der Quelle
Annotation:
Abstract Flexible pipes tend to be complex structures, tailor-made, and require a significant amount of engineering in preparation for manufacturing and delivery. These features increase the cost and the time required between procurement and delivery, extending the project schedule significantly. On the other hand, several wells may have their operational life shortened due to reservoir management strategies. To make ends meet, Petrobras has established procedures to evaluate the integrity and the possible reuse of flexible pipes, which are removed from the field with remaining service life, in new wells. This paper outlines how Petrobras, drawing on the knowledge gained through years of operating flexible pipes, along with extensive qualification programs and inspections, developed and certified methodologies and digital tools to enable, enhance and streamline the evaluation the reuse of flexible pipes in new applications. The reuse of flexibles became possible through development of an extensive material database, in-house web-based digital tools to verify permeation, polymer aging, and execute local and fatigue analysis. These tools were calibrated through years of data, as full-scale fatigue testing (tension and tension and bending), information from operational monitoring and historical field failures. The integration of these digital tools and databases allows engineers to quickly identify the best candidates for reuse in new projects. They gather all relevant compatibility analysis with new application, operational history, and integrity management information for each selected pipe, avoiding the need to go through extensive searching of each individual inspection report, production records, and input data in the analysis tools. In the last five years, over 420 km of pipes have been reused. This number tends to increase even more as more precise operational data becomes available and more integrated tools and databases are employed. The reuse of flexible pipes saves resources, time, capital expenditures (CAPEX), anticipate projects, and mitigate CO2 emissions by avoiding manufacturing new pipes.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
3

Ревин, К. С. „SUPERVISION AS A METACOGNITIVE PROCESS. Significance of metacognition in the formation of a Supervisor's Professional Identity“. In Антология российской психотерапии и психологии. Crossref, 2023. http://dx.doi.org/10.54775/ppl.2023.48.18.001.

Der volle Inhalt der Quelle
Annotation:
В настоящее время знания, полученные когнитивной наукой, приоткрыли содержание человеческого сознания и понимания метапознавательных процессов. Метапознание, как показано, занимает центральную роль в как в предмете психотерапетической работы, так и в эффективности деятельности и обучения. Однако, зачастую эти достижения не используются в практической работе, а в целом ситуация напоминает попытку двух людей, находящихся по разные стороны от забора сделать подкоп, но копают они в разных местах. Целью данного доклада выступает увязать между собой некоторые достижения когнитивной науки с практическими областями психотерапевтической работы и понять, чем в настоящее время эти достижения могут быть полезны в практике. В этом контексте важным видится обсуждение характера и значимости метакогниций со стороны клиента и терапевта, супервизанта и супервизора. В истории взаимоотношений психологии и психотерапии можно заметить ряд закономерностей. В конце 1950-х годов психоаналитики активно занимались изучением закономерностей формирования психической деятельности, и практическим путем была сформулирована концепция У.Биона о формировании психики и значение в этом процессе проективной идентификации. Одна из основных идея этой концепции заключалась в следующем – нормальное развитие психической деятельности происходит путем тестирования аффектом реальности и последующая индукция изменений. Позднее в ленинградской школе психологии в 1980-х –1990-х годах Б.Ф. Ломов, Л.М. Веккер, Б.Г. Ананьев и другие при экспериментальном изучении образа восприятия приходят к похожим выводам – формирование дифференцированосинтезированного образа восприятия происходит через активное взаимодействие с элементами реальности. Тем самым сформировалась доказательная база для теории, существующей в практической психотерапии. В наше время происходит похожая ситуация – в когнитивной психологии активно разрабатываются исследования сознания и метапознания, что может выступить доказательной базой для существующих в психотерапии современных концепций. Однако, в силу того, что традиционно психотерапия разрабатывалась преимущественно врачами и в рамках медицинских дисциплин, в психотерапию перекочевали те же проблемы с доказательностью, что и в медицине. В итоге мы видим неутешительный вывод, наблюдаемый в метанализах современных исследований эффективности психотерапии – за 129 концепции появившиеся за последние 30 лет не показали большей эффективности, чем ранее существующие. Вкупе с этим, нельзя забывать в целом о проблеме доказанной эффективности психотерапии. Таким образом, видится особая значимость в учете результатов когнитивной психологии в психотерапевтической работе и разработка психотерапевтических концепций на базе доказательной психологии. Рассматривая значение метакогнитивного познания в процессе психотерапии и супервизии, можно обратить внимание на такие понятия как, стратегии поведения в когнитивно-поведенческой терапии, внутриличностиная структура в психодинамических концепциях и индивидуальный опыт в феноменологических концепциях. Каждое из этих понятий, по сути, используется для описания ментальной репрезентации, которые сейчас активно изучаются в рамках исследований метапознавательных процессов. В ряде теоретических моделей, например модель Е.Ерткина, особую значимость имеют взаимодействие метакогнитивного знания (ментальной репрезентации), метакогнитивных навыков (способов переработки информации и знаний о себе) и метакогнитивных переживаний (реакции на предыдущие процессы переработки). Особо ярко взаимодействие этих 3-ех компонентов мы видим в рамках супервизионного процесса, когда супервизант приносит метакогнитивные переживания о клиенте, уже интегрированные в знания о клиенте, о себе или находящиеся в этом процессе. Там, на супервизии, группа или супервизор помогают специалисту пройти цикл между этими тремя компонентами, для углубления понимания клиента, возникновения метакогнитивных переживаний нового уровня и разряжения этих переживай. Таким образом, понимание разнообразия организации всех трех компонентов у разных людей и в целом необходимо для эффективного супервизора. В противном случае риск превращения супервизии из способа преодоления трудности во времяпрепровождение оказывается очень высоким. Эти выводы можно также применить и к психотерапевтической работе. В свете описанного, хочется привлечь внимание коллег к взаимоотношениям исследований в психологии и психотерапевтическими концепциями. Автору видится, что взаимосвязь этих областей может помочь преодолеть застой, который наблюдается в психотерапии последние 10-15 лет, и дать почву для решения проблем эффективности и доказательности в психотерапии. The knowledge gained by cognitive science has now opened up the content of human consciousness and understanding of metacognitive processes. Metacognition has been shown to occupy a central role in both the subject matter of psychotherapy and in the effectiveness of activity and learning. However, these advances are often not used in practical work, and the overall situation resembles an attempt of two people on opposite sides of a fence trying to dig, but they are digging in different places. The purpose of this paper is to connect some achievements of cognitive science to practical areas of psychotherapy work and to understand how these achievements can currently be useful in practice. In this context, a discussion of the nature and significance of metacognitions on the part of client and therapist, supervisor and supervisee seems important. In the history of the relationship between psychology and psychotherapy, it is possible to notice a number of regularities. At the end of the 1950s, psychoanalysts were actively engaged in studying patterns of mental activity formation, therefore W. Bion's concept of mental formation and importance of projective identification in this process was formulated on basis of practical work in this field. One of the basic ideas of this concept was the following – the normal development of mental activity occurs through affect testing of reality and the subsequent induction of change. Later in the Leningrad school of psychology in the 1980's and 1990's B.F. Lomov, L.M. Vekker, B.G. Ananyev and others reached similar conclusions during the experimental study of the perceptual image – the formation of a differentiated and synthesized perceptual image occurs through active interaction with elements of reality. This formed the evidence base for the theory that exists in practical psychotherapy. Nowadays, a similar situation is occurring – studies of consciousness and metacognition are being actively developed in cognitive psychology, which can serve as an evidentiary base for current concepts existing in psychotherapy. However, due to the fact that psychotherapy was traditionally developed mainly by doctors and within the framework of medical disciplines, the same problems of evidence as in medicine have migrated to psychotherapy. As a result, we see the disappointing conclusion observed in metaanalyses of contemporary research on the efficacy of psychotherapy – the concepts that have emerged over the past 30 years have shown no greater efficacy than previously existing ones. Coupled with this, the problem of proven efficacy of psychotherapy in general cannot be forgotten. Consequently, it is seems especially important to take into consideration the results of cognitive psychology in psychotherapeutic work and to develop psychotherapeutic concepts on the basis of evidence-based psychology. Considering the importance of metacognition in the process of psychotherapy and supervision, should be paid attention to such concepts as behavioral strategies in cognitive-behavioral therapy, intrapersonal structure in psychodynamic concepts and individual experience in phenomenological concepts. Each of these concepts is essentially used to describe mental representations, which are now being actively explored in metacognitive research. In a number of theoretical models, such as E.Ertkin's model, the interactions of metacognitive knowledge (mental representation), metacognitive skills (ways of processing information and knowledge about oneself), and metacognitive experiences (reactions to previous processes of processing) are of particular importance. We see a particularly pronounced interaction of these 3 components in the supervisory process when the supervisor brings metacognitive experiences about the client that have already been integrated into, or are in the process of being integrated into, knowledge about the client, about the self. There, in supervision, the group or supervisor helps the professional to go through full cycle between these three components to deepen understanding of the client, emerge new level metacognitive experiences and defuse these 130 experiences. Thus, understanding the diversity of organization of all three components in different people and in general is necessary for an effective supervisor. Otherwise, the risk of turning supervision from a way of overcoming difficulty into just a conversation very high. These conclusions can also be applied to psychotherapeutic work. In the light of the above, I would like to draw colleagues' attention to the relationship between research in psychology and psychotherapy concepts. The author believes that the interrelation of these fields can help to overcome the stagnation observed in psychotherapy in the last 10-15 years and provide the ground for solving problems of effectiveness and evidence in psychotherapy.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
4

Kumar, Munish, Kanna Swaminathan, Aizat Rusli und Abel Thomas-Hy. „Applying Data Analytics & Machine Learning Methods for Recovery Factor Prediction and Uncertainty Modelling“. In SPE Asia Pacific Oil & Gas Conference and Exhibition. SPE, 2022. http://dx.doi.org/10.2118/210769-ms.

Der volle Inhalt der Quelle
Annotation:
Abstract The estimation of recoverable hydrocarbons, or field recovery factor (RF), is a critical process for Oil and Gas (O&G) companies to plan and optimise field development, manage ongoing production and identify profitable investments amongst other technical and commercial decisions. However, RF remains one of the greatest uncertainties in O&G projects. The difficulty in RF prediction arises due to the number of variables affecting the recovery from a reservoir. These includes variables that are both uncertain and beyond the control of O&G operators, such as fluid flow in microscopic pores, as a function of fluid and rock properties, and variables which are engineering design based, such as completion methods, secondary and tertiary recovery mechanisms. In early field life, insufficient production data coupled with subsurface uncertainty makes RF prediction uncertain, and it is often the experience of the operator combined with analogue studies that is used to determine RF. However, there may be instances where operators may have insufficient data from analogue fields to properly capture the uncertainty in the RF range. Utilising techniques of big data manipulation and machine learning (ML), two open-source, United States based data sets are (a) deconstructed to identify the key variables impacting the ultimate recovery of a field, and (b) used to create a ML model to predict the RF based on these key variables. These two datasets (the onshore Tertiary Oil Recovery System (TORIS), and the offshore Gulf of Mexico (GOM)) consist of over 1,000,000 real world data points. Employing a low code environment, we test the predictive ability of 20 different ML algorithms by comparing predictive error. Decision tree type models (Random Forest and Category Boosting) show the best results. The paper shows comparison to a distance based (K Neighbour) model as well. The work aims to show that not all variables influence RF equally and that any ML model should therefore be built with variables that have the greatest influence on RF yet have the lowest pairwise correlation. The influence of these input variables differs, depending on the implemented ML model. The paper demonstrates the predictive ability of ML models is strongly dependent on the input dataset. Predicting the recovery factor of fields within the TORIS and GOM databases, the R2 values are 0.81 and 0.88 respectively. Testing the algorithm on three additional fields outside of the two datasets, and in different geological provinces showed errors of up to 10-15%.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
5

Mawlod, Arwa, Afzal Memon und John Nighswander. „Accuracy and Precision of Reservoir Fluid Characterization Tests Through Blind Round-Robin Testing“. In Abu Dhabi International Petroleum Exhibition & Conference. SPE, 2021. http://dx.doi.org/10.2118/207749-ms.

Der volle Inhalt der Quelle
Annotation:
Abstract Objectives/Scope: Oil and gas operators use a variety of reservoir engineering workflows in addition to the reservoir, production, and surface facility simulation tools to quantify reserves and complete field development planning activities. Reservoir fluid property data and models are fundamental input to all these workflows. Thus, it is important to understand the propagation of uncertainty in these various workflows arising from laboratory fluid property measured data and corresponding model uncertainty. The first step in understanding the impact of laboratory data uncertainty was to measure it, and as result, ADNOC Onshore undertook a detailed study to assess the performance of four selected reservoir fluid laboratories. The selected laboratories were evaluated using a blind round-robin study on stock tank liquid density and molar mass measurements, reservoir fluid flashed gas and flashed liquid C30+ reservoir composition gas chromatography measurements, and Constant Mass Expansion (CME) Pressure-Volume-Temperature (PVT) measurements using a variety of selected reservoir and pure components test fluids. Upon completion of the analytical study and establishing a range of measurement uncertainty, a sensitivity analysis study was completed using an equation of state (EoS) model to study the impact of reservoir fluid composition and molecular weight measurement uncertainty on EoS model predictions. Methods, Procedures, Process: A blind round test was designed and administered to assess the performance of the four laboratories. Strict confidentiality was maintained to conceal the identity of samples through blind test protocols. The round-robin tests were also witnessed by the researchers. The EoS sensitivity study was completed using the Peng Robinson EoS and a commercially available software package. Results, Observations, Conclusions: The results of the fully blind reservoir fluid laboratory tests along with the statistical analysis of uncertainties will be presented in this paper. One of the laboratories had a systemic deviation in the measured plus fraction composition on black oil reference standard samples. The plus fraction concentration is typically the largest weight percent component in black oil systems and, along with the plus fraction molar mass, plays a crucial role in establishing the mole percent overall reservoir fluid compositions. Another laboratory had systemic issues related to chromatogram component integration errors that resulted in inconsistent carbon number concentration trends for various components. All laboratories failed to produce consistent molecular weight measurements for the reference samples. Finally, one laboratory had a relative deviation for P-V measurements that were significantly outside the acceptable range. The EoS sensitivity study demonstrates that the fluid composition and stock tank oil molar mass measurements have a significant impact on EoS model predictions and hence the reservoir/production models input when all other parameters are fixed. Novel/Additive Information: To the best of our knowledge, this is the first time such an extensive and fully blind round-robin test of commercial reservoir fluid characterization laboratories has been completed and published in the open literature. The industry should greatly benefit from this first-of-its-kind blind round-robin dataset being made available to all. The study provides the basis, protocols, expectations, and recommendations for such independent round-robin testing for fluid characterization laboratories on a broader scale.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
6

Ferreira, Elga, Eliana Penedos-Santiago, Constança Rocha, Daniela Marques, Esteêvo Santos und Sara Dias. „Cohort Study Good Practices: Design Communication and Capacitation Processes“. In 13th International Conference on Applied Human Factors and Ergonomics (AHFE 2022). AHFE International, 2022. http://dx.doi.org/10.54941/ahfe1001406.

Der volle Inhalt der Quelle
Annotation:
In the county of Leiria, Portugal, part of the population is known to have morbidity diagnoses (metabolic illnesses and more) and poor health habits on a big enough scale to bring the idea of how low health literacy can affect people's lives and health services, such as a flood of the emergency systems caused by people attending the emergency room with minor issues. To address it, institutions in Leiria such as the City Hall and Polytechnic of Leiria decided to conduct a longitudinal and prospective cohort study, where a sample of the population will be followed throughout time to understand if their choices regarding health and sustainable habits are indeed affected by their health literacy levels.This project will contribute to the initial stage of this cohort study, by developing a recognizable brand, whose identity can be maintained throughout all its communication and dissemination media, so that the population can identify, without equivocation, the cohort study to which it refers, and awaken their curiosity to participate. This stage also includes the presentation and dissemination of the cohort study itself to the population under study, followed by a randomized inquiry done by pre-selected interviewers.This project relies on Service Design and Participatory Design methodologies to streamline the development of the study’s elements and to solve common cohort issues, such as: 1) gathering a suitable number of participants that can represent the population; 2) follow-up maintenance of participants; 3) keeping the interviewers and participants engaged with the study, after the first contact. Informal interviews and user group definition will help the comprehension of the study and allow to create personas to characterize the interviewers of the cohort study. These aforementioned methodologies will be supported by the workshop methodology under Participatory Design, acting as a testing ground for the previously developed processes, preparing interviewers to adapt their communication when facing people from different generations, education, and social backgrounds.By carrying out this project simultaneously with the cohort study, it’s possible to evaluate, over time, how the design methodologies can empower and facilitate communication and intervene, changing tactics in case it’s needed. The creation of a replicable experience is proposed allowing the betterment of the overall health of the population. Additionally, assuming the lack of information on how the preparatory phases of cohort studies are designed, it’s also envisaged the creation of guidelines and a good practice manual. It is also of great importance to point out the bridge established between the health and design fields, where design becomes the interface between science and the public.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
7

Ortiz Requena, Jhon Robert, Maryvi Yabet Santiago Martinez, Fatmah Mohamed Alshehhi, Fareed Ahmad Daudpota und Ahmed Mohamed Fawzy. „Improving Well and Reservoir Management Practice Through New Flow Control Philosophy that Prolongs the Life of Production Wells Affected by Water Breakthrough in A Giant Carbonate Oil Field, Abu Dhabi, United Arab Emirates“. In SPE Annual Technical Conference and Exhibition. SPE, 2021. http://dx.doi.org/10.2118/205978-ms.

Der volle Inhalt der Quelle
Annotation:
Abstract X Field located in the United Arab Emirates has been developed since 1970's by waterflooding as secondary recovery strategy. As water front advances into oil bank, the well operation practice commonly adopted in many fields for oil wells cutting water has consisted in reducing choke aperture in an attempt to control the water cut trend. However, in wells producing moderate to high water cut, this practice has proven to generate excess water settling in the bottom of the wellbore leading to premature inactivation of the wells. The reservoir Z in the north of X Field, is a black oil block operated by peripheral and pattern waterflooding. The production wells have been operating by natural lifting since first oil and will continue in natural flow until the Artificial Lift projects are commissioned within a few years. Meanwhile, the field production plateau has been increased arising challenges of production sustainability due to higher risk of acceleration of water breakthrough and consequently higher number of wells becoming inactive earlier. This led to re-assess the Well and Reservoir management strategy to define improved practices oriented to maximize the natural life cycle of wet wells and ensure the compliance of the field production quota. As a result, a new well management approach was devised and adopted to identify and optimize at the earliest stage, wells potentially affected by water loading mismanage. Conceptually, this new practice consisted in comprehensively analyzing well operating conditions, which ultimately generated a flow operating window that improved the multiphase flow performance in wellbores, minimized water slippage avoiding it to settle down and its associated problems, whilst respecting the compliance of technical guidelines for optimum reservoir management. Based on observations and data gathered from portable testing jobs, saturation logs, PLT and production monitoring; a methodology referred in this work as Critical Flow Analysis, has been successfully implemented in several naturally flowing wells with water cuts ranging from 15 – 40 % in Reservoir Z in X Field, which resulted in prolonged natural life, extra oil recovered, and avoided the negative impact of inactive string count on the Field Management KPI. The Critical Flow analysis has been a comprehensive well management evaluation and operation philosophy in Reservoir Z which helped to manage more efficiently and in cost-saving fashion the performance of oil wells located in high risk areas, in addition to contribute with stablishing best practices for well and reservoir management that could be extended to analog fields in the area.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
8

Larbi Zeghlache, Mohamed, Marvin Rourke und Xiaotian Liu. „Automated Corrosion Log Quality Control and Interpretation Using Machine-Learning“. In Offshore Technology Conference Asia. OTC, 2022. http://dx.doi.org/10.4043/31631-ms.

Der volle Inhalt der Quelle
Annotation:
Abstract With the increasing focus on data mining and machine learning (ML) applications in the oil and gas industry, the substantial number of well integrity logs and variety of data types represent a suitable candidate for the implementation of automated corrosion log processing. Convolutional neural networks (CNNs) are used in many fields, especially for image processing and features recognition. On the other hand, genetic algorithms (GA) add a valuable benefit to data processing in terms of global search and optimization. This paper demonstrates the integration of ML techniques with legacy well integrity log data, improving the results and leading to a tangible time and cost savings. A downhole well integrity evaluation triangle comprises three important services for comprehensive diagnosis: 1) cement evaluation, 2) corrosion inspection, and 3) leak detection. These services produce multiple datasets from a variety of logging tools. The types and sources of these datasets include synthetic data from simulation and modeling, tool calibration and lab testing, as well as raw, processed, and interpreted data. This paper describes the use of advanced ML techniques to scrutinize and improve well integrity evaluation. The new process resolves the recurrent challenges of well integrity evaluation in complex completion and downhole environments. It also maximizes value from existing well and field data. Image features recognition enables major improvements in the data analysis, such as the identification of concentric casings and tubing as well as their respective collar depths and types. In addition, input parameters and well schematics promote quality control of recorded data versus the model data. The new process helps to identify casing and completion accessories and provides a reliable benchmark. Another major element is the qualitative and quantitative evaluation of corrosion using deep learning algorithms combined with the GA. This evaluation is achieved using feature extraction from the forward model (FM) data in an analogous way to collar identification in an electromagnetic decay image. The integration of big data and advanced ML enables an improved data analysis with automated data quality control (QC) and interpretation. A more pro-active well integrity management system will result. Testing and validation using field examples demonstrate the benefits of this new methodology. The outcome is a better-quality answer product that helps depict various aspects of the acquired and interpreted data. Savings in time and cost are complemented with an improved and automated quality control.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
9

Uniyal, Rishabh, Suman Kumar Jaruhar, Manoj Kumar Sarkar, Sagun Devshali, Dibyajyoti Parida, Sushil Bhoye und Sudipta Biswas. „Selection of High Temperature Scale Inhibitor for Squeeze Application in Indian Offshore Carbonate Reservoir“. In Offshore Technology Conference Brasil. OTC, 2023. http://dx.doi.org/10.4043/32811-ms.

Der volle Inhalt der Quelle
Annotation:
Abstract The paper aims to elucidate the process undertaken to identify suitable inhibiting chemical to prevent down hole deposition of scale in ONGC western offshore wells by means of a squeeze job. Detailed description of methodology adopted for chemical selection has been elaborated in the paper. Most fields in ONGC's Western Offshore region are brown/matured fields with depleted reservoirs pressures. Seawater injection is one of the primary techniques used to combat depleting reservoir pressure. This has led to rampant escalation in scaling issues in offshore limestone reservoirs and subsequently, the frequency of scale removal jobs has also increased exponentially over the past two decades. Scale prevention is a superior and economical alternative to scale removal due to lesser consumption of chemicals and prolonged life. As part of this study, the feasibility of carrying out Scale Inhibitor Squeeze Jobs in ONGC offshore wells was examined and subsequently, extensive laboratory experiments were performed to identify suitable chemicals. The experiments included inhibition efficiency tests, thermal stability tests and extended core flow studies (adsorption and desorption methods) to verify chemical compatibility with core sample of a number of generic and vendor based chemicals under simulated reservoir conditions. After a comprehensive literature review and market scouting, six Scale Inhibitors were shortlisted and evaluated for their inhibition efficiency, thermal stability and compatibility with the rock formation through laboratory experiments. After extensive testing, Chemical X was identified as being most suitable for scale squeeze job in carbonate formations having temperatures up to 110° Celsius (230° F) and was also compatible with the formation. The adsorption and desorption isotherms respectively demonstrated sufficient chemical retention in the core and slow elution in the discharge. The measured Scale Inhibitor concentration was found to be greater than the Minimum Inhibitor Concentration (MIC) required for scale prevention. This indicated that any potential squeeze job would likely have a reasonable expected life. The study explores the possibility of carrying out a first ever scale squeeze job in ONGC Western Offshore reservoirs particularly with high temperature application. Core flow experiments were performed using scale inhibitor chemical to derive adsorption and desorption isotherms used to prepare customized job plans.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
10

Fontes, Flaviano Dias, Giordano Ribeiro Eulalio Cabral und Geber Lisboa Ramalho. „An open source platform to assist the creation of group playlists through artificial intelligence algorithms“. In Simpósio Brasileiro de Computação Musical. Sociedade Brasileira de Computação - SBC, 2021. http://dx.doi.org/10.5753/sbcm.2021.19442.

Der volle Inhalt der Quelle
Annotation:
Recommendation systems are a constantly expanding study area, with applications in various fields such as e-commerce, films, music to promote the user’s suggestions. When we talk about music, we have more than 20 years of studies trying to solve the problem of a good generation of playlists that maximizes the satisfaction of a larger number of listeners. For automated automatic playlist generation methods focusing on a user group, we have the collaborative filter as a more assertive method to get the user’s not likely, to improve the performance of group recommendation algorithms we store the preferences of users Especially I did not like it by placing the availability of using this data as an algorithm input parameter. The platform described in This paper is intended to facilitate testing between these recommendation systems, standardizing data entry, and facilitating requests. The use of GraphQL as a framework associated with Apollo as a library, greatly facilitates the integration of these APIs, as the separation of data sources makes it possible to associate Spotify data with Deezer or Apple Music data, these data are stored in the database of the connection, so that in future requests it will no longer be necessary to consult the Spotify API, thus facilitating the consumption of data from the artificial intelligence algorithms, as well as a possible sharing of songs between services, since all services have an ISRC code to identify the songs.
APA, Harvard, Vancouver, ISO und andere Zitierweisen

Berichte der Organisationen zum Thema "Identity Testing in Number Fields"

1

Svedeman. L51729 Gas Scrubber Performance Evaluation - Measurement Methods. Chantilly, Virginia: Pipeline Research Council International, Inc. (PRCI), April 1995. http://dx.doi.org/10.55274/r0010420.

Der volle Inhalt der Quelle
Annotation:
Scrubbers and separators are used in natural gas pipelines to remove solid and liquid materials from the gas stream. Failure to remove the entrained materials from the gas can result in equipment damage, increased pressure drop due to liquid accumulation, flow measurement errors, and corrosion. The performance of separators is rarely tested after a separator is installed because there is a lack of test instrumentation and it is difficult to conduct tests at the high pressures. The only indicators of poor separator performance are recurring problems in downstream equipment or the detection of accumulated materials in downstream piping. Instrumentation is needed that can verify separator performance when the unit is installed and to periodically monitor separator performance. The report documents results of instrument tests. The objectives of the instrument evaluations were to verify that the instruments could be used to measure particles penetrating a separator, to provide a comparative evaluation of the instruments, and to identify any measurement problems that could be encountered in field testing. One important result was that the separator minimum removable drop size increased as the operating pressure increased. This trend is not generally known, since there is a lack of test results for pressures above atmospheric pressure. The separator performance test results are documented in this report. Two different particle measuring instruments were evaluated for documenting separator performance. The two instruments were the video imaging system with automatic image analysis and the laser-based phase Doppler particle measuring system. The instruments were evaluated in laboratory tests that were conducted on a commercially available vane-type separator. The objectives of the instrument evaluations were to verify that the instruments could be used to measure particles penetrating a separator, to provide a comparative evaluation of the two instruments, and to identify any measurement problems that could be encountered in field testing. The video imaging system has a number of attractive attributes, but it was not able to measure the small diameter drops at the separator exit. The primary limitation was that the optical system could not clearly image the small drops (in the range from 5 to 30 um). The phase Doppler particle measuring system was capable of measuring all of the parameters needed to document the separator performance. Based on the instrument evaluations, future efforts on developing measurement methods for documenting separator performance should focus on adapting the phase Doppler system to field testing.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
2

Arumugam, Udayansankar, Mimoun Elboujdaini, Ming Gao und Ramiro Vanoye. PR-328-133702-R02 F-S Fatigue Testing of Crack-in-Dent with Framework for Life Prediction. Chantilly, Virginia: Pipeline Research Council International, Inc. (PRCI), Oktober 2019. http://dx.doi.org/10.55274/r0011628.

Der volle Inhalt der Quelle
Annotation:
ASME B31.8 states that "Dents that contain stress corrosion cracking or other cracks are injurious to the pipeline" and therefore, requires immediate attention by the Operators. Dent containing crack fields (colonies) are often observed in liquid pipelines. The recently completed PRCI research project MD-1N "Study of the Mechanism for Cracking in Dents in a Crude Oil Pipeline" showed evidence of a mechanism for fatigue cracking. The crack growth rate as a function of stress intensity factor was estimated using the measured spacings of fatigue striations from fracture surfaces based on the assumption that the formation of fatigue striations on a cycle-by-cycle basis. However, due to the lack of full-scale fatigue crack growth data, the success was limited. This gap prompted PRCI to launch a full-scale experimental investigation of crack growth rates of cracks in dents under cyclic pressure load in the simulated groundwater NS4 environment (PRC-328-133702, MD-1Q). The objective of the study was to determine the crack growth rate as a function of stress intensity factor, the number of cycles to failure, and the failure modes of cracks in dents. The test results would be used to evaluate the validity of cycle-by-cycle based assumption for crack growth rate estimation from the measured fatigue-striation-spacing. The investigation was also aimed at establishing a framework for remaining fatigue life prediction of cracks in dents in liquid pipelines. This framework would benefit liquid pipeline Operators to manage better the integrity of dents associated with corrosion fatigue cracking in groundwater. A total of six pipe samples containing cracks in shallow dents excavated from a retired 24-inch diameter liquid transmission pipeline were available and used for the full-scale fatigue tests. The test system developed under the project consisted of four components: (1) a computer-controlled hydraulic pressure cycling system, (2) an environment chamber containing a simulated groundwater NS4 solution mounted on the pipe in around the dent region to provide a simulated field environment condition; (3) real-time crack growth monitoring systems including direct cur-rent potential drop (DCPD), Clip gage and Strain gage; (4) data acquisition system. The cyclic pressure range used in the fatigue tests was 78 to 780 psig (72%SMYS) with R=0.1, which was based on historical operational pressure data and the Rain flow analysis. A constant frequency of 0.0526 Hz was selected for the testing to ensure the frequency requirement for corrosion fatigue is met. The remaining fatigue life of cracks-in-dents and failure modes were evaluated using the full-scale fatigue test results. Further, fatigue crack growth rates were established. Finally, a framework was developed for the life prediction of cracks in shallow dents based on the findings from six full-scale fatigue cyclic tests. This framework will assist liquid pipeline operators to estimate the remaining fatigue life for cracks in shallow dents utilizing inputs from ILI and pipeline's historical operational pressure fluctuation data and to mitigate the threat of cracks in dents in a timely manner. There is a related webinar.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
3

Morin, S., L. L. Walling, Peter W. Atkinson, J. Li und B. E. Tabashnik. ets for CRISPR/Cas9-mediated gene drive in Bemisia tabaci. Israel: United States-Israel Binational Agricultural Research and Development Fund, 2021. http://dx.doi.org/10.32747/2021.8134170.bard.

Der volle Inhalt der Quelle
Annotation:
The goal of our BARD proposal was to build both the necessary infrastructure and knowledge for using the CRISPR/Cas9-based gene drive system to control the whitefly Bemisia tabaci. Our research focused on achieving three main goals: (1) establishing a CRISPR/Cas9 gene-editing system for producing genetically-edited B. tabaci; (2) generating and testing CRISPR/Cas9-mediated mutations targeting genes that represent two gene drive strategies: population replacement and population suppression; (3) using computer modeling to optimize strategies for applying CRISPR/Cas9 to control B. tabaci populations in the field. CRISPR gene drive is one of the most promising strategies for diminishing the negative impacts of harmful insects. This technique can introduce mutations into wild populations of pests that reduce their ability to cause damage, reduce their population size, or both. In principle, this can be selfsustaining because mutations carried by relatively few insects can increase in frequency and spread quickly throughout wild populations. Because of this sustainability and the potential benefits to society, agricultural gene-drive systems are most likely to be funded by government agencies, foundations, and grower associations; as with sterile insect releases and most biocontrol programs. Although gene drives have received intensive study in Drosophila and mosquito vectors of human disease, we were one of the first teams pursuing this approach for crop pests. Our project was also one of the first to address CRISPR gene drive in the Hemiptera, an insect order that includes hundreds of pest species. We focused on developing and implementing CRISPR gene drive to reduce the massive damage caused by B. tabaci. This haplodiploid insect is one of the world's most devastating crop pests. Whereas extensive work by others explored CRISPR in diploid species, our project pioneered application of this revolutionary technology to haplodiploids, which have a distinct system of inheritance that presents special challenges and opportunities. Our project has achieved several breakthroughs, including publication of the first paper analyzing CRISPR gene drive in haplodiploids (Li et al. 2020, see next section). Our modeling results from this landmark study demonstrate that CRISPR gene drive can work in haplodiploids, especially if fitness costs associated with the driver allele are low or nil. Our paper was the first to provide a conceptual framework for evaluating and optimizing CRISPR gene drive strategies for managing B. tabaci and other haplodiploid pests. Our breakthroughs in the laboratory have created the infrastructure needed to develop CRISPR for controlling B. tabaci. We established a microinjection system enabling us to introduce CRISPR-derived mutations into B. tabaci embryos. We have used this system to generate and track inherited eye-color mutants of B. tabaci. We have identified and cloned germline promoters, and demonstrated their function in transgenic B. tabaci embryos and other hemipteran insects. We have also developed a tool to easily identify B. tabaci harboring CRISPR-mediated mutations by tagging target genes using a transgenic fluorescent marker. The successful completion of our project provides all the knowledge and infrastructure essential for developing a novel genetic approach for B. tabaci control, which can serve as a non-chemical "green" alternative for managing this global pest. We predict that our discoveries will accelerate the development of the CRISPR gene drive technique for reducing the numbers of this pest and the damage it causes. Still, realization of the benefits of gene-drive technology for pest control will require sustained attention to potential environmental and societal impacts, as well as regulatory and implementation challenges. Given the great promise of this technology and the urgent need for better control methods, we expect that guidance documents and regulations will be in place to allow the scientific community to safely move gene drives for pest control from the laboratory to field trials.
APA, Harvard, Vancouver, ISO und andere Zitierweisen
Wir bieten Rabatte auf alle Premium-Pläne für Autoren, deren Werke in thematische Literatursammlungen aufgenommen wurden. Kontaktieren Sie uns, um einen einzigartigen Promo-Code zu erhalten!

Zur Bibliographie