Inhaltsverzeichnis
Auswahl der wissenschaftlichen Literatur zum Thema „Field crops Diseases and pests Australia“
Geben Sie eine Quelle nach APA, MLA, Chicago, Harvard und anderen Zitierweisen an
Machen Sie sich mit den Listen der aktuellen Artikel, Bücher, Dissertationen, Berichten und anderer wissenschaftlichen Quellen zum Thema "Field crops Diseases and pests Australia" bekannt.
Neben jedem Werk im Literaturverzeichnis ist die Option "Zur Bibliographie hinzufügen" verfügbar. Nutzen Sie sie, wird Ihre bibliographische Angabe des gewählten Werkes nach der nötigen Zitierweise (APA, MLA, Harvard, Chicago, Vancouver usw.) automatisch gestaltet.
Sie können auch den vollen Text der wissenschaftlichen Publikation im PDF-Format herunterladen und eine Online-Annotation der Arbeit lesen, wenn die relevanten Parameter in den Metadaten verfügbar sind.
Zeitschriftenartikel zum Thema "Field crops Diseases and pests Australia"
1
Li, Y. P., M. P. You, T. N. Khan, P. M. Finnegan und M. J. Barbetti. „First Report of Phoma herbarum on Field Pea (Pisum sativum) in Australia“. Plant Disease 95, Nr. 12 (Dezember 2011): 1590. http://dx.doi.org/10.1094/pdis-07-11-0594.
Der volle Inhalt der QuelleAnnotation:
Black spot disease on field pea (Pisum sativum) in Australia is generally caused by one or more of the four fungi: Mycosphaerella pinodes (anamorph Ascochyta pinodes), Phoma medicaginis var. pinodella (synonym Phoma pinodella), Ascochyta pisi, and Phoma koolunga (1,2,4). However, in 2010 from a field pea blackspot disease screening nursery at Medina, Western Australia, approximately 25% of isolates were a Phoma sp. that was morphologically different to Phoma spp. previously reported on field pea in Western Australia, while the remaining 75% of isolates were either M. pinodes or P. medicaginis var. pinodella. Single-spore isolations of 23 isolates of this Phoma sp. were made onto potato dextrose agar. A PCR-based assay with the TW81 and AB28 primers was used to amplify from the 3′ end of 16S rDNA, across ITS1, 5.8S rDNA, and ITS2 to the 5′ end of the 28S rDNA. The DNA products were sequenced and BLAST analyses were used to compare sequences with those in GenBank. In each case, the sequence had ≥99% nucleotide identity with the corresponding sequence in GenBank for P. herbarum. Isolates also showed morphological similarities to P. herbarum as described in other reports (e.g., 3). The relevant information for a representative isolate has been lodged in GenBank (Accession No. JN247437). The same primers were used by Davidson et al. (2) to identify P. koolunga, but none of our 23 isolates were P. koolunga. A conidial suspension of 107 conidia ml–1 from a single-spore culture was spray inoculated onto foliage of 10-day-old Pisum sativum cv. Dundale plants maintained under >90% relative humidity conditions for 72 h postinoculation. Symptoms evident by 11 days postinoculation consisted of pale brown lesions that were mostly 1.5 to 2 mm long and 1 to 1.5 mm wide. Approximately 50% of lesions showed a distinct chlorotic halo extending 1 to 2 mm outside the boundary of the lesion. P. herbarum was readily reisolated from infected foliage. A culture of this representative isolate has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13499). Outside of Australia, P. herbarum, while generally considered a soilborne opportunistic pathogen, has been reported on a wide range of species, including field pea (3). Molecular analysis of historical isolates collected from field pea in Western Australia, mostly in the late 1980s, did not show any incidence of P. herbarum, despite this fungus being reported on alfalfa (Medicago sativa) and soybean (Glycine max) in Western Australia in 1985 (Australian Plant Pest Database). In Western Australia, this fungus has also been recorded on a Protea sp. in 1991 and on Arabian pea (Bituminaria bituminosa) in 2010 (Australian Plant Pest Database). To our knowledge, this is the first report of P. herbarum as a pathogen on field pea in Australia. These previous reports of P. herbarum on other hosts in Western Australia and the wide host range of P. herbarum together suggest the potential for this fungus to be a pathogen on a wider range of genera/species than field pea. References: (1) T. W. Bretag and M. Ramsey. Page 24 in: Compendium of Pea Diseases and Pests. 2nd ed. The American Phytopathologic Society, St Paul, MN, 2001. (2) J. A. Davidson et al. Mycologica 101:120, 2009. (3) G. L. Kinsey. Phoma herbarum. No 1501. IMI Descriptions of Fungi and Bacteria, 2002. (4) T. L. Peever et al. Mycologia 99:59, 2007.
2
Goyne, PJ, H. Meinke, SP Milroy, GL Hammer und JM Hare. „Development and use of a barley crop simulation model to evaluate production management strategies in north-eastern Australia“. Australian Journal of Agricultural Research 47, Nr. 7 (1996): 997. http://dx.doi.org/10.1071/ar9960997.
Der volle Inhalt der QuelleAnnotation:
A study was undertaken to identify improved management strategies for barley (Hordeum vulgare L.), particularly in relation to time of planting, location, and frost risk in the variable climate of north-eastern Australia. To achieve this objective, a crop growth simulation model (QBAR) was constructed to integrate the understanding, gained from field experiments, of the dynamics of crop growth as influenced by soil moisture and environmental variables. QBAR simulates the growth and yield potential of barley grown under optimal nutrient supply, in the absence of pests, diseases, and weeds. Genotypic variables have been determined for 4 cultivars commonly grown in the northern cereal production areas. Simulations were conducted using long-term weather data to generate the probabilistic yield outcome of cv. Grimmet for a range of times of planting at 10 locations in the north-eastern Australian grain belt. The study indicated that the common planting times used by growers could be too late under certain circumstances to gain full yield potential. Further applications of QBAR to generating information suitable for crop management decision support packages and crop yield forecasting are discussed.
3
Hochman, Z., D. Holzworth und J. R. Hunt. „Potential to improve on-farm wheat yield and WUE in Australia“. Crop and Pasture Science 60, Nr. 8 (2009): 708. http://dx.doi.org/10.1071/cp09064.
Der volle Inhalt der QuelleAnnotation:
Water-use efficiency (WUE) is defined here as the ratio of grain yield (kg/ha) to crop water use by evapotranspiration (mm). Much of the WUE literature has focussed on either the determination of the boundary of attainable WUE for any amount of available water, or on the practicalities of measurement of the WUE of a crop. While these are important issues for defining the gap between the attained and the potential WUE, little progress has been reported on clarifying the components that contribute to this gap or on how it can be bridged. To address these questions, we analysed 334 wheat fields for which we had the data necessary to both calculate WUE and to simulate crop growth and water use. Simulations were conducted through Yield Prophet®, an on-line version of the APSIM systems model. For this dataset, evapotranspiration accounted for 69% of observed yield variation, although the more commonly used growing-season (April–October) rainfall accounted for 50%. Considering that evapotranspiration efficiency does not account for a wide range of potentially yield-limiting factors including soil and fertiliser nitrogen supply, crop phenology, and sowing dates, or rainfall distribution, these results reinforce the importance of evapotranspiration efficiency as a yield determinant for well managed crops in water-limited environments. WUE attained over the whole dataset was 15.2 kg grain/ha.mm (x-intercept = 67 mm), although this value contained data subsets with important differences in WUE based on soil water-holding capacity and regional diversity. Yield Prophet® simulated commercial wheat yields with RMSDs of 0.80 t/ha (r2 = 0.71), with some systematic error between observed and simulated yields. Simulated crops achieved a higher WUE (16.9 kg grain/ha.mm; x-intercept = 72 mm) than the observed crops, probably because APSIM does not account for effects of factors such as weeds, pests and diseases and impacts of severe weather. Simulated ‘what-if’ analysis suggested that further improvement in WUE may be achieved with an early sowing strategy or a higher nitrogen input strategy. A ‘yield maximising’ strategy that included an optimal plant density, early sowing date, and higher nitrogen inputs resulted in an average WUE (21.4 kg grain/ha.mm; x-intercept = 80 mm) that is close to the previously reported (French-Schultz) boundary of WUE. This outcome suggests a great deal of scope for Australian wheat growers to adopt strategies that improve their WUE. Yield Prophet® farmers have already demonstrated significant improvement in on-farm WUE compared with previous studies. However, additional improvements will only be partially realised due to considerations of the cost: benefit ratio and risk in a highly variable climate, and the operational feasibility of these strategies with current technologies.
4
Nordblom, T. L., T. R. Hutchings, R. C. Hayes, G. D. Li und J. D. Finlayson. „Does establishing lucerne under a cover crop increase farm financial risk?“ Crop and Pasture Science 68, Nr. 12 (2017): 1149. http://dx.doi.org/10.1071/cp16379.
Der volle Inhalt der QuelleAnnotation:
Rainfed farms in south-eastern Australia often combine annual cropping and perennial pasture phases with grazing sheep enterprises. Such diversity serves in managing diseases, pests and plant nutrition while stabilising income in the face of wide, uncorrelated variations in international commodity prices and local weather over time. We use an actuarial accounting approach to capture the above contexts to render financial risk profiles in the form of distributions of decadal cash balances for a representative 1000-ha farm at Coolamon (34°50ʹS, 147°12ʹE) in New South Wales, Australia. For the soil and weather conditions at this location we pose the question of which approach is better when establishing the perennial pasture lucerne (Medicago sativa L.): sowing with the final crop of the cropping phase, or sowing alone following the final crop? It is less expensive to sow lucerne with the final crop, which can provide useful income from the sale of grain, but this practice can reduce pasture quantity and quality in poorer years. Although many years of field research have confirmed that sowing lucerne alone is the most reliable way to establish a pasture in this area, and years of extension messages to this effect have gone out to farmers, they often persist in sowing lucerne with their final cereal crops. For this region, counting all costs, we show that sowing lucerne alone can reduce farm financial risk (i.e. probability of negative decadal cash balances) at stocking rates >10 dry sheep equivalents (DSE)/ha, compared with the practice of sowing lucerne with a cover crop. Establishing lucerne alone allows the farmer the option to profitably run higher stocking rates for higher median decadal cash margins without additional financial risk. At low stocking rates (i.e. 5 DSE/ha), there appears to be no financial advantage of either establishment approach. We consider the level of equity, background farm debt and overhead costs to demonstrate how these also affect risk-profile positions of the two sowing options. For a farm that is deeply in debt, we cannot suggest either approach to establishing lucerne will lead to substantially better financial outcomes.
5
Chen, W., F. M. Dugan und R. McGee. „First Report of Dodder (Cuscuta pentagona) on Chickpea (Cicer arietinum) in the United States“. Plant Disease 98, Nr. 1 (Januar 2014): 165. http://dx.doi.org/10.1094/pdis-03-13-0334-pdn.
Der volle Inhalt der QuelleAnnotation:
Chickpea (Cicer arietinum L.) is an important rotational and an emerging specialty crop in the Pacific Northwest of the United States, in California, and in the Northern Great Plains of the United States and Canada. Dodders (Cuscuta spp.) are widespread parasitic weeds on many crops worldwide. Several Cuscuta species (primarily C. campestris Yuncker) have been reported to parasitize chickpea, and dodder is important on chickpea in the Indian subcontinent, the Middle East, and recently in Australia (4), but has previously not been reported from North America. On 28 July 2012, a chickpea field near Walla Walla, WA, was found parasitized by dodder. The chickpea was at late flowering and early pod filling stages and there were no other visible green weedy plants as observed from the canopy. There were about 15 dodder colonies varying in size from 2 to 15 meters in diameter in the field of about 500 acres. Chickpea plants in the center of the dodder colonies were wilting or dead. The colonies consisted of orange leafless twining stems wrapped around chickpea stems and spreading between chickpea plants. Haustoria of the dodder penetrating chickpea stems were clearly visible to the naked eye. Flowers, formed abundantly in dense clusters, were white and five-angled, with capitate stigmas, and lobes on developing calyxes were clearly overlapping. The dodder keyed to C. pentagona Engelm. in Hitchcock and Cronquest (3) and in Costea (1; and www.wlu.ca/page.php?grp_id=2147&p=8968 ). Specimens of dodder plants wrapping around chickpea stems with visible penetrating haustoria were collected on 28 July 2013 and vouchers (WS386115, WS386116, and WS386117) were deposited at the Washington State University Ownbey Herbarium. All dodder colonies in the field were eradicated before seed formation to prevent establishment of dodder. Total genomic DNA was isolated from dodder stems, and PCR primers ITS1 (5′TCCGTAGGTGAACCTGCGG) and ITS4 (5′TCCTCCGCTTATTGATATGC) were used to amplify the internal transcribed spacer (ITS) region of the nuclear rDNA. The ITS region was sequenced. BLAST search of the NCBI nucleotide database using the ITS sequence as query found that the most similar sequence was from C. pentagona (GenBank Accession No. DQ211589.1), and our ITS sequence was deposited in GenBank (KC832885). Dodder (C. approximata Bab.) has been historically a regional problem on alfalfa (Washington State Noxious Weed Control Board 2011). Another species stated to be “mainly” associated with legumes is C. epithymum Murr., and C. pentagona is “especially” associated with legumes (3). The latter species has sometimes been considered a variety (var. calycina) of C. campestris Yuncker (1,3). Although chickpea has been cultivated in the Walla Walla region for over 20 years, to our knowledge, this is the first time dodder has been observed on chickpea in North America. The likely source is from nearby alfalfa or other crop fields, with transmission by farm machinery or wild animals. Some chickpea germplasm exhibits partial resistance to C. campestris (2). References: (1) M. Costea et al. SIDA 22:151, 2006. (2) Y. Goldwasser et al. Weed Res. 52:122, 2012. (3) C. L. Hitchcock and A. Cronquist. Flora of the Pacific Northwest: An Illustrated Manual. University of Washington Press, Seattle, 1973. (4) D. Rubiales et al. Dodder. Page 98 in: Compendium of Chickpea and Lentil Diseases and Pests. W. Chen et al., eds. APS Press, St. Paul, Minnesota, 2011.
6
Wheeler, Bryan. „Book Reviews: Pests and Diseases of Tropical Crops. Vol. 2: Field Handbook.“ Outlook on Agriculture 18, Nr. 4 (Dezember 1989): 192. http://dx.doi.org/10.1177/003072708901800426.
Der volle Inhalt der Quelle
7
Truzina, Lyudmila, und Larissa Korovina. „TO THE ANNIVERSARY OF THE FEDERAL WILLIAMS RESEARCH CENTER OF FORAGE PRODUCTION AND AGROECOLOGY: ABOUT THE PLANT PROTECTION DEPARTMENT“. Adaptive Fodder Production 2022, Nr. 1 (05.05.2022): 59–70. http://dx.doi.org/10.33814/afp-2222-5366-2022-1-59-70.
Der volle Inhalt der QuelleAnnotation:
The main directions of research on chemical means of protecting fodder crops from diseases, pests and weeds in the field fodder production of the All-Russian Fodder Research Institute are given. Studies on toxicological assessment of feed and soil are given. Plant Protection Department included three laboratories: the Herbicide Laboratory, the Plant Protection Laboratory and the Feed Toxicological Evaluation Laboratory. The Laboratory of Herbicides was established in 1967 to conduct research on the chemical method of controlling weeds on fodder crops, hayfields and pastures. Research on the study of pests of fodder crops was started in 1939 in the newly created laboratory for the protection of fodder crops from pests and diseases. The Feed Toxicology Assessment Laboratory was established in 1980 to assess pesticide residues in crop and soil. As a result of the studies, a system of measures for clover from pests has been developed; alfalfa diseases and pests and measures to combat them in the Non-Chernozem zone were studied. Pests and pathogens of corn, root crops, peas, lupine and other fodder crops were identified; their biology, ecology and harmfulness have been studied. A set of protective measures has been developed to combat the main pests and diseases of fodder crops, including soil cultivation techniques, early sowing dates, the use of resistant varieties, micro- and macrofertilizers, pre-sowing treatment of seeds with combined preparations, etc. Plant Protection Department carried out work with herbicides. As a result of research begun in 1950, a method was developed to clean the meadows from weedy herbaceous vegetation with the help of preparations 2,4-D and 2M-4X. A chemical method for the destruction of woody and shrubby vegetation with the help of the same preparations in the Non-Chernozem zone of the European part of the USSR has been developed. Methods of using herbicides on crops of almost all fodder crops have been developed: perennial and annual legumes and cereal grasses for green mass and seeds, corn, fodder beets, rapeseed, etc. The theoretical issues of the mutual influence of fodder crops and weeds are studied, the substantiation of the effectiveness of the use of herbicides on different types of soils is given.
8
González-Domínguez, Elisa, César Monzó und Antonio Vicent. „New Trends in Disease and Pest Management: Challenges and Opportunities“. Agronomy 11, Nr. 5 (07.05.2021): 923. http://dx.doi.org/10.3390/agronomy11050923.
Der volle Inhalt der Quelle
9
McRoberts, N., G. Hughes und S. Savary. „Integrated approaches to understanding and control of diseases and pests in field crops“. Australasian Plant Pathology 32, Nr. 2 (2003): 167. http://dx.doi.org/10.1071/ap03026.
Der volle Inhalt der Quelle
10
Etebari, Kayvan, Pauline Lenancker, Kevin S. Powell und Michael J. Furlong. „Transcriptomics Reveal Several Novel Viruses from Canegrubs (Coleoptera: Scarabaeidae) in Central Queensland, Australia“. Viruses 14, Nr. 3 (21.03.2022): 649. http://dx.doi.org/10.3390/v14030649.
Der volle Inhalt der QuelleAnnotation:
Canegrubs (Coleoptera: Scarabaeidae) are major pests of sugarcane crops in Australia, but despite long-term and intensive research, no commercially viable biological control agents have been identified. We used the RNA-Seq approach to explore the viriomes of three different species of canegrubs from central Queensland, Australia to identify potential candidates for biological control. We identified six novel RNA viruses, characterized their genomes, and inferred their evolutionary relationships with other closely related viruses. These novel viruses showed similarity to other known members from picornaviruses, benyviruses, sobemoviruses, totiviruses, and reoviruses. The abundance of viral reads varied in these libraries; for example, Dermolepida albohirtum picorna-like virus (9696 nt) was built from 83,894 assembled reads while only 1350 reads mapped to Lepidiota negatoria beny-like virus (6371 nt). Future studies are essential to determine their natural incidence in different life stages of the host, biodiversity, geographical distributions, and potential as biological control agents for these important pests of sugarcane.
Dissertationen zum Thema "Field crops Diseases and pests Australia"
1
Dennis, Jeremy Ian. „Chocolate spot of faba beans in South Australia“. Title page, contents and summary only, 1991. http://web4.library.adelaide.edu.au/theses/09A/09ad411pdf.pdf.
Der volle Inhalt der QuelleAnnotation:
Bibliography: leaves 81-100. Entry of inoculum into a crop and disease development in the crop cannot be prevented because spores are airborne and there is a lack of highly resistant varieties. This makes complete control of chocolate spot unlikely. It should however, be possible to improve current levels of disease control through the integration of the factors identified in the study.
2
Taylor, Sharyn Patricia. „The root lesion nematode, Pratylenchus neglectus, in field crops in South Australia“. Title page, contents and summary only, 2000. http://web4.library.adelaide.edu.au/theses/09PH/09pht2462.pdf.
Der volle Inhalt der QuelleAnnotation:
Includes bibliographical references (leaves 241-25). Aims to evaluate sampling procedures; assess the extent and magnitude of yield loss caused by Pratylenchus neglectus; assess the population dynamics of Pratylenchus neglectus in cereals; determine whether resistance occurs in field crops; and, assess whether variation occurs between geographically isolated species of Pratylenchus neglectus
3
Paap, Arie Jacobus. „Development of an optical sensor for real-time weed detection using laser based spectroscopy“. Thesis, Edith Cowan University, Research Online, Perth, Western Australia, 2014. https://ro.ecu.edu.au/theses/1282.
Der volle Inhalt der QuelleAnnotation:
The management of weeds in agriculture is a time consuming and expensive activity, including in Australia where the predominant strategy is blanket spraying of herbicides. This approach wastes herbicide by applying it in areas where there are no weeds. Discrimination of different plant species can be performed based on the spectral reflectance of the leaves. This thesis describes the development of a sensor for automatic spot spraying of weeds within crop rows. The sensor records the relative intensity of reflected light in three narrow wavebands using lasers as an illumination source.
A prototype weed sensor which had been previously developed was evaluated and redesigned to improve its plant discrimination performance. A line scan image sensor replacement was chosen which reduced the noise in the recorded spectral reflectance properties. The switching speed of the laser sources was increased by replacing the laser drivers. The optical properties of the light source were improved to provide a more uniform illumination across the viewing area of the sensor. A new opto-mechanical system was designed and constructed with the required robustness to operate the weed sensor in outdoor conditions. Independent operation of the sensor was made possible by the development of hardware and software for an embedded controller which operated the opto-electronic components and performed plant discrimination.
The first revised prototype was capable of detecting plants at a speed of 10 km/h in outdoor conditions with the sensor attached to a quad bike. However, it was not capable of discriminating different plants. The final prototype included a line scan sensor with increased dynamic range and pixel resolution as well as improved stability of the output laser power. These changes improved the measurement of spectral reflectance properties of plants and provided reliable discrimination of three different broadleaved plants using only three narrow wavelength bands. A field trial with the final prototype demonstrated successful discrimination of these three different plants at 5 km/h when a shroud was used to block ambient light.
A survey of spectral reflectance of four crops (sugarcane, cotton, wheat and sorghum) and the weeds growing amongst these crops was conducted to determine the potential for use of the prototype weed sensor to control spot-spraying of herbicides. Visible reflectance spectra were recorded from individual leaves using a fibre spectrometer throughout the growing season for each crop. A discriminant analysis was conducted based on six narrow wavebands extracted from leaf level spectral reflectance measured with a spectrometer. The analysis showed the potential to discriminate cotton and sugarcane from
4
Dennis, Jeremy Ian. „Chocolate spot of faba beans in South Australia“. Thesis, 1991. http://hdl.handle.net/2440/109036.
Der volle Inhalt der QuelleAnnotation:
Entry of inoculum into a crop and disease development in the crop cannot be prevented because spores are airborne and there is a lack of highly resistant varieties. This makes complete control of chocolate spot unlikely. It should however, be possible to improve current levels of disease control through the integration of the factors identified in the studyThesis (M.Ag.Sc.) -- University of Adelaide, Departments of Plant Science and Crop Protection, 1991
5
Hosseini, Reza. „A DNA-based approach to study predator-prey trophic interactions within Brassica crops : a search for predators of diamondback moth (Plutella xylostella)“. 2007. http://hdl.handle.net/2440/56816.
Der volle Inhalt der QuelleAnnotation:
Title page, contents and abstract only. The complete thesis in print form is available from the University of Adelaide Library.Brassica vegetables and oilseeds are economically important crops worldwide. These crops are associated with several destructive and widespread insect pests. In Australia these pests include six species, Plutella xylostella (Linnaeus), Pieris rapae (Linnaeus), Hellula hydralis Guenée, Helicoverpa punctigera (Wallengren), Brevicoryne brassicae (Linnaeus) and Myzus persicae (Sulzer), which are the focus of this research. Among them P. xylostella (diamondback moth or DBM) is the most serious and destructive insect pest. Little is known about the potential of predators, which may be able to contribute to control diamondback moth, although some field studies have shown the overall importance of predators in controlling this key pest. The aim of this study was to develop a method that allows study of predator-prey trophic interactions in the field.
http://proxy.library.adelaide.edu.au/login?url= http://library.adelaide.edu.au/cgi-bin/Pwebrecon.cgi?BBID=1294814
Thesis (Ph.D.) -- University of Adelaide, School of Agriculture, Food and Wine, 2007
6
Ngoya, Japheth N. „The statistical analyses of a complex survey of banana pests and diseases in Uganda“. Thesis, 1999. http://hdl.handle.net/10413/6224.
Der volle Inhalt der Quelle
7
Bie, Elizabeth B. A. „A feasibility study of the control of adults of Heliothis spp. by drifting a cloud of monosized droplets across a cotton field at night“. Thesis, 1985. http://hdl.handle.net/2440/108817.
Der volle Inhalt der Quelle
8
Moloto, Kholofelo Caroline. „Evaluation of F3 segregation cowpea (Vigna unguiculata) population developed from insect-mediated crosses“. Thesis, 2019. http://hdl.handle.net/10386/2948.
Der volle Inhalt der QuelleAnnotation:
Thesis (M.Sc. Agriculture (Agronomy) -- University of Limpopo, 2019Erratic rainfall and insect infestation are some of the factors that limit cowpea production in Limpopo (Asiwe, 2009). Improved cowpea varieties available for dryland production in Limpopo do not meet the farmer’s needs. Specific trait crosses are needed to be made with adapted varieties for the purpose of developing high yielding, pest tolerant and adapted varieties. Varieties with desired specific traits were planted in isolation plots for outcrossing by insects. F1 lines derived from parental lines that were half sib seeds were harvested and planted as F2, and seeds obtained from F2 generation were used to develop F3 segregating population at University of Limpopo Experiential Farm, Syferkuil, and planted along with parents. This F3 generation forms the current evaluation on which this report is based. Data collected included; aphid severity (measured on a 9-point scale), number of days to 90 % maturity, grain yield, 100 seed weight and number of genotypes selected for advancement. Results showed significant variation among progeny over parents therefore expressing transgressive segregation. Genotypes derived from pedigree TX08-30-5 were five while pedigree IT98K-205-8 and IT97K-499-35 had four genotypes each that expressed early maturity (80-90 days) which are desirable for evading drought. Twenty-three genotypes from pedigree GEC and three from pedigree IT97K-499-35 obtained grain yield (>101 g/plot and >161 g/plot) that was better than their parents. Only one genotype derived from pedigree TX08-30-1 expressed high resistance to aphids better than the parent with a mean aphid score range of 1-2. Four genotypes from pedigree TX08-30-5 obtained bigger 100 seed weight (>18.6 g) compared to parent. These progeny also proved to be high yielders as they expressed heterosis for all yield attributes than their parents. Eighty-two genotypes were selected for advancement. Significant variations were observed among progeny giving opportunity to make selections. In most cases, genotypes outperformed their parents which indicate positive heterosis. The 82 promising genotypes selected will be advanced for further selections from multi location testing for stability and adaptation.
9
Gatarayiha, Mutimura Celestin. „Biological control of the two-spotted spider mite, Tetranychus urticae Koch (Acari : tetranychidae)“. Thesis, 2009. http://hdl.handle.net/10413/650.
Der volle Inhalt der QuelleAnnotation:
The two-spotted spider mite (TSM), Tetranychus urticae Koch, is an important pest of many greenhouse and field crops worldwide. The development of resistance in TSM populations to chemical acaricides, allied with public health concerns about pesticide residues, has motivated the search for alternative control measures to suppress the pest. Hyphomycetous fungi are promising agents for mite control and the fungus Beauveria bassiana (Bb) (Balsamo) Vuillemin was investigated in this study as a biocontrol agent. The principal objectives of this study comprised: a) screening Bb strains for their pathogenicity against T. urticae; b) testing the effect of adjuvants on the efficacy of Bb; c) studying the effect of plant type on persistence of Bb and the efficacy of control of Bb against T. urticae; d) evaluating the field efficacy of Bb applications against T. urticae; e) testing the compatibility of Bb with selected fungicides; and f) assessing the synergy between Bb and soluble silicon for T. urticae control. Screening bioassays of sixty-two strains of Bb identified the two most effective strains, PPRI 7315 (R289) and PPRI 7861 (R444), that caused mortality levels of more than 80% of adult mites at 9 d post-inoculation with 2 × 108 conidia ml-1. These strains performed significantly better than the Bb commercial strain PPRI 5339, in laboratory bioassays. The two strains also attacked mite eggs, causing 53.4% and 55.5% reduction in egg hatchability at 2 × 108 conidia ml-1 respectively. However, PPRI 7861 showed relatively higher production of conidia in culture and was, therefore, selected for further trials under greenhouse and field conditions. Greenhouse evaluations of the effects of two adjuvants (Break-thru® and a paraffin oil-based emulsion) on efficacy of Bb demonstrated a higher efficacy of the biocontrol agent (BCA) when it was applied with Break-thru® or the oil solution than with water alone. Moreover, Bb conidia applied in Break-thru® solution resulted in greater control of TSM than conidia applied in the mineral oil. There was also a dose-response effect and the control of TSM by Bb increased when the concentration of conidia was increased. The control of TSM by Bb in beans (Phaseolus vulgaris L), cucumber (Cucumis sativus L.), eggplant (Solanum melongena L.), maize (Zea mays L.) and tomato (Solanum lycopersicum L.) was tested in greenhouse trials. On these crops, the persistence of conidia declined over time. The rate of decline was significantly higher on maize. However, TSM mortality was positively correlated with the amount of conidia deposited on leaves immediately after spraying, rather than their persistence over time. Higher levels of mortality of TSM due to Bb application were observed on beans, cucumber and eggplants, suggesting that the type of crop must be taken into consideration when Bb is applied as a BCA. Field efficacy of Bb against mites was evaluated in two trials on eggplants. Based on assessment of population densities of mites and leaf damage assessments; both trials showed that the strain PPRI 7861 controlled TSM in the field. Two commonly used fungicides, azoxystrobin and flutriafol, were investigated in vitro tests on culture medium and laboratory bioassays on detached bean leaves (Phaseolus vulgaris L.) for their effects on Bb. Azoxystrobin (a strobilurin) was less harmful to Bb while flutriafol was found to be inhibitory. Another important finding of this study was the substantial enhancement of Bb efficacy by soluble silicon. When Bb was combined with soluble Si, the control of TSM was better than when either of the two products was applied alone. Moreover, application of soluble Si as a plant fertilizer in hydroponic water nutrient increased accumulation of peroxidase, polyphenoloxidase and phenylalanine ammonia-lyase enzymes in leaves of plants infested with TSM. Increased activity of these defense enzymes in leaves deters feeding behaviour of mites. We suggested that feeding stress renders them susceptible to Bb infection, which would explain the synergy observed between the two agents.Thesis (Ph.D.)-University of KwaZulu-Natal, Pietermaritzburg, 2009.
Bücher zum Thema "Field crops Diseases and pests Australia"
1
Persley, Denis. Diseases of vegetable crops in Australia. Herausgegeben von CSIRO (Australia) und Queensland. Dept. of Primary Industries and Fisheries. Collingwood, Vic: CSIRO Publishing, 2010.
Den vollen Inhalt der Quelle finden
2
Mueller, Daren, Kiersten A. Wise, Nicholas S. Dufault, Carl Alan Bradley und Martin I. Chilvers. Fungicides for field crops. St. Paul, Minnesota: APS Press, The American Phytopathololgical Society, 2013.
Den vollen Inhalt der Quelle finden
3
Hill, D. S. Pests and diseases of tropical crops: Field handbook. Harlow: Longman, 1990.
Den vollen Inhalt der Quelle finden
4
F, Nyvall Robert, Hrsg. Field crop diseases. 3. Aufl. Ames: Iowa State University Press, 1999.
Den vollen Inhalt der Quelle finden
5
Bajwa, Waheed Ibrahim. Pest management of major field crops. Islamabad: Agricultural Development Bank of Pakistan, 1988.
Den vollen Inhalt der Quelle finden
6
Bailey, Peter. Pests of field crops and pastures: Identification and control. Collingwood, VIC: CSIRO Pub., 2007.
Den vollen Inhalt der Quelle finden
7
Withers, J. A. Northern Ireland arable crops 2002. Belfast: Department of Agriculture and Rural Development, 2002.
Den vollen Inhalt der Quelle finden
8
Withers, J. A. Northern Ireland arable crops 2000. Belfast: Department of Agriculture and Rural Development, 2000.
Den vollen Inhalt der Quelle finden
9
Beating the bugs: Protecting Victoria's economically significant crops from pests and diseases. Melbourne: Govt. Printer, 2004.
Den vollen Inhalt der Quelle finden
10
University of Illinois at Urbana-Champaign. Cooperative Extension Service. Condensed plant disease management: Guide for field crops. [Urbana, Ill.]: University of Illinois at Urbana-Champaign, College of Agriculture, Cooperative Extension Service, 1989.
Den vollen Inhalt der Quelle findenBuchteile zum Thema "Field crops Diseases and pests Australia"
1
Cortada, Laura. „Technologies for integrated nematode management in smallholder farming systems: no one-size-fits-all.“ In Integrated nematode management: state-of-the-art and visions for the future, 457–62. Wallingford: CABI, 2021. http://dx.doi.org/10.1079/9781789247541.0063.
Der volle Inhalt der QuelleAnnotation:
Abstract In this chapter, the need to take a more critical look at the highly precarious and vulnerable situation of smallholder farming systems, the predominant type of the agricultural output worldwide, is emphasized. These farmers represent 98% of the farmers in the world that sustain the local production of staple crops such as rice, maize, cassava, groundnut and millet. Although there is some disparity in the figures, recent data estimates that there are between 380 and 500 million smallholder farming households globally. The productivity of the smallholders' farms depends on soil health and quality, agroecological conditions (irrigated versus rainfed), access to agricultural inputs and new technologies. These last two also critically influence smallholders' ability to manage pests and diseases, including plant parasitic nematodes (PPN). This chapter discusses the epidemiological perspective, diagnostics and surveillance, alternate host and in-field spread of PPN. Breeding programmes for PPN resistance, seed delivery system, importance of clean planting material, influence of land availability to smallholders' ability to practice fallow and rotation for nematode management are described. The use of trap crops, cover crops, nematicides and biological control agents for nematode suppression are also discussed. Future developments aimed at promoting the progress of smallholder farming systems are also mentioned.
2
McEwan, Margaret A., Tom A. van Mourik, Mihiretu C. Hundayehu, Frezer Asfaw, Sam Namanda, Issahaq Suleman, Sarah Mayanja, Simon Imoro und Prince M. Etwire. „Securing Sweetpotato Planting Material for Farmers in Dryland Africa: Gender-Responsive Communication Approaches to Scale Triple S“. In Root, Tuber and Banana Food System Innovations, 353–88. Cham: Springer International Publishing, 2022. http://dx.doi.org/10.1007/978-3-030-92022-7_12.
Der volle Inhalt der QuelleAnnotation:
AbstractTriple S (Storage in Sand and Sprouting) is a root-based system for conserving and multiplying sweetpotato planting material at the household level. In sub-Saharan Africa, farmers predominantly source planting material by cutting vines from volunteer plants that sprout from roots left in the field from a previous crop. However, it takes 6 to 8 weeks after the rains start to produce enough vines for planting material, and normally these vines are infected by sweetpotato diseases and pests carried over from previous crops. Where rainfall is unpredictable, farmers can use Triple S to take advantage of the whole growing season, planting and harvesting early to obtain food, higher yields, and income. Triple S facilitates household retention and adoption of new sweetpotato varieties, notably the beta-carotene-rich, orange-fleshed varieties. Triple S PLUS is the combined innovation package of core Triple S components and complementary components used to scale the innovation. These included good agricultural practices, different storage containers, local multiplication and sales of planting material, and a multimedia communication strategy for training and extension to encourage the uptake of Triple S. Components were at different levels of scaling readiness. This chapter explores evidence from Ethiopia and Ghana (2018–2019) on the extent to which exposure to different communication channels and their combinations influenced the uptake of Triple S PLUS by male and female farmers, the partnering arrangements that supported this, and the resulting changes in food security. We discuss implications for future scaling initiatives.
3
James Grichar, William, Peter A. Dotray und Derald Ray Langham. „Effects of Harvest Aids on Sesame (Sesamum indicum L.) Drydown and Maturity“. In Pests, Weeds and Diseases in Agricultural Crop and Animal Husbandry Production. IntechOpen, 2020. http://dx.doi.org/10.5772/intechopen.91011.
Der volle Inhalt der QuelleAnnotation:
Harvest aids are traditionally used to desiccate weeds to improve crop quality and harvest efficiency. Field studies were conducted in Texas to determine the effect of harvest aids (glyphosate, diquat-dibromide, glufosinate-ammonium, and carfentrazone-ethyl) on sesame drydown and yield. The objective was to identify one or more harvest aids that could (1) accelerate drydown, (2) burn-down green weeds, (3) even up a field with varying levels of drydown, (4) stop regrowth, (5) stop vivipary, and (6) prepare to plant a new crop. Other than diquat-dibromide, the herbicides were chosen based on the effect on weeds in other crops. The plan was to apply the herbicides 1 week before physiological maturity (PM), at PM, and 1 week after PM. However, sesame maturity is very sensitive to ground moisture, ambient temperature, and relative humidity. The weather was different in all trials and some stages could not be completed. In two cases, the trials had to be abandoned; however, certain patterns emerged. All the herbicides accelerated drydown compared to the untreated check. Diquat-dibromide and glufosinate-ammonium dried sesame faster than glyphosate and carfentrazone-ethyl. The higher rates of the herbicide dried down the sesame faster than the low rate. Although there were some differences in yields across the three application periods, there was no consistent pattern.
4
Kankam, Frederick, Stephen Larbi-Koranteng, Joseph Adomako, Joseph Kwowura Kwodaga, Isaac Boatey Akpatsu, Yaw Danso und Elias Nortaa Kunedeb Sowley. „Anthracnose Disease of Mango: Epidemiology, Impact and Management Options“. In Current and Emerging Challenges in the Diseases of Trees [Working Title]. IntechOpen, 2022. http://dx.doi.org/10.5772/intechopen.105934.
Der volle Inhalt der QuelleAnnotation:
Mango is one of the frequently cultivated seasonal fruit crops in several tropical and subtropical regions. It is consumed as whole fruits apart from serving as raw materials for most industries that are into mineral production. Mango production is, however, constrained by diseases, pests, and poor post-harvest handling of fruits. Anthracnose disease, caused by Colletotrichum gloeosporioides Penz and Sacc, is one of the most important yields limiting constraint in mango production across the globe. The disease occurs in both the field and post-harvesting. In the field, it affects aboveground parts, such as the stem, branches, leaves, flowers, and fruits. Anthracnose disease reduces the shelve life and marketability of mango fruit. In Ghana, anthracnose disease is responsible for about 30% yield/fruit loss. Most farmers do not control it, although some have resorted to the application of various fungicides not registered for mango anthracnose disease management in Ghana. This chapter will highlight on the importance of the disease on the mango industry in Ghana, control strategies currently employed thereby reducing the over-reliance on chemical control option and propose ways to minimize the effect of the disease in the country.
5
Das, Kallol, Pijush Kanti Jhan, Srijan Chandra Das, F. M. Aminuzzaman und Benjamin Yaw Ayim. „Nanotechnology: Past, Present and Future Prospects in Crop Protection“. In Technology in Agriculture [Working Title]. IntechOpen, 2021. http://dx.doi.org/10.5772/intechopen.98703.
Der volle Inhalt der QuelleAnnotation:
Nanotechnology is an advanced and evolving discipline in the field of science and technology with various applications in other fields such as the life sciences, and is increasingly important in the plant sciences as well. It is estimated that 20–40% of crops are lost each year due to plant pests and pathogens. The current plant disease management, which primarily relies on toxic pesticides that may be harmful to humans and the environment, has the benefit of utilizing nanotechnology. It has capabilities in determining the outbreak of an epidemic as well as diagnosing different types of diseases. It can also distinguish between similar microbes like bacteria, fungi, viruses, complex genomic portions, and how two versions of genes on an individual chromosome differ. This chapter will cover the plant disease management implementation of this technology.
6
N. Kushanov, Fakhriddin, Ozod S. Turaev, Oybek A. Muhammadiyev, Ramziddin F. Umarov, Nargiza M. Rakhimova und Noilabonu N. Mamadaliyeva. „Maize (Zea mays L.) as a Model System for Plant Genetic, Genomic, and Applied Research“. In Model Organisms in Plant Genetics. IntechOpen, 2022. http://dx.doi.org/10.5772/intechopen.104658.
Der volle Inhalt der QuelleAnnotation:
Maize leads the world’s cereals after wheat and rice in terms of cultivated area, because of its economic importance for the production of both food purposes and raw materials for industry. The maize genus Zea L. belonging to the family of cereals (Poaceae or Graminaceae) includes six species. However, all cultivated maize belongs specifically to Zea mays L. subsp. mays (2n = 2× = 20) is the only cultivated species of the genus Zea L., and the remaining species of this genus are mostly wild herbaceous plants. In addition to meeting the nutritional needs of the world’s population, Zea mays L. is one of the classic model objects of genetic and physiological research, as well as in the field of breeding not only cereals but also other important agricultural plants. Especially, this model object has been used in genetic mapping of loci of quantitative traits and genes associated with economically valuable traits, such as yield, resistance to diseases and pests, grain quality, etc. in cereal crops.
Konferenzberichte zum Thema "Field crops Diseases and pests Australia"
1
Corneanu, Mihaela, Cornelia Buzatu-Goanta und Constantin Netoiu. „Quantitative characters variability and diseases / pests’ tolerance of some of Salix SP. Accessions“. In VIIth International Scientific Conference “Genetics, Physiology and Plant Breeding”. Institute of Genetics, Physiology and Plant Protection, Republic of Moldova, 2021. http://dx.doi.org/10.53040/gppb7.2021.99.
Der volle Inhalt der QuelleAnnotation:
The oil crisis of the last decades of the twentieth century has led researchers to turn their attention to alternative sources of energy, the so-called green energy. One of the genres intensively studied for bi-omass production was the genus Salix. In Europe, in Sweden, were made the first Salix hybrids for short-rotation crops (SRC). Willows are used for wood plantation, cellulose and paper production, in pharma-ceutical industry, for soil phytoremediation, like pioneer species by their role in ecosystem restoration, increasing biodiversity and for biomass production (Berg, 2002). In Romania, willow SRC for biomass production started after 2005. There are about 1500 ha of willow SRC, 400 ha of them are in Banat area. All of these cultures were established with Swedish clones, especially clone Inger. Swedish clones and hybrids registered good results in Sweden and North-West Europe countries with cool, wet climate, but in Romania they have not achieved spectacular results in some areas, such as North-Est Timis county and Oltenia area, the crops being compromised in the first years. In the view of the extension of cultivated areas unsuitable for agriculture, with forestry and energy crops, there are necessary comprehensive studies to find optimal solutions - selection of genotypes to their potential production, but also to be adapted at temperatures over 35ºC and severe drought. A willow breeding program for the biomass production has to be started and a potential genitors collection (local germplasm) sets the stage for the beginning of a science-based breeding program. The collection of potential genitors (39 genotypes, 12 species) was established in the spring of 2015 on the territory of the Experimental Didactical Station belonging to Banat’s University of Agricul-tural Sciences and Veterinary Medicine from Timisoara. The biological material (46 cuttings for each genotype) was planted in double rows 75 cm apart with double rows spaced at 150 cm and an 80 cm in-row spacing. During the growing season was made chemical and mechanical weed control. There were not applied phytosanitary treatments, in order to test the natural resistance of the genotypes. The sprouting capacity and biometric observations were made in an experimental trial with uncut and cutback shoots and biomass was estimated. Following the biometric observations performed biannually and the evaluation of tolerance / re-sistance to diseases and pests, a wide variability was noticed, both interspecific and intraspecific. The quantitative traits varied significantly with genotype and management practice. Large variability was ob-served in terms of survival rate but also in sprouting capacity, maximum height, and diameter. The field trial recommends some genotypes with particularly high production, clone 30 Salix pentandra L. and clone 31 S. triandra L. for crops with short rotation cycle, both in normal soil and climatic conditions and on degraded lands. The most tolerant genotypes both to pests and diseases were belonging to S. rosmarinifolia and S. pentandra. The most sensitive species include genitors from S. fragilis, S.alba and S.purpurea. Tolerance to pests and diseases was dependent on species and origin.
2
Tkalenko, A., und Vasily Khodorchuk. „The use of biological preparations in fruit and vegetable agrocenoses“. In International Scientific Symposium "Plant Protection – Achievements and Prospects". Institute of Genetics, Physiology and Plant Protection, Republic of Moldova, 2020. http://dx.doi.org/10.53040/9789975347204.36.
Der volle Inhalt der QuelleAnnotation:
The results of many years of research in the field of the biological method of protecting vegetable and fruit crops from pests and diseases, carried out at the Institute of Plant Protection and ITI "Biotekhnika" NAAS, are presented. The optimal norms, terms, sequence and frequency of their application in agrocenoses of fruit and vegetable crops of open and closed ground have been determined.
3
PIMOKHOVA, Lyudmila, German YaGOVENKO, Zhanna TSARAPNEVA und Nina Kharaborkina. „Impact of efficient protective chemicals on seeds yield of white lupin“. In Multifunctional adaptive feed production 27 (75). ru: Federal Williams Research Center of Forage Production and Agroecology, 2022. http://dx.doi.org/10.33814/mak-2022-27-75-65-72.
Der volle Inhalt der QuelleAnnotation:
The white lupin is a source for qualitative plant protein to provide balanced nutrition for animals and poultry. Seed and green mass yield of modern lupin varieties can be 3–5 t/ha and 70–120 t/ha respectively. In spite of valuable qualities the production crop use is insufficient. One of the reasons is infection by diseases and pests. Anthracnose is the main dangerous and harmfulness disease. As a result lupin is in dire need for high effective protective chemicals. High effectiveness (97–96%) of seed dressers Vitaros – 2.0 l/t, Maxim XL – 2.0 l/t, Divident Star – 0.5 l/t, Selest Top – 0.7 l/t, Inshurperform – 0.7 l/t was revealed against seeds’ infection with anthracnose and other diseases under field conditions. The fungicides Amistar Extra – 0.5 l/ha, Spirit – 0.7 l/ha, Rakurs – 0.4 l/ha, Kolosal Pro – 0.4 l/ha, Bamper Super – 1.5 l/ha and Zantara – 1.5 l/ha are of high effectiveness (88–93%) for protection of lupin crops. The insecticides Tabu – 0.4 l/t and Selest Top – 07 l/t were high effective (76.2–96.0%) against seedlings pests. The most effective dressers (91–96%) against aphids and weevils were the chemicals BI-58 New – 0.7 l/ha and Borey Neo – 0.2 l/ha. The use of the mentioned chemicals for white lupin protection allows manage development and harmfulness level of harmful organisms in crops and prevent significant grain yield losses.
4
Iurcu-Straistaru, Elena, Nicola Sasanelli, Ion Toderas, Alexei Bivol, Vasile Maticiuc, Stefan Rusu und Cristina Andoni. „Investigations on invasive nematodes associated with complex insect pests from soil in corn in the environmental conditions of the Republic of Moldova“. In Xth International Conference of Zoologists. Institute of Zoology, Republic of Moldova, 2021. http://dx.doi.org/10.53937/icz10.2021.36.
Der volle Inhalt der QuelleAnnotation:
Corn is one of the major technical field crops in the Republic of Moldova, advantageous in bioecological and productive aspects, which is invaded annually by the harmful organisms with considerable parasitic impact. The phytosanitary control results, carried out annually and seasonally, comparatively in the corn plantations, notice a significant diversity of the specific diseases and of the invasive insects that seriously affect the plants from the germination phases until the harvest. In corn, were established the numerical density values (D. n.), comparative in different ecological areas, on average 15-280 (ex. /100 g soil), with an abundance by 5-25% higher in the autumn than in the spring. Phytoparasitic impact indices the frequency (F %) and intensity (I %) of the phytohelminthological disease level was estimated, being more advanced by 3-30% in the spring-summer period, observed differently depending on the area compared to the autumn period. The structure of parasitic phytonematode complexes was determined counting 20 species, included in 8 families and one order (Tylenchida), classified according to trophic specialization, with the predominance of endo-ectoparasites. It was established the diversity of the associated invasive insect species from the soil: 12 species, 8 families, 3 orders, also, with invasive ectoparasitic impact on corn plants, with the disease degree of 5-40%, detected in all phases of vegetation and sectors investigated.