Einloggen

Thematische Bibliographien / Citrus / Zeitschriftenartikel

Um die anderen Arten von Veröffentlichungen zu diesem Thema anzuzeigen, folgen Sie diesem Link: Citrus.

Zeitschriftenartikel zum Thema „Citrus“

Autor: Grafiati

Veröffentlicht am 4. Juni 2021

Zuletzt aktualisiert am 31. Juli 2024

Geben Sie eine Quelle nach APA, MLA, Chicago, Harvard und anderen Zitierweisen an

Wählen Sie eine Art der Quelle aus:

Machen Sie sich mit Top-50 Zeitschriftenartikel für die Forschung zum Thema "Citrus" bekannt.

Neben jedem Werk im Literaturverzeichnis ist die Option "Zur Bibliographie hinzufügen" verfügbar. Nutzen Sie sie, wird Ihre bibliographische Angabe des gewählten Werkes nach der nötigen Zitierweise (APA, MLA, Harvard, Chicago, Vancouver usw.) automatisch gestaltet.

Sie können auch den vollen Text der wissenschaftlichen Publikation im PDF-Format herunterladen und eine Online-Annotation der Arbeit lesen, wenn die relevanten Parameter in den Metadaten verfügbar sind.

Sehen Sie die Zeitschriftenartikel für verschiedene Spezialgebieten durch und erstellen Sie Ihre Bibliographie auf korrekte Weise.

1

Sulaymonov, Otabek Abdushukurovich, Guzal Tulaganovna Dusmurodova und Bekzod Bekmurod Ugli Sobirov. „STUDYING THE EFFICACY OF ALLCHUNGKILL CYC.K. AGAINST CITRUS CITRUS WHITEFLY (DIALEURODES CITRI ASHM.) IN CULTURE LEMON“. American Journal of Agriculture and Biomedical Engineering 04, Nr. 05 (01.05.2022): 22–25. http://dx.doi.org/10.37547/tajabe/volume04issue05-07.

Der volle Inhalt der Quelle

Annotation:

This article provides data on the harmfulness, distribution and lifestyle of citrus citrus whitefly , which in recent years has been a harmful object in our republic. In order to determine the effectiveness of insecticides against citrus citrus The whitefly first introduced observational work based on lemon pheromones . On this basis, in three variants, tests were carried out on Allchungkill preparations. cyc .to . 0.35 - 0.4 l / ha . , (reference) Emaben, 5% SDG . 0.4 kg/ha. The highest efficiency was observed in the variant where Allchungkill was used. cyc .to . 0.35 - 0.4 l / ha . In this variant, the efficiency was 7-day 86.1-87.7% .

APA, Harvard, Vancouver, ISO und andere Zitierweisen

2

Applequist, Wendy. „Citrus. The Genus Citrus“. Economic Botany 58, Nr. 4 (Dezember 2004): 749. http://dx.doi.org/10.1663/0013-0001(2004)058[0749:bredfa]2.0.co;2.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

3

Brandão, Henrique Cardoso Batista, Ana Laura Santos Anjos, Cristiane de Jesus Barbosa, Walter dos Santos Soares Filho und Alessandra Selbach Schnadelbach. „Porta-enxertos híbridos de citros tolerantes ao Citrus tristeza vírus (CTV) / Hybrid Citrus Rootstocks Tolerant to Citrus Tristeza Virus (CTV)“. Brazilian Journal of Animal and Environmental Research 4, Nr. 2 (25.06.2021): 2714–16. http://dx.doi.org/10.34188/bjaerv4n2-093.

Der volle Inhalt der Quelle

Annotation:

A citricultura brasileira lidera o mercado de exportação mundial. A tristeza dos citros é uma doença endêmica causada pelo Citrus tristeza virus (CTV), que é transmitido pelo pulgão preto dos citros, Toxoptera citricida (Kirkaldy). O controle da tristeza é feito, principalmente, pela utilização de porta-enxertos tolerantes ao CTV. Este trabalho teve como objetivo avaliar o comportamento de 50 híbridos de porta-enxerto de citros, gerados pelo Programa de Melhoramento Genético de Citros da Embrapa Mandioca e Fruticultura, quanto à infecção natural pelo CTV. Amostras de cada híbrido foram coletadas no campo experimental e casas teladas da Embrapa em Cruz das Almas. A mostra estava composta por 10 ramos novos, coletados em diferentes quadrantes da planta, que foram avaliados quanto à presença de caneluras por escala de notas: 1. Ausência de caneluras; 2. Presença de caneluras esparsas; 3. Número intermediário de caneluras; 4. Várias caneluras superficiais ou poucas caneluras profundas; 5. Toda a superfície do ramo coberta por caneluras superficiais ou profundas. A avaliação da infecção pelo CTV foi realizada no Laboratório de Biologia Molecular do Campo Avançado da Embrapa no CETAB/Seagri-BA. As amostras inicialmente foram avaliadas por sorologia, utilizando a técnica de ELISA indireto, com antissoro policlonal contra o CTV. Entretanto, as amostras que apresentaram resultados negativos no teste sorológico, foram também avaliadas por RT-PCR. Para tanto, foi realizada a extração de dsRNA a partir da casca de ramos de cada amostra. A extração de dsRNA foi feita com nitrogênio líquido e o precipitado final foi ressuspendindo em 50ul de água livre de RNAse, tratados com DNAse (Promega®). Na reação de transcrição reversa (RT) foi utilizada a enzima M-MLV (Promega®), de acordo com as recomendações do fabricante. Utilizou-se nessa etapa 5ul do dsRNA obtido, primer randômico (250ng/ul), dNTP (10mM), tampão M-MLV, RNase out e M- MLV, totalizando um volume de 25ul. Para PCR, utilizou-se 3ul do DNA obtido na RT, dNTP (2,5mM), tampão Tris/KCl (10x), MgCl2 (50mM), Taq polimerase (5U/ul) e os primers específicos para o CTV F- CN119 (5’ AGATCTACCATGGACGACGAAACAAAG3’) e R-CN120 (5’ GAATTCGCGGCCGCTCAACGTGTGTTAAATTTCC 3’), para um volume final de 25ul. O ciclo de reação adotado foi de 94°C/2min, 55°C/30seg e 72°C/1min, respectivamente. A maioria dos híbridos avaliados foi suscetível ao CTV, mas não desenvolveram os sintomas de canelura, sendo considerados tolerantes ao patógeno. Significado e impacto do trabalho: Apesar de atualmente controlada, a tristeza dos citros constitui ainda uma ameaça aos produtores de citros, já que é endêmica no Brasil. Diante desse fato, a avaliação do comportamento de híbridos gerados pelo Programa de Melhoramento Genético de Citros da Embrapa em relação ao CTV, é uma etapa determinante na seleção de novas variedades.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

4

Nafisah, Sarah Nur, Suharno Suharno und Netti Tinaprilla. „SIKAP DAN PERSEPSI KONSUMEN TERHADAP JERUK LOKAL DAN JERUK IMPOR DI PASAR MODERN KOTA BOGOR“. Forum Agribisnis 4, Nr. 1 (01.03.2014): 71–84. http://dx.doi.org/10.29244/fagb.4.1.71-84.

Der volle Inhalt der Quelle

Annotation:

The trends within citrus consumption have shifted from consumption of local citrus to the imported citrus. The present research investigates th econsumer characteristics of citrus, the consumer purchasing decision process, and consumer attitude and perception towards local citruss and imported citruss. Adopting purposive sampling technique, 100 respondents were chosen among the population of citrus consumers in modern market in Bogor. The data was analyzed with descriptive analysis, multi attribute Fishbein model, and perceptual mapping. The results showed that the majority of consumers were productive age female ranging from 27 to 34 years, married, bachelor degree, housewife with 3-4 family members, and with more than Rp 4.000.000 income per month. For both citrus, taste and freshness are the most important attributes Local citrus’s attributes such as taste, size, juicy, availability, appearance, freshness, the level of maturity, and the texture of pulp, were believed as a good attribute. Meanwhile for imported citrus, the juicyness, appearance, freshness, the level of maturity, the texture of pulp,andthesalespromotion, were believedto be agoodattribute. The price of bothlocal citrus and imported citruswas not believed as a good attribute. The score of consumer attitude and perception toward local citrus were higher than that of imported citrus. This shows that generally the local citrus’ attribute in modern market Bogor City was perceived as good by the consumers. Due to that the local citrus agribusiness actors needs to maintain and improve the performance of local citrus’attribute in such a way that the consumer prefer local citrus than imported citrus.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

5

Burrow, Jamie D., und Ariel Singerman. „Children's Citrus Activity: Citrus Counting“. EDIS 2019, Nr. 4 (22.07.2019): 1. http://dx.doi.org/10.32473/edis-4h402-2019.

Der volle Inhalt der Quelle

Annotation:

Florida is well known for its citrus industry, valued at over eight billion dollars, and is one of the top citrus-producing states in the United States. This new one-page children’s activity sheet about Florida citrus includes an activity for students learning to count and match. Written by Jamie D. Burrow and Ariel Singerman and published by the UF/IFAS Extension 4-H Youth Development Program. https://edis.ifas.ufl.edu/4h402

APA, Harvard, Vancouver, ISO und andere Zitierweisen

6

Ozaki, Yoshihiko, Masaki Miyake, Hisao Maeda, Yasushi Ifuku, Raymond D. Bennett, Zareb Herman, Chi H. Fong und Shin Hasegawa. „Ichangensin glucoside in Citrus junos, Citrus sudachi and Citrus sphaerocarpa“. Phytochemistry 30, Nr. 8 (Januar 1991): 2659–61. http://dx.doi.org/10.1016/0031-9422(91)85118-j.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

7

Ifmalinda, Ifmalinda, Khandra Fahmy und Elsa Fitria. „Prediction of Siam Gunung Omeh Citrus Fruit (Citrus Nobilis Var Microcarpa) Maturity Using Image Processing“. Jurnal Keteknikan Pertanian 6, Nr. 3 (01.12.2018): 335–42. http://dx.doi.org/10.19028/jtep.06.3.335-342.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

8

E.B. „Citrus“. Encyclopédie berbère, Nr. 13 (01.02.1994): 2027–28. http://dx.doi.org/10.4000/encyclopedieberbere.2311.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

9

Kender, Walter J. „Citrus“. HortScience 38, Nr. 5 (August 2003): 1043–47. http://dx.doi.org/10.21273/hortsci.38.5.1043.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

10

Bower, J. P. „Citrus“. Scientia Horticulturae 62, Nr. 1-2 (April 1995): 147–48. http://dx.doi.org/10.1016/0304-4238(95)90014-4.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

11

French, J. Victor, und Santiago Villarreal. „Citrus Leafminer Control on Citrus, 1996“. Arthropod Management Tests 22, Nr. 1 (01.01.1997): 59–60. http://dx.doi.org/10.1093/amt/22.1.59a.

Der volle Inhalt der Quelle

Annotation:

Abstract Micromite, Alert and Provado were compared with the standard treatment Agri-Mek + NR 435 Oil for efficacy against CLM. Treatments were randomized and replicated 4 times on single tree plots in a 3-yr-old grapefruit orchard on 18 X 24 ft spacing. Trees were sprayed to foliar runoff on 12 Sep using a Hypro 5200 high pressure handgun sprayer operating at 200 psi. At each count date, 4 new flush terminals (each with 10-12 leaves) were randomly collected per replicate and taken to the laboratory. All live and dead CLM lst--4th stage larvae and pupae were counted on each terminal. The insects were recorded as dead by lack of movement and/or evidence of dessication when examined microscopically at 20 X. Percent mortality of all CLM immature stages was determined for each treatment.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

12

Burrow, Jamie D., und Lauren M. Diepenbrock. „Citrus Pest Quick Guide: Citrus Leafminer“. EDIS 2020, Nr. 2 (02.04.2020): 1. http://dx.doi.org/10.32473/edis-in1254-2020.

Der volle Inhalt der Quelle

Annotation:

A one-page quick guide written by Lauren M. Diepenbrock and Jamie D. Burrow and published by the Entomology and Nematology Department presents the life cycle of the citrus leafminer and provides several photos of the pest and the damage it causes to assist in identification. https://edis.ifas.ufl.edu/in1254

APA, Harvard, Vancouver, ISO und andere Zitierweisen

13

Richardson, Matthew L., Catherine J. Westbrook, David G. Hall, Ed Stover, Yong Ping Duan und Richard F. Lee. „Abundance of Citrus Leafminer Larvae on Citrus and Citrus-related Germplasm“. HortScience 46, Nr. 9 (September 2011): 1260–64. http://dx.doi.org/10.21273/hortsci.46.9.1260.

Der volle Inhalt der Quelle

Annotation:

The citrus leafminer, Phyllocnistis citrella Stainton (Lepidoptera: Gracillariidae), is a key pest in most citrus-growing regions worldwide. Adult citrus leafminers oviposit primarily on young elongating flush of Citrus as well as other Rutaceae and some ornamental plants. Larvae feed on the epidermal cell layer of developing leaves and injury to leaves provides a pathway for infection by the bacterium Xanthomonas citri subsp. citri (Hasse), the causal agent of Asiatic citrus canker. In this study, we quantified abundance of citrus leafminer larvae on progeny of 87 seed parent genotypes of Citrus and Citrus relatives (family Rutaceae) in the field in East–central Florida to identify those that have low abundance of leafminers. Progeny from the 87 parent genotypes varied in abundance of the leafminer. Progeny of 15 parent genotypes had a high mean abundance of more than six leafminers per flush shoot. All but one of these genotypes were in the Citrus genus. Progeny of 16 parent genotypes had zero, or nearly zero, leafminers, but none were from the Citrus genus. However, many of these 16 genotypes were from genera closely related to true citrus (subtribe Citrinae) and are sexually compatible with Citrus. Progeny of two parent genotypes in the subfamily Toddalioideae and Glycosmis pentaphylla (Retz.) Corr. also had a low abundance of leafminer. Glycosmis pentaphylla also is a poor host for the Asian citrus psyllid, Diaphorina citri Kuwayama, and has biochemical resistance to the citrus weevil, Diaprepes abbreviatus (L.), so this genotype as well as others identified as poor hosts for the leafminer may prove useful in breeding programs aimed at reducing the abundance of multiple insect pests on citrus.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

14

He, Yu, und Wenkuan Chen. „Evaluation of Sustainable Development Policy of Sichuan Citrus Industry in China Based on DEA–Malmquist Index and DID Model“. Sustainability 15, Nr. 5 (27.02.2023): 4260. http://dx.doi.org/10.3390/su15054260.

Der volle Inhalt der Quelle

Annotation:

The citrus industry is an important fruit industry, with the widest cultivation area and the most crucial economic status in southern China. Evaluating the sustainable development of citrus industry is the basis for accurately grasping the food safety situation and scientifically formulating industrial development policies. This research aims to evaluate the sustainable development policies of citrus industry in 20 citrus-growing cities and states in Sichuan province in China from two dimensions of efficiency and effect. To this end, this study develops a DEA–Malmquist index and DID model using city and state panel data from 2009–2020. The results have the following implications: (1) The low technical efficiency and technological progress index together cause the general inefficiency of citrus production in Sichuan cities and states, and the improper scale of inputs is the main reason for the low technical efficiency. (2) The implementation of sustainable development policies has increased citrus total factor productivity and widened the gap between cities and states in Sichuan. (3) Excessive production factors and financial inputs have hindered the sustainable development of the Sichuan citrus industry.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

15

Aslam, Kinza, Shahzad Zafar Iqbal, Ahmad Faizal Abdull Razis, Sunusi Usman und Nada Basheir Ali. „Patulin Contamination of Citrus Fruits from Punjab and Northern Pakistan and Estimation of Associated Dietary Intake“. International Journal of Environmental Research and Public Health 18, Nr. 5 (25.02.2021): 2270. http://dx.doi.org/10.3390/ijerph18052270.

Der volle Inhalt der Quelle

Annotation:

This research aims to assess the natural occurrence of patulin (PAT) in selected citrus fruits from central cities of Punjab and Pakistan’s northern cities. A total of 2970 fruit samples from 12 citrus cultivars were examined using liquid chromatography fitted with a UV detector. The detection limit (LOD) and quantification limit were 0.04 and 0.12 µg/kg, respectively. About 56% of samples of citrus fruits from Punjab’s central cities, Pakistan, were found to be contaminated with PAT, with values ranging from 0.12 to 1150 µg/kg in samples from central Punjab cities. Furthermore, 31.7% of samples of citrus fruits from northern cities of Pakistan were contaminated with PAT, with values ranging from 0.12 to 320 µg/kg. About 22.1% of citrus fruit samples had PAT levels greater than the suggested limits established by the European Union (EU). The dietary intake levels of PAT ranged from 0.10 to 1.11 µg/kg bw/day in the central cities of Punjab, Pakistan, and 0.13 to 1.93 µg/kg bw/day in the northern cities of Pakistan.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

16

Černi, S., D. Škorić und M. Krajačić. „Preliminary molecular characterization of some Citrus tristeza Closterovirus isolates infecting Croatian citrus“. Plant Protection Science 38, SI 2 - 6th Conf EFPP 2002 (31.12.2017): 264–66. http://dx.doi.org/10.17221/10460-pps.

Der volle Inhalt der Quelle

Annotation:

Citrus tristeza Closterovirus (CTV) is widespread in major citrus-growing regions of the world often causing destructive diseases. Citrus samples were taken from orchards in the Croatian coastal region. CTV was detected in two symptomless field trees of Satsuma mandarins and one diseased lemon tree. Double-stranded RNA was isolated from the field trees and the dsRNA patterns were compared in polyacrylamide gels. The same dsRNA extracts were used as templates in RT-PCR experiments amplifying the CTV coat protein sequence. Amplicons were subjected to SSCP and RFLP analyses. The results indicate greater similarity between CTV isolates from Satsuma mandarins than between these two and the lemon isolate.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

17

Yahya, Abdul-Halim, Gun-Hean Chong und Chin-Ping Tan. „The phytochemical properties of a new citrus hybrid (Citrus hystrix × Citrus microcarpa)“. ScienceAsia 40, Nr. 2 (2014): 121. http://dx.doi.org/10.2306/scienceasia1513-1874.2014.40.121.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

18

Ruberto, Giuseppe, Agatino Renda, Mario Piattelli, Paolo Rapisarda und Angelo Starrantino. „Essential Oil of Two New Pigmented Citrus Hybrids,Citrus clementina × Citrus sinensis“. Journal of Agricultural and Food Chemistry 45, Nr. 2 (Februar 1997): 467–71. http://dx.doi.org/10.1021/jf960109j.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

19

Bar-Joseph, M. „CITRUS VIROIDS AND CITRUS DWARFING IN ISRAEL“. Acta Horticulturae, Nr. 349 (Oktober 1993): 271–76. http://dx.doi.org/10.17660/actahortic.1993.349.45.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

20

Sottile, Francesco, Maria Beatrice Del Signore und Ettore Barone. „Ornacitrus: Citrus plants (Citrus spp.) as ornamentals“. Folia Horticulturae 31, Nr. 2 (01.12.2019): 239–51. http://dx.doi.org/10.2478/fhort-2019-0018.

Der volle Inhalt der Quelle

Annotation:

AbstractThe industrial production of citrus plants for ornamental use (ornacitrus) began in Italy at the end of the 1960s due to the need for many citrus nurseries to adapt their activities in a time of crisis for citriculture. Nowadays, the ornamental citrus nursery sector is a well-established industry in many European countries such as Portugal, Spain, Greece, and southern Italy. In Italy, nursery production of ornamental citrus plants has become prominent due to the gradual shutdown of many commercial citrus orchards. Currently, Italy maintains its leadership with more than 5.5 million ornacitrus plants produced annually. Ornamental citrus production regards mainly different cultivars of Citrus and Fortunella species, with lemon as the lead species. In this paper, the contribution of breeding and cultural techniques to the innovation of the sector is reported and discussed. This review aims to give an updated scientific and technical description of a sector with large competitive potential that remains still largely unexplored, pointing out its strengths and weaknesses.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

21

Story, R. N., und W. J. Bourgeois. „Citrus Red Mite Control on Citrus, 1984“. Insecticide and Acaricide Tests 10, Nr. 1 (01.01.1985): 52–53. http://dx.doi.org/10.1093/iat/10.1.52a.

Der volle Inhalt der Quelle

Annotation:

Abstract The study was conducted on a plot of recently transplanted trees located at the LSU Citrus Research Station, Port Sulpher, LA. A randomized complete block design was used with 4 replications per treatment (individual trees served as plots). Pesticides were applied on 10 Oct ’84 with a hand-held CO2 pressurized sprayer delivering 0.5 liter per tree at 40 psi through a single spray nozzle containing a D-3 disc, No. 25 core, and 16 mesh strainer. Trees were sprayed until completely covered. Although only 50 liters of pesticide was applied per acre, pesticide concentrations were calculated at a rate of 378 liter per acre so as to simulate concentrations used for a mature stand. Evaluations were made on 19 Oct and 13 Nov by randomly selecting 10 leaves per tree as follows: 2 leaves from each of the 4 compass directions and 2 from the center of the tree. Leaves were taken to the lab, examined under a stereo-microscope, and the number of mites recorded.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

22

Story, R. N., und W. J. Bourgeois. „Citrus Red Mite Control on Citrus, 1983“. Insecticide and Acaricide Tests 10, Nr. 1 (01.01.1985): 52. http://dx.doi.org/10.1093/iat/10.1.52.

Der volle Inhalt der Quelle

Annotation:

Abstract The study was conducted on mature trees located at the LSU Citrus Research Station, Port Sulpher, LA. A randomized complete block design was used with 4 replications per treatment (individual trees served as plots). Each plot was surrounded by 4 untreated trees to serve as a buffer between treatments. Pesticides were applied on 15 Jun ’83 with a FMC Speed Sprayer operated at 1200 RPM and 250 psi and a 4 nozzle hand gun. Trees were sprayed until runoff (approx 2.5 gal/tree). Evaluations were made on 29 Jun and 13 Jul by randomly selecting 10 leaves per tree as follows: 2 leaves from each of the 4 compass directions and 2 from the center of the tree. Leaves were taken to the lab, examined under a stereo-microscope, and the number of mites recorded.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

23

McCoy, C. W., J. Fojtik und B. H. Lye. „Citrus Root Weevil Control on Citrus, 1988“. Insecticide and Acaricide Tests 14, Nr. 1 (01.01.1989): 82–83. http://dx.doi.org/10.1093/iat/14.1.82a.

Der volle Inhalt der Quelle

Annotation:

Abstract The experiment was conducted with a completely randomized block design of 2 trees/plot and was replicated 4 times. All treatments were applied with a John Bean sprayer at 300 psi to run-off. Wild adult weevils collected from the adjacent plantings were placed in screen limb bags (5 weevils/bag) which were attached to treated leaf terminals and secured to prevent escape. Two limb bags were attached to each tree, and adult mortality (residual control data) was recorded and a new cohort of weevils was placed in each bag at 1, 2, 3, 4, 6, 7, and 8 wk after treatment.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

24

Victor French, J., und R. L. Meagher. „Citrus Blackfly Control on Nursery Citrus, 1990“. Insecticide and Acaricide Tests 16, Nr. 1 (01.01.1991): 46. http://dx.doi.org/10.1093/iat/16.1.46.

Der volle Inhalt der Quelle

Annotation:

Abstract Talstar, Dursban, and Orthene were compared to petroleum oil (Sunspray 6 N) for efficacy against CBF on container grown citrus in a nursery at Monte Alto, Tex. CBF-infested trees, 3-4 ft tall, were selected and each treatment replicated 4 times on groups of 5 trees each. Trees were sprayed to foliar runoff, with control trees receiving a water spray, using a TQ-40 Koke Kap backpack COa Sprayer at 30 psi. At intervals prespray and postspray, mature young leaves (20/treatment) were randomly sampled and lst-4th stage CBF (minimum of 500/ treatment) were examined under a binocular microscope. CBF were recorded as dead by the absence of body fluid when probed with a needle. Percent mortality of all immature stage CBF was determined for each treatment.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

25

French, J. Victor, und Santiago Villarreal. „Citrus Rust Mite Control on Citrus, 1996“. Arthropod Management Tests 22, Nr. 1 (01.01.1997): 60. http://dx.doi.org/10.1093/amt/22.1.60.

Der volle Inhalt der Quelle

Annotation:

Abstract Different rates of Experimental CM-006, alone and tank-mixed with NR 435 Oil, were. compared with the standard acaricide Agri-Mek + NR 435 oil. Treatments were randomized and replicated 4 times on plots of 6 trees each in a block of 11 -yr-old grapefruit trees planted on 18 X 24 ft. spacing. Treatment sprays were applied 20 May using a FMC 1229 single volute commercial air blast sprayer operating at 1 mph, with nozzling and pressure calibrated to apply 200 gpa. At weekly intervals post treatment, 25 fruit per replicate (100/treatment) were randomly selected and examined for CRM in situ with a 10 X handlens. All live CRM were counted in two, 1 cm2 lens fields on the shaded side of each fruit. The two counts per fruit were averaged and recorded as one observation.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

26

French, J. Victor, und Santiago Villarreal. „Citrus Leafminer Control on Texas Citrus, 1997“. Arthropod Management Tests 23, Nr. 1 (01.01.1998): 62. http://dx.doi.org/10.1093/amt/23.1.62.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

27

Bastianel, Marinês, Juliana A. Pereira-Martin, Valdenice M. Novelli, Juliana Freitas-Astúa und Maria A. Nunes. „Citrus leprosis resistance within the citrus group“. VirusDisease 29, Nr. 4 (26.09.2018): 491–98. http://dx.doi.org/10.1007/s13337-018-0489-6.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

28

Diepenbrock, Lauren M., und Jamie D. Burrow. „Citrus Pest Quick Guide: Asian Citrus Psyllid“. EDIS 2020, Nr. 3 (28.05.2020): 1. http://dx.doi.org/10.32473/edis-in1271-2019.

Der volle Inhalt der Quelle

Annotation:

A one-page quick guide written by and published by the Entomology and Nematology Department presents the life cycle of the Asian citrus psyllid and provides several photos of the pest and the damage it causes to assist in identification.https://edis.ifas.ufl.edu/in1271

APA, Harvard, Vancouver, ISO und andere Zitierweisen

29

Victor French, J., und Elias Hernandez. „Citrus Blackfly Control on Texas Citrus, 1993“. Arthropod Management Tests 19, Nr. 1 (01.01.1994): 46. http://dx.doi.org/10.1093/amt/19.1.46a.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

30

Batool, Faiza. „Structural Characterization, Antioxidant, Antidiabetic and Antimicrobial Activities of Citrus Limettarisso, Citrus Nobilis X Citrus Deliciosa and Citrus Maxima“. Journal of Health and Rehabilitation Research 3, Nr. 2 (15.12.2023): 607–11. http://dx.doi.org/10.61919/jhrr.v3i2.187.

Der volle Inhalt der Quelle

Annotation:

Background: The pharmacological properties of citrus fruits have long been recognized in traditional medicine, with recent scientific studies corroborating their potential as sources of natural bioactive compounds. Citrus limettarisso, Citrus nobilis x Citrus deliciosa, and Citrus maxima, in particular, have garnered attention for their antioxidant, antidiabetic, and antimicrobial properties. Prior research has highlighted these species' capabilities, with various studies reporting on their significant health benefits. Objective: This study aims to evaluate and compare the antioxidant, antidiabetic, and antimicrobial activities of essential oils extracted from the peels of Citrus limettarisso, Citrus nobilis x Citrus deliciosa, and Citrus maxima, thereby contributing to the understanding of their potential therapeutic applications. Methods: Essential oils were extracted from the peels of the three citrus species using hydro distillation. The antioxidant activity was assessed through Total Phenolic Content (TPC), Total Flavonoid Content (TFC), and DPPH Radical Scavenging Assay. Antiglycation potential and alpha-amylase inhibition were evaluated for antidiabetic properties, while antimicrobial activity was determined using the Agar Well Diffusion Method. Results: Citrus limettarisso showed the highest TPC (301.4474 ± 2.930402 mg GAE/100g) and significant antioxidant activity (68.26347% DPPH scavenging). Citrus maxima exhibited a high TFC (143.8727 ± 5.454545 mg CE/100g) but lower TPC (115.8333 ± 3.553444 mg GAE/100g). Citrus nobilis x Citrus deliciosa demonstrated considerable TPC (244.1667 ± 5.862774 mg GAE/100g) and TFC (50.17576 ± 0.457566 mg CE/100g). Antiglycation and alpha-amylase inhibition assays revealed Citrus limettarisso as the most potent antidiabetic agent with the highest inhibition percentages. All three species showed significant antimicrobial activity. Conclusion: The study confirms the substantial pharmacological potential of Citrus limettarisso, Citrus nobilis x Citrus deliciosa, and Citrus maxima, particularly in terms of their antioxidant and antidiabetic properties. Citrus limettarisso emerged as the most potent in most assays, underscoring its potential for therapeutic use. These findings support the use of these citrus species as natural sources of bioactive compounds for health and medical applications. It carries special importance for public health advancements.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

31

Girardi, Eduardo Augusto, Francisco de Assis Alves Mourão Filho und Sônia Maria de Stefano Piedade. „Desenvolvimento vegetativo e custo de produção de porta-enxertos de citros em recipientes para fins de subenxertia“. Pesquisa Agropecuária Brasileira 42, Nr. 5 (Mai 2007): 679–87. http://dx.doi.org/10.1590/s0100-204x2007000500010.

Der volle Inhalt der Quelle

Annotation:

O objetivo deste trabalho foi avaliar o desenvolvimento vegetativo e estimar o custo de produção de 11 porta-enxertos de citros para fins de subenxertia, em diferentes recipientes. Avaliaram-se limão 'Cravo' clone Limeira (Citrus limonia Osbeck); citrumelo 'Swingle' (Poncirus trifoliata (L.) Raf. x Citrus paradisi Macf.); tangerina 'Cleópatra' (Citrus reshni Hort. ex Tanaka); tangerina 'Sunki' (Citrus sunki Hort. ex Tanaka); limão 'Volkameriano' clone Catânia 2 (Citrus volkameriana Pasquale); laranja 'Caipira' clone DAC (Citrus sinensis L. Osbeck); limão 'Rugoso da África' clone Mazoe (Citrus jambhiri Lush.); Poncirus trifoliata 'Davis A'; tangerina 'Sun Shu Sha Kat' (Citrus sunki Hort. ex Tanaka); tangerina 'Sunki' clone 2506 ou Fruto Grande (Citrus sunki Hort. ex Tanaka) e Poncirus trifoliata 'Barnes'. Foram utilizados tubetes de 290 mL, sacolas de 1,7 L, e porta-enxertos transplantados de tubetes de 75 mL para sacolas de polietileno de 1,7 e 4,5 L. Porta-enxertos produzidos diretamente em sacolas de 1,7 L atingem ponto ideal de subenxertia em menor tempo, de 100 a 150 dias após a semeadura, e permitem a obtenção de plantas maiores e com sistema radicular adequado, porém com custo de produção superior ao sistema de produção em tubetes de 290 mL.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

32

Siva, Anderson Gonçalves da, Paulo Roberto Silva Farias, Arlindo Leal Boiça Junior und Bruno Henrique Sardinha Souza. „Mosca-Negra-dos-Citros: Características Gerais, Bioecologia e Métodos de Controle dessa Importante Praga Quarentenária da Citricultura Brasileira“. EntomoBrasilis 4, Nr. 3 (31.10.2011): 85–91. http://dx.doi.org/10.12741/ebrasilis.v4i3.145.

Der volle Inhalt der Quelle

Annotation:

A mosca-negra-dos-citros, Aleurocanthus woglumi Ashby, é uma séria praga da cultura dos citros e de outras frutíferas de importância econômica. Constitui-se praga quarentenária presente ou A2 de alerta máximo, restringindo o comércio com outras regiões livres de sua presença. A partir de sua primeira ocorrência, no ano de 2001 na cidade de Belém, houve sua rápida disseminação para outros estados e regiões citrícolas do Brasil. Por ser uma praga exótica, conhecimentos básicos são escassos para se implementar o manejo adequado do inseto em território brasileiro. Desse modo, o objetivo do presente estudo é o de disponibilizar informações a respeito de aspectos importantes de A. woglumi, como: histórico e distribuição geográfica, bioecologia, plantas hospedeiras, métodos de controle adotados, dentre outros, a fim de se fornecer subsídios para futuras pesquisas sobre a mosca-negra-dos-citros no Brasil. Citrus Blackfly: General Aspects, Bioecology and Methods for the Control of this Important Quarantine Pest to Brazilian Citrus Production Abstract. Citrus blackfly, Aleurocanthus woglumi Ashby, is a serious pest of citrus culture and other economically important fruit crops. It is a present quarantine pest or A2 maximum alert restricting trades with other regions free of its presence. Since the first occurrence of the citrus blackfly in Belém in 2001 its dissemination was quickly to other States and regions of citrus production in Brazil. As an exotic pest, basic knowledge is scarce in order to establish the appropriate management to the insect in Brazil. Thus, the aim of the present study was to provide information about important aspects of A. woglumi, such as: history and geographical distribution, bioecology, host plants, appropriate control methods, among others, in order to provide subsidies for futures researches about the citrus blackfly in Brazil.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

33

Elleuch, A., M. Marrakchi, D. Lévesque, N. Bessais, PerreaultJP und H. Fakhfakh. „Molecular variability of Citrus exocortis viroid in a single naturally infected citrus tree“. Plant Protection Science 39, No. 4 (25.11.2011): 139–45. http://dx.doi.org/10.17221/3833-pps.

Der volle Inhalt der Quelle

Annotation:

We report the nucleotide sequence of Citrus exocortis viroid (CEVd) from a single natural infected citrus tree of the clementinier variety (Citrus clementina) in Tunisia. The sequence variability of this viroid from its natural host without using an alternative passage by an indicator host or an artificial inoculation was found to occur at 14 positions, giving a variability of 3.8%. This work confirms that naturally – occurring viroids belonging to the Pospiviroid genera contain a mixture of sequence variants. In addition, this study confirms the worldwide distribution of this viroid.  

APA, Harvard, Vancouver, ISO und andere Zitierweisen

34

Zhou, Carol L. Ecale, El-Desouky Ammar, Hany Sheta, Sandra Kelley, MaryLou Polek und Diane E. Ullman. „Citrus tristeza virus ultrastructure and associated cytopathology in Citrus sinensis and Citrus aurantifolia“. Canadian Journal of Botany 80, Nr. 5 (01.05.2002): 512–25. http://dx.doi.org/10.1139/b02-030.

Der volle Inhalt der Quelle

Annotation:

Citrus tristeza virus ultrastructure and associated cytopathology was documented with three isolates and two hosts, sweet orange 'Madam vinous' (Citrus sinensis (L.) Osbeck) and Mexican lime (Citrus aurantifolia (L.) Swingle). Virions were long, flexuous, and disorganized or in swirled, parallel masses. Infection was common in phloem parenchyma and companion cells and less frequent in mature sieve elements. Immunogold labeling confirmed previous findings that the major coat protein encapsidated the length of purified virions, while the minor coat protein encapsidated one terminal. Three types of inclusions were observed: (i) viral arrays that reacted with antibodies against the major (p25) and minor (p27) Citrus tristeza virus coat proteins, (ii) fibrous inclusions that reacted with antibodies against the Citrus tristeza virus p20 gene product but were sparsely labeled with antibodies against either coat protein, and (iii) accumulated cytoplasmic vesicles associated with aggregated, vesiculating mitochondria. The latter resembled Beet yellows virus-like vesicles, which are typical of closterovirus infection, but did not react with any of our antibodies. Cytopathology did not differ between isolates and plant hosts. Most effects were observed in phloem parenchyma cells, including chloroplast degradation, mitochondria vesiculation, and nuclear membrane invagination. Multivesicular bodies and lipid-filled vesicles were abundant in the cytoplasm. Masses of electron-lucent vesicles and electron-dense bodies were present between the cell membrane and cell wall.Key words: immunolocalization, CTV major coat protein, CTV minor coat protein, CTV p20 gene product, inclusions, isolate severity.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

35

Djelouah, K. „CITRUS TRISTEZA (CITRUS TRISTEZA VIRUS): A SERIOUS THREAT TO THE MEDITERRANEAN CITRUS INDUSTRY“. Acta Horticulturae, Nr. 940 (Dezember 2012): 597–606. http://dx.doi.org/10.17660/actahortic.2012.940.84.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

36

Federici, C. T., M. L. Roose und R. W. Scora. „RFLP ANALYSIS OF THE ORIGIN OF CITRUS BERGAMIA, CITRUS JAMBHIRI, AND CITRUS LIMONIA“. Acta Horticulturae, Nr. 535 (August 2000): 55–64. http://dx.doi.org/10.17660/actahortic.2000.535.6.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

37

Okunlola, Banke Mary, Udeme Joshua Josiah Ijah, Jonathan Yisa und Olabisi Peter Abioye. „Phytochemicals and phyto-disinfectant properties of citrus species (Citrus limon, Citrus aurantifolia and Citrus sinensis) for pond water purification“. GSC Biological and Pharmaceutical Sciences 8, Nr. 2 (30.08.2019): 034–44. http://dx.doi.org/10.30574/gscbps.2019.8.2.0139.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

38

Freitas-Astúa, Juliana, André Luiz Fadel, Marinês Bastianel, Valdenice Moreira Novelli, Renata Antonioli-Luizon und Marcos Antônio Machado. „Resposta diferencial de espécies e de híbridos de citros à leprose“. Pesquisa Agropecuária Brasileira 43, Nr. 7 (Juli 2008): 809–14. http://dx.doi.org/10.1590/s0100-204x2008000700004.

Der volle Inhalt der Quelle

Annotation:

O objetivo deste trabalho foi buscar novas fontes de resistência à leprose-dos-citros, no Banco Ativo de Germoplasma do Centro APTA Citros Sylvio Moreira, Instituto Agronômico, em Cordeirópolis, SP. Foram utilizadas plantas obtidas por sementes de 26 acessos, infectadas com o vírus da leprose-dos-citros (Citrus leprosis virus - CiLV), por meio do seu vetor Brevipalpus phoenicis. O aparecimento de lesões, a partir de 21 dias após a inoculação, foi observado em 11 dos genótipos testados (42,3%). Quinze espécies, entre elas Citrus pennivesiculata e C. celebica, comportaram-se como altamente resistentes, enquanto outras, como C. keraji, foram mais suscetíveis que o padrão C. sinensis. Os dados mostraram grande variação de respostas de Citrus spp. à leprose, com elevado número de espécies resisentes, que podem ser utilizadas como fonte de resistência à doença em programas de melhoramento.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

39

Batool, A., Y. Iftikhar, M. Mughal S, M. Khan M, J. Jaskani M, M. Abbas und A. Khan I. „Citrus Greening Disease – A major cause of citrus decline in the world: A Review“. Horticultural Science 34, No. 4 (07.01.2008): 159–66. http://dx.doi.org/10.17221/1897-hortsci.

Der volle Inhalt der Quelle

Annotation:

Citrus Greening Disease (CGD) was critically reviewed with respect to its history, origin, symptomatology, host range, pathogenic association, identification and detection, transmission and management. It is evident that the citrus disease has emerged as a potential serious threat to citrus production in all the citrus growing countries of the world including Pakistan. It is has been proved that in Pakistan the greening disease is the major cause of citrus decline; hence it is necessary to formulate definite planning and strategies.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

40

Bouzid, S., und I. Belcoura. „CITRUS MICROPROPAGATION“. Acta Horticulturae, Nr. 212 (September 1987): 470. http://dx.doi.org/10.17660/actahortic.1987.212.71.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

41

Meena, Ashok Kumar, Francis Dutta, Mingnam Ch. Marak und R. K. Meena. „Citrus Decline“. International Journal of Current Microbiology and Applied Sciences 7, Nr. 04 (10.04.2018): 2807–15. http://dx.doi.org/10.20546/ijcmas.2018.704.319.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

42

Evans, Kerry James. „Metaphysical Citrus“. Colorado Review 44, Nr. 1 (2017): 128. http://dx.doi.org/10.1353/col.2017.0017.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

43

Talon, Manuel, und Fred G. Gmitter. „Citrus Genomics“. International Journal of Plant Genomics 2008 (19.05.2008): 1–17. http://dx.doi.org/10.1155/2008/528361.

Der volle Inhalt der Quelle

Annotation:

Citrus is one of the most widespread fruit crops globally, with great economic and health value. It is among the most difficult plants to improve through traditional breeding approaches. Currently, there is risk of devastation by diseases threatening to limit production and future availability to the human population. As technologies rapidly advance in genomic science, they are quickly adapted to address the biological challenges of the citrus plant system and the world's industries. The historical developments of linkage mapping, markers and breeding, EST projects, physical mapping, an international citrus genome sequencing project, and critical functional analysis are described. Despite the challenges of working with citrus, there has been substantial progress. Citrus researchers engaged in international collaborations provide optimism about future productivity and contributions to the benefit of citrus industries worldwide and to the human population who can rely on future widespread availability of this health-promoting and aesthetically pleasing fruit crop.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

44

Contreras-Maya, Rosalba, Angel Villegas-Monter, Nicacio Cruz-Huerta, Amalio Santacruz-Varela, Laura D. Ortega-Arenas und Daniel-Leobardo Ochoa-Martínez. „Photosynthetic response of citrus to Citrus tristeza virus isolates with potential for cross-protection“. Pesquisa Agropecuária Brasileira 58 (2023). http://dx.doi.org/10.1590/s1678-3921.pab2023.v58.03290.

Der volle Inhalt der Quelle

Annotation:

Abstract The objective of this work was to evaluate the photosynthetic response of citrus varieties to the inoculation of isolates T30 and T3 of Citrus tristeza virus (CTV) characterized as having potential to provide cross-protection against severe CTV isolates in citrus. Citrus plants of 'Campbell' orange, 'Persian' lime, and 'Key' lime were subjected to inoculations by both isolates by patch. Noninoculated plants were used as the control. Symptom expression, photosynthetic and transpiration rates, and stomatal conductance were evaluated by IRGA. Stomatal density and size were evaluated by epidermal impressions. The CTV isolates were also evaluated and molecularly characterized by RT-PCR and Sanger sequencing. 'Campbell' orange and 'Persian' lime plants remained asymptomatic after the inoculations. The inoculation treatments with both CTV isolates did not reduce photosynthetic capacity, transpiration rate, and stomatal conductance, in comparison with the control. Stomatal density and size varied according to the citrus species. T30 and T3 do not affect the photosynthetic responses of 'Campbell' orange and 'Persian' lime; therefore, these isolates have the potential to provide cross-protection to citrus varieties against severe isolates of CTV.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

45

Adhikar, D. „Chinese citrus fly in citrus.“ PlantwisePlus Knowledge Bank Pest Management (Januar 2013). http://dx.doi.org/10.1079/pwkb.20187800001.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

46

„Citrus exocortis viroid (citrus exocortis)“. CABI Compendium CABI Compendium (07.01.2022). http://dx.doi.org/10.1079/cabicompendium.16534.

Der volle Inhalt der Quelle

Annotation:

This datasheet on Citrus exocortis viroid covers Identity, Overview, Distribution, Dispersal, Hosts/Species Affected, Diagnosis, Biology & Ecology, Seedborne Aspects, Impacts, Uses, Prevention/Control, Further Information.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

47

Cambra, M. „Citrus tristeza virus (citrus tristeza)“. CABI Compendium CABI Compendium (07.01.2022). http://dx.doi.org/10.1079/cabicompendium.16705.

Der volle Inhalt der Quelle

Annotation:

This datasheet on Citrus tristeza virus covers Identity, Overview, Distribution, Dispersal, Hosts/Species Affected, Vectors & Intermediate Hosts, Diagnosis, Biology & Ecology, Seedborne Aspects, Impacts, Prevention/Control, Further Information.

APA, Harvard, Vancouver, ISO und andere Zitierweisen

48

„Citrus blight disease (citrus blight)“. CABI Compendium CABI Compendium (07.01.2022). http://dx.doi.org/10.1079/cabicompendium.13441.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

49

„Citrus cachexia viroid (citrus xyloporosis)“. CABI Compendium CABI Compendium (07.01.2022). http://dx.doi.org/10.1079/cabicompendium.16737.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

50

„Citrus exocortis viroid (citrus exocortis)“. PlantwisePlus Knowledge Bank Species Pages (07.01.2022). http://dx.doi.org/10.1079/pwkb.species.16534.

Der volle Inhalt der Quelle

APA, Harvard, Vancouver, ISO und andere Zitierweisen

Wir bieten Rabatte auf alle Premium-Pläne für Autoren, deren Werke in thematische Literatursammlungen aufgenommen wurden. Kontaktieren Sie uns, um einen einzigartigen Promo-Code zu erhalten!