Um die anderen Arten von Veröffentlichungen zu diesem Thema anzuzeigen, folgen Sie diesem Link: Barley yellow dwarf viruses Control.
Zeitschriftenartikel zum Thema „Barley yellow dwarf viruses Control“
Geben Sie eine Quelle nach APA, MLA, Chicago, Harvard und anderen Zitierweisen an
Machen Sie sich mit Top-50 Zeitschriftenartikel für die Forschung zum Thema "Barley yellow dwarf viruses Control" bekannt.
Neben jedem Werk im Literaturverzeichnis ist die Option "Zur Bibliographie hinzufügen" verfügbar. Nutzen Sie sie, wird Ihre bibliographische Angabe des gewählten Werkes nach der nötigen Zitierweise (APA, MLA, Harvard, Chicago, Vancouver usw.) automatisch gestaltet.
Sie können auch den vollen Text der wissenschaftlichen Publikation im PDF-Format herunterladen und eine Online-Annotation der Arbeit lesen, wenn die relevanten Parameter in den Metadaten verfügbar sind.
Sehen Sie die Zeitschriftenartikel für verschiedene Spezialgebieten durch und erstellen Sie Ihre Bibliographie auf korrekte Weise.
1
Burrows, M. E., M. C. Caillaud, D. M. Smith, E. C. Benson, F. E. Gildow und S. M. Gray. „Genetic Regulation of Polerovirus and Luteovirus Transmission in the Aphid Schizaphis graminum“. Phytopathology® 96, Nr. 8 (August 2006): 828–37. http://dx.doi.org/10.1094/phyto-96-0828.
Der volle Inhalt der QuelleAnnotation:
Sexual forms of two genotypes of the aphid Schizaphis graminum, one a vector, the other a nonvector of two viruses that cause barley yellow dwarf disease (Barley yellow dwarf virus [BYDV]-SGV, luteovirus and Cereal yellow dwarf virus-RPV, polerovirus), were mated to generate F1 and F2 populations. Segregation of the transmission phenotype for both viruses in the F1 and F2 populations indicated that the transmission phenotype is under genetic control and that the parents are heterozygous for genes involved in transmission. The ability to transmit both viruses was correlated within the F1 and F2 populations, suggesting that a major gene or linked genes regulate the transmission. However, individual hybrid genotypes differed significantly in their ability to transmit each virus, indicating that in addition to a major gene, minor genes can affect the transmission of each virus independently. Gut and salivary gland associated transmission barriers were identified in the nonvector parent and some progeny, while other progeny possessed only a gut barrier or a salivary gland barrier. Hemolymph factors do not appear to be involved in determining the transmission phenotype. These results provide direct evidence that aphid transmission of luteoviruses is genetically regulated in the insect and that the tissue-specific barriers to virus transmission are not genetically linked.
2
Burrows, Mary, Carla Thomas, Neil McRoberts, Richard M. Bostock, Len Coop und James Stack. „Coordination of Diagnostic Efforts in the Great Plains: Wheat Virus Survey and Modeling of Disease Onset“. Plant Disease 100, Nr. 6 (Juni 2016): 1037–45. http://dx.doi.org/10.1094/pdis-04-15-0467-fe.
Der volle Inhalt der QuelleAnnotation:
Following the discovery of two new wheat virus diseases in the United States, the Great Plains region (Colorado, Kansas, Montana, Nebraska, North Dakota, Oklahoma, South Dakota, Texas, and Wyoming) of the National Plant Diagnostic Network (NPDN) initiated a project to measure the prevalence of five wheat diseases using indirect ELISA. Wheat streak mosaic virus (WSMV), Wheat mosaic virus (WMoV), and Triticum mosaic virus (TriMV) were found in all nine states. WSMV was the most prevalent, averaging 23 to 47% of samples each year. TriMV and WMoV were detected with WSMV (in up to 76% of the samples). All three mite-transmitted viruses were present in 26% or fewer of the samples. Aphid-transmitted viruses in the barley yellow dwarf complex Barley yellow dwarf virus, and Cereal yellow dwarf virus-RPV were less frequent (fewer than 65% of the samples). This paper presents the first case-control methodology paper using plant diagnostic laboratory data and the first signed diagnostic data-sharing agreement between the NPDN and its regulatory stakeholders. Samples collected when <700 cumulative degree-days base 0°C, were twice as likely to be virus negative. This proof-of-concept effort highlights the potential of the NPDN and its National Data Repository to develop knowledge about emerging diseases.
3
Li, Lin, Shuangchao Wang, Xiufen Yang, Frederic Francis und Dewen Qiu. „Protein Elicitor PeaT1 Efficiently Controlled Barley Yellow Dwarf Virus in Wheat“. Agriculture 9, Nr. 9 (06.09.2019): 193. http://dx.doi.org/10.3390/agriculture9090193.
Der volle Inhalt der QuelleAnnotation:
Barley yellow dwarf virus (BYDV), transmitted by the wheat aphid, generates serious wheat yellow dwarf disease and causes great losses in agriculture. Induced resistance has attracted great attention over recent years as a biological method to control plant pathogens and herbivores. Protein elicitor PeaT1 induces defense response in plants against fungi, viruses, and aphids. In this study, wheat seeds and seedlings were soaked and sprayed with 30 μg/mL PeaT1, respectively. Then seedlings were inoculated with BYDV by viruliferous Schizaphis graminum to detect the control efficiency of PeaT1-induced resistance against BYDV. The control efficiency was over 30% on the 14th and 21st days after the inoculation access period. Quantitative real time polymerase chain reaction (Q-RT-PCR) tests showed that there was less mRNA from the BYDV coat protein in PeaT1-treated wheat seedlings than in the control group. Electrical penetration graph (EPG) tests showed that virus transmission vector S.graminum took a longer time to find probe and feeding sites on PeaT1-treated wheat seedlings. Additionally, PeaT1-treated wheat seedlings gained higher plant height and more chlorophyll a&b. These results showed that PeaT1 efficiently controlled BYDV by inhibiting BYDV proliferation, reducing the virus transmission ability of S. graminum and alleviating the symptoms of dwarfism and yellow colouring caused by BYDV. This study provided a new integrated way to control BYDV biologically.
4
Nancarrow, Narelle, Mohammad Aftab, Angela Freeman, Brendan Rodoni, Grant Hollaway und Piotr Trębicki. „Prevalence and Incidence of Yellow Dwarf Viruses Across a Climatic Gradient: A Four-Year Field Study in Southeastern Australia“. Plant Disease 102, Nr. 12 (Dezember 2018): 2465–72. http://dx.doi.org/10.1094/pdis-01-18-0116-re.
Der volle Inhalt der QuelleAnnotation:
Yellow dwarf viruses (YDVs) form a complex of economically important pathogens that affect cereal production worldwide, reducing yield and quality. The prevalence and incidence of YDVs including barley yellow dwarf viruses (BYDV-PAV and BYDV-MAV) and cereal yellow dwarf virus (CYDV-RPV) in cereal fields in Victoria, Australia were measured. As temperature decreases and rainfall increases from north to south in Victoria, fields in three geographical regions were evaluated to determine potential differences in virus prevalence and incidence across the weather gradient. Cereal samples randomly collected from each field during spring for four consecutive years (2014–2017) were tested for BYDV-PAV, BYDV-MAV, and CYDV-RPV using tissue blot immunoassay. BYDV-PAV was the most prevalent YDV species overall and had the highest overall mean incidence. Higher temperature and lower rainfall were associated with reduced prevalence and incidence of YDVs as the northern region, which is hotter and drier, had a 17-fold decrease in virus incidence compared with the cooler and wetter regions. Considerable year-to-year variation in virus prevalence and incidence was observed. This study improves our understanding of virus epidemiology, which will aid the development of more targeted control measures and predictive models. It also highlights the need to monitor for YDVs and their vectors over multiple years to assess the level of risk and to make more informed and appropriate disease management decisions.
5
Tapio, Eeva, Katri Bremer und Jari P. T. Valkonen. „Viruses and their significance in agricultural and horticultural crops in Finland“. Agricultural and Food Science 6, Nr. 4 (01.12.1997): 323–36. http://dx.doi.org/10.23986/afsci.72795.
Der volle Inhalt der QuelleAnnotation:
This paper reviews the plant viruses and virus vectors that have been detected in agricultural and horticultural crop plants and some weeds in Finland. The historical and current importance of virus diseases and the methods used for controlling them in cereals, potato, berry plants, fruit trees, ornamental plants and vegetables are discussed. Plant viruses have been intensely studied in Finland over 40 years. Up to date, 44 plant virus species have been detected, and many tentatively identified viruses are also reported. Control of many virus diseases has been significantly improved. This has been achieved mainly through changes in cropping systems, production of healthy seed potatoes and healthy stocks of berry plants, fruit trees and ornamental plants in the institutes set up for such production, and improved hygiene. At the present, barley yellow dwarf luteovirus, potato Y potyvirus and potato mop-top furovirus are considred to be economically the most harmful plant viruses in Finland.
6
Kiruwa, Fatma Hussein, Samuel Mutiga, Joyce Njuguna, Eunice Machuka, Senait Senay, Tileye Feyissa, Patrick Alois Ndakidemi und Francesca Stomeo. „Status and Epidemiology of Maize Lethal Necrotic Disease in Northern Tanzania“. Pathogens 9, Nr. 1 (18.12.2019): 4. http://dx.doi.org/10.3390/pathogens9010004.
Der volle Inhalt der QuelleAnnotation:
Sustainable control of plant diseases requires a good understanding of the epidemiological aspects such as the biology of the causal pathogens. In the current study, we used RT-PCR and Next Generation Sequencing (NGS) to contribute to the characterization of maize lethal necrotic (MLN) viruses and to identify other possible viruses that could represent a future threat in maize production in Tanzania. RT-PCR screening for Maize Chlorotic Mottle Virus (MCMV) detected the virus in the majority (97%) of the samples (n = 223). Analysis of a subset (n = 48) of the samples using NGS-Illumina Miseq detected MCMV and Sugarcane Mosaic Virus (SCMV) at a co-infection of 62%. The analysis further detected Maize streak virus with an 8% incidence in samples where MCMV and SCMV were also detected. In addition, signatures of Maize dwarf mosaic virus, Sorghum mosaic virus, Maize yellow dwarf virus-RMV and Barley yellow dwarf virus were detected with low coverage. Phylogenetic analysis of the viral coat protein showed that isolates of MCMV and SCMV were similar to those previously reported in East Africa and Hebei, China. Besides characterization, we used farmers’ interviews and direct field observations to give insights into MLN status in different agro-ecological zones (AEZs) in Kilimanjaro, Mayara, and Arusha. Through the survey, we showed that the prevalence of MLN differed across regions (P = 0.0012) and villages (P < 0.0001) but not across AEZs (P > 0.05). The study shows changing MLN dynamics in Tanzania and emphasizes the need for regional scientists to utilize farmers’ awareness in managing the disease.
7
Redila, Carla Dizon, Ved Prakash und Shahideh Nouri. „Metagenomics Analysis of the Wheat Virome Identifies Novel Plant and Fungal-Associated Viral Sequences“. Viruses 13, Nr. 12 (07.12.2021): 2457. http://dx.doi.org/10.3390/v13122457.
Der volle Inhalt der QuelleAnnotation:
Wheat viruses including wheat streak mosaic virus, Triticum mosaic virus, and barley yellow dwarf virus cost substantial losses in crop yields every year. Although there have been extensive studies conducted on these known wheat viruses, currently, there is limited knowledge about all components of the wheat (Triticum aestivum L.) virome. Here, we determined the composition of the wheat virome through total RNA deep sequencing of field-collected leaf samples. Sequences were de novo assembled after removing the host reads, and BLASTx searches were conducted. In addition to the documented wheat viruses, novel plant and fungal-associated viral sequences were identified. We obtained the full genome sequence of the first umbra-like associated RNA virus tentatively named wheat umbra-like virus in cereals. Moreover, a novel bi-segmented putative virus tentatively named wheat-associated vipovirus sharing low but significant similarity with both plant and fungal-associated viruses was identified. Additionally, a new putative fungal-associated tobamo-like virus and novel putative Mitovirus were discovered in wheat samples. The discovery and characterization of novel viral sequences associated with wheat is important to determine if these putative viruses may pose a threat to the wheat industry or have the potential to be used as new biological control agents for wheat pathogens either as wild-type or recombinant viruses.
8
Song, Sang Ik, und W. Allen Miller. „cis and trans Requirements for Rolling Circle Replication of a Satellite RNA“. Journal of Virology 78, Nr. 6 (15.03.2004): 3072–82. http://dx.doi.org/10.1128/jvi.78.6.3072-3082.2004.
Der volle Inhalt der QuelleAnnotation:
ABSTRACT Satellite RNAs usurp the replication machinery of their helper viruses, even though they bear little or no sequence similarity to the helper virus RNA. In Cereal yellow dwarf polerovirus serotype RPV (CYDV-RPV), the 322-nucleotide satellite RNA (satRPV RNA) accumulates to high levels in the presence of the CYDV-RPV helper virus. Rolling circle replication generates multimeric satRPV RNAs that self-cleave via a double-hammerhead ribozyme structure. Alternative folding inhibits formation of a hammerhead in monomeric satRPV RNA. Here we determine helper virus requirements and the effects of mutations and deletions in satRPV RNA on its replication in oat cells. Using in vivo selection of a satRPV RNA pool randomized at specific bases, we found that disruption of the base pairing necessary to form the non-self-cleaving conformation reduced satRPV RNA accumulation. Unlike other satellite RNAs, both the plus and minus strands proved to be equally infectious. Accordingly, very similar essential replication structures were identified in each strand. A different region is required only for encapsidation. The CYDV-RPV RNA-dependent RNA polymerase (open reading frames 1 and 2), when expressed from the nonhelper Barley yellow dwarf luteovirus, was capable of replicating satRPV RNA. Thus, the helper virus's polymerase is the sole determinant of the ability of a virus to replicate a rolling circle satellite RNA. We present a framework for functional domains in satRPV RNA with three types of function: (i) conformational control elements comprising an RNA switch, (ii) self-functional elements (hammerhead ribozymes), and (iii) cis-acting elements that interact with viral proteins.
9
Guy, P. L. „Viruses of New Zealand pasture grasses and legumes: a review“. Crop and Pasture Science 65, Nr. 9 (2014): 841. http://dx.doi.org/10.1071/cp14017.
Der volle Inhalt der QuelleAnnotation:
This article reviews knowledge of 23 plant viruses infecting pasture grasses and legumes in New Zealand. The incidence, ecology and impact of each virus and prospects for control using natural or artificial resistance genes or by vector control is discussed. The most prevalent viruses are Alfalfa mosaic virus and White clover mosaic virus in pasture legumes and Cocksfoot mottle virus, Ryegrass mosaic virus and Barley yellow dwarf virus in pasture grasses. Lucerne Australian latent virus is restricted to the North Island and Red clover necrotic mosaic virus is largely restricted to the South Island. These patterns are likely to be dynamic with ongoing changes in weather patterns, land use, the spread of insect vectors and the continuing introduction of viruses and vectors. The existing and potential threats to 12 pasture species are tabulated and the knowledge gaps for each species highlighted. Control of vectors including aphids, eriophyid mites and soil-borne fungi is probably not economic per se but could be an additional benefit of integrated pest management in pasture and cropping systems. The most cost-effective and practical preventative measures are likely to be the use of virus-tested seed to establish new pastures and the incorporation of resistance genes by conventional breeding or by genetic engineering. Finally, recommendations are made for future research for New Zealand, which is also relevant to other temperate regions of the world.
10
Miller, W. Allen, Ruizhong Shen, William Staplin und Pulkit Kanodia. „Noncoding RNAs of Plant Viruses and Viroids: Sponges of Host Translation and RNA Interference Machinery“. Molecular Plant-Microbe Interactions® 29, Nr. 3 (März 2016): 156–64. http://dx.doi.org/10.1094/mpmi-10-15-0226-fi.
Der volle Inhalt der QuelleAnnotation:
Noncoding sequences in plant viral genomes are well-known to control viral replication and gene expression in cis. However, plant viral and viroid noncoding (nc)RNA sequences can also regulate gene expression acting in trans, often acting like ‘sponges’ that bind and sequester host cellular machinery to favor viral infection. Noncoding sequences of small subgenomic (sg)RNAs of Barley yellow dwarf virus (BYDV) and Red clover necrotic mosaic virus (RCNMV) contain a cap-independent translation element that binds translation initiation factor eIF4G. We provide new evidence that a sgRNA of BYDV can globally attenuate host translation, probably by sponging eIF4G. Subgenomic ncRNA of RCNMV is generated via 5′ to 3′ degradation by a host exonuclease. The similar noncoding subgenomic flavivirus (sf)RNA, inhibits the innate immune response, enhancing viral pathogenesis. Cauliflower mosaic virus transcribes massive amounts of a 600-nt ncRNA, which is processed into small RNAs that overwhelm the host’s RNA interference (RNAi) system. Viroids use the host RNAi machinery to generate viroid-derived ncRNAs that inhibit expression of host defense genes by mimicking a microRNA. More examples of plant viral and viroid ncRNAs are likely to be discovered, revealing fascinating new weaponry in the host-virus arms race.
11
Koev, Gennadiy, und W. Allen Miller. „A Positive-Strand RNA Virus with Three Very Different Subgenomic RNA Promoters“. Journal of Virology 74, Nr. 13 (01.07.2000): 5988–96. http://dx.doi.org/10.1128/jvi.74.13.5988-5996.2000.
Der volle Inhalt der QuelleAnnotation:
ABSTRACT Numerous RNA viruses generate subgenomic mRNAs (sgRNAs) for expression of their 3′-proximal genes. A major step in control of viral gene expression is the regulation of sgRNA synthesis by specific promoter elements. We used barley yellow dwarf virus (BYDV) as a model system to study transcriptional control in a virus with multiple sgRNAs. BYDV generates three sgRNAs during infection. The sgRNA1 promoter has been mapped previously to a 98-nucleotide (nt) region which forms two stem-loop structures. It was determined that sgRNA1 is not required for BYDV RNA replication in oat protoplasts. In this study, we show that neither sgRNA2 nor sgRNA3 is required for BYDV RNA replication. The promoters for sgRNA2 and sgRNA3 synthesis were mapped by using deletion mutagenesis. The minimal sgRNA2 promoter is approximately 143 nt long (nt 4810 to 4952) and is located immediately downstream of the putative sgRNA2 start site (nt 4809). The minimal sgRNA3 core promoter is 44 nt long (nt 5345 to 5388), with most of the sequence located downstream of sgRNA3 start site (nt 5348). For both promoters, additional sequences upstream of the start site enhanced sgRNA promoter activity. These promoters contrast to the sgRNA1 promoter, in which almost all of the promoter is located upstream of the transcription initiation site. Comparison of RNA sequences and computer-predicted secondary structures revealed little or no homology between the three sgRNA promoter elements. Thus, a small RNA virus with multiple sgRNAs can have very different subgenomic promoters, which implies a complex system for promoter recognition and regulation of subgenomic RNA synthesis.
12
Miller and , W. Allen, und Lada Rasochová. „Barley Yellow Dwarf Viruses“. Annual Review of Phytopathology 35, Nr. 1 (September 1997): 167–90. http://dx.doi.org/10.1146/annurev.phyto.35.1.167.
Der volle Inhalt der Quelle
13
Walsh, Lael, Ester Ferrari, Stephen Foster und Michael T. Gaffney. „Evidence of Pyrethroid Tolerance in the Bird Cherry-Oat Aphid Rhopalosiphum Padi in Ireland“. Outlooks on Pest Management 31, Nr. 1 (01.02.2020): 5–9. http://dx.doi.org/10.1564/v31_feb_02.
Der volle Inhalt der QuelleAnnotation:
Results of dose response bioassays 'in vivo' used to characterise the phenotypic response of pyrethroid resistant S. avenae in comparison to susceptible S. avenae, and two other cereal aphids, the rose-grain aphid (Metopholophium dirhodum) and the bird-cherry – oat aphid (Rhopalosiphum padi), are used to measure levels of pyrethroid resistance. Aphid pests on cereals in the British Isles are predominantly controlled by pyrethroid insecticides, especially since the implementation of the recent ban on neonicotinoid seed treatments on all outdoor crops. Resistance to pyrethroids has been detected in one of the main aphid pests, the grain aphid (Sitobion avenae), probably brought on by the sustained use of these pyrethroid sprays to control cereal aphids, which can transmit plant viruses, especially Barley Yellow Dwarf Virus (BYDV). The withdrawal of several insecticide compounds (e.g. pirimicarb, dimethoate, chlorpyrifos and the aforesaid neonicotinoids) for cereal aphid control will probably increase the selection pressure, leading to increased levels of resistance in S. avenae, and, potentially, the evolution of resistance in other cereal aphid species. In this article we present the results of dose response bioassays 'in vivo' used to characterise the phenotypic response of pyrethroid resistant S. avenae in comparison to susceptible S. avenae, and two other cereal aphids, the rosegrain aphid (Metopholophium dirhodum) and the bird-cherry– oat aphid (Rhopalosiphum padi), in order to measure levels of pyrethroid resistance. At present, little is known about the extent of pyrethroid resistance in S. avenae beyond the UK and in other cereal aphids. It therefore becomes increasingly important to monitor these pests to inform crop management decisions in light of the recent loss of other insecticides. The unintended consequences of the rapid withdrawal of insecticides, together with a failure to prepare and install alternative products and control approaches in advance, will probably ultimately lead to the loss of effectiveness of insecticidal compounds like pyrethroids.
14
Shen, Ruizhong, Aurélie M. Rakotondrafara und W. Allen Miller. „trans Regulation of Cap-Independent Translation by a Viral Subgenomic RNA“. Journal of Virology 80, Nr. 20 (15.10.2006): 10045–54. http://dx.doi.org/10.1128/jvi.00991-06.
Der volle Inhalt der QuelleAnnotation:
ABSTRACT Many positive-strand RNA viruses generate 3′-coterminal subgenomic mRNAs to allow translation of 5′-distal open reading frames. It is unclear how viral genomic and subgenomic mRNAs compete with each other for the cellular translation machinery. Translation of the uncapped Barley yellow dwarf virus genomic RNA (gRNA) and subgenomic RNA1 (sgRNA1) is driven by the powerful cap-independent translation element (BTE) in their 3′ untranslated regions (UTRs). The BTE forms a kissing stem-loop interaction with the 5′ UTR to mediate translation initiation at the 5′ end. Here, using reporter mRNAs that mimic gRNA and sgRNA1, we show that the abundant sgRNA2 inhibits translation of gRNA, but not sgRNA1, in vitro and in vivo. This trans inhibition requires the functional BTE in the 5′ UTR of sgRNA2, but no translation of sgRNA2 itself is detectable. The efficiency of translation of the viral mRNAs in the presence of sgRNA2 is determined by proximity to the mRNA 5′ end of the stem-loop that kisses the 3′ BTE. Thus, the gRNA and sgRNA1 have “tuned” their expression efficiencies via the site in the 5′ UTR to which the 3′ BTE base pairs. We conclude that sgRNA2 is a riboregulator that switches off translation of replication genes from gRNA while permitting translation of structural genes from sgRNA1. These results reveal (i) a new level of control of subgenomic-RNA gene expression, (ii) a new role for a viral subgenomic RNA, and (iii) a new mechanism for RNA-mediated regulation of translation.
15
Strażyński, Przemysław, Maria Ruszkowska, Małgorzata Jeżewska und Katarzyna Trzmiel. „Evaluation of The Autumn Infection of Winter Barley with Barley Yellow Dwarf Viruses Transmitted by Anholocyclic forms of Bird Cherry-Oat Aphid Rhopalosiphum Padi L. in Poland“. Journal of Plant Protection Research 51, Nr. 3 (01.07.2011): 314–21. http://dx.doi.org/10.2478/v10045-011-0051-7.
Der volle Inhalt der QuelleAnnotation:
Evaluation of The Autumn Infection of Winter Barley with Barley Yellow Dwarf Viruses Transmitted by Anholocyclic forms of Bird Cherry-Oat Aphid Rhopalosiphum Padi L. in Poland Research was carried out to determine the extent of anholocyclic forms of bird cherry-oat aphid, Rhopalosiphum padi on winter barley, and to estimate the level of infection of winter barley crops with Barley yellow dwarf (BYD) viruses. Observations were made in 12 Polish regions. Each region is made up of four distinct locations, with different temperatures. The 12 observed regions were: Lubuskie, Dolnośląskie, Opolskie, Śląskie, Małopolskie, Podkarpackie, Wielkopolskie, Łódzkie, Mazowieckie, Lubelskie, Warmińsko-Mazurskie and Podlaskie. The research was carried out during the period of colonization of plants by aphids. Anholocyclic forms of R. padi were found on winter barley crops in all regions, with the exception of the Podlaskie area. Samples of plants were collected and tested for virus occurrence by ELISA. In 2007, the detection of BYD viruses in aphids feeding on winter barley was performed using the PCR technique. Virus diagnostics revealed the prevalence of Barley yellow dwarf virus-PAV (BYDV-PAV) over Barley yellow dwarf virus-MAV (BYDV-MAV), in 2006 and 2007. Aphid vectors of BYD viruses were the most numerous in all the locations of the Opolskie region.
16
Milgate, Andrew, Dante Adorada, Grant Chambers und Mary Ann Terras. „Occurrence of Winter Cereal Viruses in New South Wales, Australia, 2006 to 2014“. Plant Disease 100, Nr. 2 (Februar 2016): 313–17. http://dx.doi.org/10.1094/pdis-06-15-0650-re.
Der volle Inhalt der QuelleAnnotation:
Winter cereal viruses can cause significant crop losses; however, detailed knowledge of their occurrence in New South Wales, Australia is very limited. This paper reports on the occurrence of Wheat streak mosaic virus (WSMV), Wheat mosaic virus (WMoV), Barley yellow dwarf virus (BYDV), Cereal yellow dwarf virus (CYDV), and their serotypes between 2006 and 2014. Detection of WMoV is confirmed in eastern Australia for the first time. The BYDV and CYDV 2014 epidemic is examined in detail using 139 samples of wheat, barley, and oat surveyed from southern New South Wales. The presence of virus was determined using enzyme-linked immunosorbent assays. The results reveal a high frequency of the serotype Barley yellow dwarf virus - MAV as a single infection present in 27% of samples relative to Barley yellow dwarf virus - PAV in 19% and CYDV in 14%. Clear differences emerged in the infection of different winter cereal species by serotypes of BYDV and CYDV. These results are contrasted to other Australian and international studies.
17
Griesbach, J. A. „Incidence of Barley Yellow Dwarf Viruses in California Cereals“. Plant Disease 74, Nr. 2 (1990): 111. http://dx.doi.org/10.1094/pd-74-0111.
Der volle Inhalt der Quelle
18
Köklü, Gassan. „Occurrence of cereal viruses on wheat in Tekirdag, Turkey“. Phytoprotection 85, Nr. 1 (27.08.2004): 19–25. http://dx.doi.org/10.7202/008902ar.
Der volle Inhalt der QuelleAnnotation:
AbstractA survey for detection of barley yellow dwarf luteoviruses (BYDV-PAV and BYDV-MAV), cereal yellow dwarf polerovirus (CYDV-RPV), barley stripe mosaic hordeivirus (BSMV), wheat dwarf monogeminivirus (WDV) and brom mosaic bromovirus (BMV) was carried out during May 2003 covering seven cereal-growing counties of Tekirdag, Turkey. Two hundred sixty (260) wheat samples with yellowing, stunting, or striping were collected from 26 wheat fields. These samples were tested for the presence of six viruses by ELISA using polyclonal antisera. Serological tests showed that six tested viruses were present in Tekirdag, Turkey. Among the tested viruses, BYDV-MAV was the most commonly detected (25% of the 260 wheat samples), followed by BYDV-PAV (22.3%), WDV (16.5%), CYDV-RPV (8.5%), BMV (3.1%) and BSMV (1.5%). This study revealed the presence of six viruses in wheat fields in Tekirdag and reported for the first time BSMV and BMV on wheat in Turkey.
19
Pocsai, Emil, und István Murányi. „Yearly change of Wheat dwarf virus infection rate during 1996-2010 in winter barley“. Acta Agraria Debreceniensis, Nr. 39 (10.11.2010): 22–28. http://dx.doi.org/10.34101/actaagrar/39/2733.
Der volle Inhalt der QuelleAnnotation:
Yearly change of the infection of Wheat dwarf virus was studied in winter barley during 1996-2010. Surveys were carried out at Kompolt (Rudolf Fleischmann Research Institute, Róbert Károly College), in winter barley breeding lines showing leaf yellowing and stunting symptoms. In 1996, 250 winter barley samples were tested. During the period of 1997–2005, 100 samples were collected in each year. In 2006, 490 winter barley samples were tested. In 2007 and 2008 the number of samples collected was 500 from winter barley. In 2009 year 100, and in 2010 year 100 winter barley samples were collected for virus testing. Virus diagnosis was carried out using DASELISA for the detection of Wheat dwarf virus (WDV), Barley yellow dwarf viruses (BYDV-MAV, BYDV-PAV, BYDV-RMV, BYDV-SGV), and Cereal yellow dwarf virus (CYDV-RPV). During the ten of the last fifteen years, the occurrence of Wheat dwarf virus in infected samples exceeded those of other viruses causing leaf yellowing and dwarfing symptoms. There were years (1997, 2002, 2004, 2007, 2009 and 2010) when only the Wheat dwarf virus played the main role in development of yirus symtoms. A contrasting tendency can be observed between the degrees of infection of WDV and BYDV. With a rise of infection in the WDV, the proportion of BYDV decreased and vice-versa.
20
Griesbach, J. A., B. J. Steffenson, M. P. Brown, B. W. Falk und R. K. Webster. „Infection of Grasses by Barley Yellow Dwarf Viruses in California“. Crop Science 30, Nr. 6 (November 1990): 1173–77. http://dx.doi.org/10.2135/cropsci1990.0011183x003000060002x.
Der volle Inhalt der Quelle
21
Valverde, R. A. „Barley Yellow Dwarf Viruses Infecting Oats and Wheat in Louisiana“. Plant Disease 73, Nr. 11 (1989): 938. http://dx.doi.org/10.1094/pd-73-0938e.
Der volle Inhalt der Quelle
22
GUY, P. L. „Pasture ecology of barley yellow dwarf viruses at Sandford, Tasmania“. Plant Pathology 37, Nr. 4 (Dezember 1988): 546–50. http://dx.doi.org/10.1111/j.1365-3059.1988.tb02113.x.
Der volle Inhalt der Quelle
23
Abukraa, Hatem, Safaa Kumari und Fawzi Bshia. „Survey for Legume and Cereal Viruses in Libya“. Arab Journal for Plant Protection 40, Nr. 3 (2022): 222–30. http://dx.doi.org/10.22268/ajpp-40.3.222230.
Der volle Inhalt der QuelleAnnotation:
Abukraa, H., S.G. Kumari and F. Bshia. 2022. Survey for Legume and Cereal Viruses in Libya. Arab Journal of Plant Protection, 40(3): 222-230. https://doi.org/10.22268/AJPP-40.3.222230 A field survey was conducted during March and April 2010, to identify viral diseases affecting cereal and legume crops in different regions of Libya. A total of 3706 barley and wheat samples were collected randomly in addition to 187 symptomatic samples from 22 barley and 20 wheat fields. Moreover, 34 symptomatic legume samples were collected from two faba bean fields and one field each of of lentil, chickpea, Vicia sativa, Vicia ervillia and Vicia narbonesis. All samples were tested at ICARDA Virology Laboratory by tissue blot immunoassay (TBIA) using specific antibodies. Results of random cereal samples showed that Barley yellow dwarf virus-PAV (BYDVPAV) was more common (12.6%) in wheat and barley samples, followed by Wheat dwarf virus (WDV) (1.1%). In symptomatic samples, BYDV-PAV was also the most common (45 out of 187 samples tested were infected: 45/187), followed by WDV (23/187), Barley yellow striate mosaic virus (BYSMV) (40/187) and Maize streak virus (MSV) (7/187). In legume fields, Soybean dwarf virus (SbDV) 13 out of 34 samples tested were infected (13/34) was the most common, followed by Bean leafroll virus (BLRV) (12/34), Chickpea chlorotic stunt virus (CpCSV) (5/34) and Beet western yellows virus (BWYV) (4/34). Serological results were confirmed by amplification with polymerase chain reaction (PCR) using specific primers. This is the first report of WDV, MSV and BYSMV on cereal crops, and BLRV, BWYV, SbDV and CpCSV on legume crops in Libya. Keywords: Libya, Cereals, Legumes, Viruses, TBIA, PCR
24
Sward, RJ, und RM Lister. „The incidence of barley yellow dwarf viruses in wheat in Victoria“. Australian Journal of Agricultural Research 38, Nr. 5 (1987): 821. http://dx.doi.org/10.1071/ar9870821.
Der volle Inhalt der QuelleAnnotation:
Wheat crops from all major wheat-growing districts throughout Victoria were sampled during September 1984. Examination of pooled samples by enzyme-linked immunosorbent assay (ELISA) with an antiserum to a mixture of two barley yellow dwarf virus (BYDV) types ('V1') showed that 10 out of 26 crops were infected with BYDV and 3 out of 26 had a BYDV incidence greater than 10%. The overall loss in yield likely to result from BYDV was estimated at 2% with a far greater loss in some crops. Frozen-stored samples from four crops with high levels of BYDV were retested after one year with isolate-specific antisera. The results indicated that in these crops, PAV-related isolates were the most common, followed by RPV-related isolates.
25
Latorre, Isabel, Cleora J. D'Arcy und Leslie L. Domier. „Ultrasonic purification of two Illinois isolates of barley yellow dwarf viruses“. Canadian Journal of Plant Pathology 18, Nr. 4 (Dezember 1996): 424–28. http://dx.doi.org/10.1080/07060669609500599.
Der volle Inhalt der Quelle
26
Fattouh, F. A. „Luteovirus Relationships Assessed by cDNA Clones from Barley Yellow Dwarf Viruses“. Phytopathology 80, Nr. 10 (1990): 913. http://dx.doi.org/10.1094/phyto-80-913.
Der volle Inhalt der Quelle
27
Azzam, O. I. „Survey of Spring Oats for Barley Yellow Dwarf Viruses in Illinois“. Plant Disease 73, Nr. 7 (1989): 610. http://dx.doi.org/10.1094/pd-73-0610d.
Der volle Inhalt der Quelle
28
Pribék, Dalma, Emil Pocsai, Gyula Vida und Otto Veisz. „Presence of wheat dwarf virus, cereal yellow dwarf virus-rpv and barley yellow dwarf viruses in cereal species in Martonvásár“. Cereal Research Communications 34, Nr. 1 (März 2006): 625–28. http://dx.doi.org/10.1556/crc.34.2006.1.156.
Der volle Inhalt der Quelle
29
Wang, Ming-Bo, David C. Abbott, Narayana M. Upadhyaya, John V. Jacobsen und Peter M. Waterhouse. „Agrobacterium tumefaciens-mediated transformation of an elite Australian barley cultivar with virus resistance and reporter genes“. Functional Plant Biology 28, Nr. 2 (2001): 149. http://dx.doi.org/10.1071/pp00103.
Der volle Inhalt der QuelleAnnotation:
Efficient transformation of barley cv. Schooner was achieved using Agrobacterium delivery, hygromycin or bialaphos selection and embryogenic callus. Using this system, transgenic plants were generated that contained either the green fluorescent protein gene, or transgenes derived from barley yellow dwarf (BYDV) and cereal yellow dwarf (CYDV) viruses. Many of these plants contained 1–3 transgene copies that were inherited in a simple Mendelian manner. Some plants containing BYDV and/or CYDV derived transgenes showed reduced virus symptoms and rates of viral replication when challenged with the appropriate virus. The ability to transform Schooner is a significant advance for the Australian barley industry, as this elite malting variety is, and has for the last 15 years been, the most widely grown barley variety in eastern Australia.
30
Melinda Apró, Mária Papp, Eszter Cseh, Richard Gáborjányi, József Horváth und András Péter Takács. „The virus infection of South-Hungarian corn fields“. Acta Agraria Debreceniensis, Nr. 43 (30.10.2011): 52–55. http://dx.doi.org/10.34101/actaagrar/43/2637.
Der volle Inhalt der QuelleAnnotation:
The past years cereal diseases, including the virus diseases have been increased in Hungary as well as worldwide. The aim of our work was to survey the virus infection of South Hungarian wheat fields. Leaf samples were collected in Szeged at the experimental farm of Cereal Research Nonprofit Co., in April and Junes of 2009 and 2010. DAS ELISA tests were carried out using Loewe antisera of Brome mosaic virus (BMV), Barley yellow dwarf virus (BYDV), Barley stripe mosaic virus (BSMV), Brome streak mosaic virus (BStMV), Wheat dwarf virus (WDV), and Wheat streak mosaic virus (WSMV) and measured with Labsystem Multiscan RC Elisa reader at 405nm. In the samples of 2009 the Wheat dwarf and Wheat streak mosaic viruses were dominated. It was also significant the appearance of the. Barley yellow dwarf virus. 2010. was favourable for the spread of the virus vectors, therefore the incidence of virus diseases increased.
31
Mustafayev, E. S., L. Svanella-Dumas, S. G. Kumari, Z. I. Akparov und T. Candresse. „First Report of Barley yellow dwarf virus and Cereal yellow dwarf virus Affecting Cereal Crops in Azerbaijan“. Plant Disease 97, Nr. 6 (Juni 2013): 849. http://dx.doi.org/10.1094/pdis-07-12-0656-pdn.
Der volle Inhalt der QuelleAnnotation:
A field survey was conducted during the 2010/2011 growing season at the Absheron experimental station of the Genetic Resources Institute of Azerbaijan. A total of 49 cereal samples with yellowing and reddening symptoms were obtained from 12 bread wheats (Triticum aestivum), 25 durum wheats (T. durum), 11 wild or cultivated wheat relatives (T. dicoccoides, T. beoticum, T. monococcum, and T. turgidum), and one oat (Avena sativa). Samples were tested by tissue-blot immunoassay (2) using antisera against 7 cereal-infecting viruses: Barley stripe mosaic virus (BSMV), Wheat dwarf virus (WDV), Wheat streak mosaic virus (WSMV), Barley yellow mosaic virus (BaYMV), Barley yellow striate mosaic virus (BYSMV), Maize streak virus (MSV), and Barley yellow dwarf virus (BYDV). Strong positive reactions against the BYDV-PAV polyclonal antiserum were shown by 43 samples. To confirm, total RNAs from 10 of the positive samples (three bread wheat, three durum wheat, the oat, and one sample each of T. beoticum, T. turgidum, and T. dicoccoides) were submitted to RT-PCR with two primer pairs adapted in part from (3). Primers Luteo1F 5′TTCGGMSARTGGTTGTGGTCCA 3′ and YanR-new 5′TGTTGAGGAGTCTACCTATTTNG 3′ (adapted from primer YanR (3)) allow the specific amplification of viruses of the genus Luteovirus (including BYDV) while primers Luteo2F 5′TCACSTTCGGRCCGWSTYTWTCAG 3′ (adapted from primer Shu2a-F (3)) and YanR-new are specific for the genus Polerovirus (including Cereal yellow dwarf virus, CYDV). All 10 tested samples gave a positive amplification at the expected size (~545 bp) with the first primer pair, while only two samples, one from oat and one from the wild wheat relative T. dicoccoides, gave a positive amplification of the expected size (~383 bp) with the second primer pair. Sequencing of amplification products obtained with the Luteo1F/YanR-new primer pair confirmed the presence of BYDV-PAV in all samples (GenBank JX275850 to JX275857). The Azeri isolates were all similar (0 to 1.7% nucleotide divergence) except for one isolate (JX275855, from T. turgidum, 2.4 to 3.2% divergence). An Azeri BYDV-PAV isolate (JX275851, from bread wheat) showed 100% identity with a Latvian isolate (AJ563414) and with two isolates from Morocco (AJ007929 and AJ007918). These isolates belong to a group of widespread PAV isolates and are 99% identical with isolates from Sweden, the United States, China, France, and New Zealand. Sequencing of products obtained with the Luteo2F/YanR-new primers (JX294311 and JX294312) identified CYDV-RPV. The two Azeri sequences show ~3% nucleotide divergence and their closest relatives in GenBank are a range of CYDV-RPV isolates mostly from the United States, including EF521848 and EF521830, with ~4 to 5% divergence. Presence of CYDV was also confirmed using amplification with a CYD-specific primer pair (CYDV-fw-New 5′TTGTACCGCTTGATCCACGG 3′ et CYDV-rev-New 5′GTCTGCGCGAACCATTGCC 3′, both adapted from (1)) and sequencing of the amplification products. This is, to our knowledge, the first report of BYDV-PAV and CYDV-RPV infecting cultivated cereals and wild or cultivated wheat relatives in Azerbaijan. These viruses are responsible for serious disease losses in cereal crops worldwide (4). Their full impact on crops in Azerbaijan is yet to be seen. References: (1) M. Deb and J. M. Anderson. J. Virol. Meth. 148:17, 2008. (2) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (3) C. M. Malmstrom and R. Shu. J. Virol. Meth. 120:69, 2004. (4) W. A. Miller and L. Rasochovà. Ann. Rev. Phytopathol. 35:167, 1997.
32
Guy, PL, GR Johnstone und JE Duffus. „Occurrence and identity of barley yellow dwarf viruses in Tasmanian pasture grasses“. Australian Journal of Agricultural Research 37, Nr. 1 (1986): 43. http://dx.doi.org/10.1071/ar9860043.
Der volle Inhalt der QuelleAnnotation:
A total of 1048 pasture grass plants representing four species was sampled from five different sites in Tasmania and tested for infection with viruses known to infect them in other temperate regions of the world. The species were cocksfoot (Dactylis glomerata), tall fescue (Festuca arundinacea), perennial ryegrass (Lolium perenne), phalaris (Phalaris aquafica) and timothy (Phleum pratense). The only viruses isolated from the plants sampled were two luteovirus types which were recovered by aphids and caused symptoms of barley yellow dwarf (BYD) in oat indicator plants. A total of 140 plants (13%) were infected. One plant was infected with a vector specific RPV type [transmitted only by oat aphids (Rhopalosiphum padi) and serologically like the New York type RPV isolate], 138 were infected with PAV types (vector non-specific and serologically like the New York type PAV isolate) and one plant apparently contained a mixed PAV/RPV infection. The PAV isolates varied considerably in the intensity of symptoms which they induced in oat indicator plants. Viruses were isolated only from tall fescue and perennial ryegrass plants in this survey. The initial recovery of BYD isolates with oat aphids and with blackberry-cereal aphids (Sitobion fragariae) from the pasture samples was often not a good indication of their serological specificities, particularly in young pastures. These data provide the first information on the vector specificities of viruses which cause BYD in Australia and on their serological identity.
33
Liu, Yan, May Oo Khine, Peipei Zhang, Yumei Fu und Xifeng Wang. „Incidence and Distribution of Insect-Transmitted Cereal Viruses in Wheat in China from 2007 to 2019“. Plant Disease 104, Nr. 5 (Mai 2020): 1407–14. http://dx.doi.org/10.1094/pdis-11-19-2323-re.
Der volle Inhalt der QuelleAnnotation:
Diseases caused by insect-transmitted viruses are the predominant constraint to wheat production worldwide. However, detailed knowledge of virus incidence and dynamics in China in recent years is very limited. Here, major wheat-growing regions of China were surveyed over 10 years for insect-transmitted viruses, and 2,143 samples were collected (in 2007 to 2015) and analyzed by molecular hybridization or multiplex reverse-transcription PCR for barley yellow dwarf viruses (BYDVs: BYDV-GAV, -GPV, and -PAV) and wheat dwarf virus (WDV). In a 4-year survey (2016 to 2019), the incidence of eight insect-transmitted viruses (BYDVs, WDV, wheat yellow striate virus [WYSV], barley yellow striate mosaic virus [BYSMV], northern cereal mosaic virus [NCMV], and rice black-streaked dwarf virus [RBSDV]) was investigated, and BYDVs and WDV were widely distributed across China. BYDV-GAV (29.0% of the tested sample) was the most abundant, followed by BYDV-PAV (23.2%) from 2007 to 2015. From 2016 to 2019, however, BYDV-PAV had become the predominant species (39.5% positive of 952 samples tested), while the incidence of BYDV-GAV (13.4%) had declined. During the entire survey, the incidence of BYDV-GPV was very low in some locations in northwestern and northern China, and all eight viruses caused only local epidemics, not large-scale outbreaks throughout China. Two new cereal-infecting rhabdoviruses, leafhopper-transmitted WYSV and planthopper-transmitted BYSMV, were also found in China in recent years.
34
Guy, PL, GR Johnstone und DI Morris. „Barley yellow dwarf viruses in, and aphids on, grasses (including cereals) in Tasmania“. Australian Journal of Agricultural Research 38, Nr. 1 (1987): 139. http://dx.doi.org/10.1071/ar9870139.
Der volle Inhalt der QuelleAnnotation:
Samples of 2077 grasses and cereal plants representative of the Poaceae found in Tasmania were collected from a wide range of habitats throughout the State. Each sample was examined for infestation with aphids and then checked for infection with viruses causing barley yellow dwarf by both aphid transmission and serological tests. Aphid species found among the samples were Hyalopterus pruni, Rhopalosiphum maidis, R. padi and Sitobion fragariae. R. padi transmitted a vector non-specific type of barley yellow dwarf (PAV) and a vector specific type (RPV), either alone or together, while S. fragariae transmitted PAV alone and occasionally RPV when present in plants together with PAV. The other aphid species did not transmit. A total of 189 samples contained virus. Incidence was greatest in samples from the Bambusoideae subfamily (31%) and least in the Arundinoideae (4%). There was no difference in the level of infection between the native and introduced species that were represented. The Arundinoideae and Panicoideae were predominantly infected with RPV types, while the Pooideae, with the exception of Dactylis glomerata and Poa pratensis, were predominantly infected with PAV types. Many more infected plants contained both PAV and RPV (11.9%) than would have been expected had the two types of virus infected independently (2.5%). No infected plants were found among samples from 25 of the 56 species tested, and some of these may prove useful in breeding for resistance to barley yellow dwarf viruses.
35
Gray, Stewart M., Dawn M. Smith, Lia Barbierri und John Burd. „Virus Transmission Phenotype Is Correlated with Host Adaptation Among Genetically Diverse Populations of the Aphid Schizaphis graminum“. Phytopathology® 92, Nr. 9 (September 2002): 970–75. http://dx.doi.org/10.1094/phyto.2002.92.9.970.
Der volle Inhalt der QuelleAnnotation:
Schizaphis graminum is an important insect pest of several grain crops and an efficient vector of cereal-infecting luteoviruses and poleroviruses. We examined the virus transmission characteristics of several distinct populations and various developmental stages of the aphid. Seven well-characterized S. graminum biotypes maintained at the USDA-ARS laboratory in Stillwater, OK, and two biotypes maintained in New York (one collected in Wisconsin and the other collected in South Carolina) were tested for their ability to transmit five viruses that cause barley yellow dwarf disease (BYD). Four of the Oklahoma biotypes, which do not commonly colonize agronomic crops, and the Wisconsin biotype, were efficient vectors of several viruses. The three other Oklahoma biotypes, which do colonize agronomic crops, and the South Carolina biotype, were poor vectors of all five viruses. Thus, the vector specificity long associated with viruses causing BYD is not limited to the level of aphid species; it clearly extends to populations within a single species. S. graminum nymphs are reported to be more efficient vectors of Barley yellow dwarf virus (BYDV-SGV) than are adults. This was confirmed only for the Wisconsin biotype, but not for the other eight S. graminum biotypes. Thus, there does not appear to be a generalized developmentally regulated barrier to the transmission of BYDV-SGV in S. graminum. Furthermore, the developmentally regulated vector competency observed in the Wisconsin biotype did not extend to other viruses. BYDV-PAV and Cereal yellow dwarf virus-RPV were transmitted with similar efficiency by all S. graminum biotypes when acquired by nymphs or adults.
36
Belkahla, H., und H. Lapierre. „Serodetection of viruses associated to barley yellow dwarf (BYD) on cereals in Algeria“. Phytoprotection 80, Nr. 3 (12.04.2005): 169–77. http://dx.doi.org/10.7202/706190ar.
Der volle Inhalt der QuelleAnnotation:
Surveys on viruses associated with Barley Yellow Dwarf (BYD) and their vectors were carried out in Algerian cereal areas (Guelma, Constantine, Algiers, Sidi-belabes, Adrar) in 1997 and 1998. Rhopalosiphum padi was present in all zones of culture, whereas R. maidis, Sitobion avenae, S. fragariae and Schizaphis graminum had only local distributions. In most areas BYD-like symptoms, i.e. dwarfing and yellowing of barley (Hordeum vulgare), dwarfing and reddening of oat (Avena sativa) and wheat (Triticum aestivum), were observed. Serological tests were done on these crops using DAS-ELISA (RMV and SGV) or TAS-ELISA using monoclonal antibodies specifie to CYDV-RPV or using different variant specifie BYDV-PAV (CpA and CpB) and BYDV-MAV monoclonal antibodies. BYDV-PAV was prevalent and few plant samples carrying RMV, SGV, BYDV-MAV or CYDV-RPV were detected. The relative frequencies of BYDV-PAV CpA and CpB serotypes were variable depending on the area and the crop season. The range of symptoms induced on barley by both Algerian BYDV-PAV CpB and BYDV-PAV CpA serotypes was mild to severe. Twenty-one BYDV-MAV isolates were compared using monoclonal antibodies, which distinguish two serotypes of this virus. Only one serotype was detected. This same serotype is also the most prevalent in Europe.
37
Szunics, L., E. Pocsai, Lu Szunics und G. Vida. „VIRAL DISEASES ON CEREALS IN CENTRAL HUNGARY“. Acta Agronomica Hungarica 48, Nr. 3 (01.12.2000): 237–50. http://dx.doi.org/10.1556/aagr.48.2000.3.3.
Der volle Inhalt der QuelleAnnotation:
In recent years viral diseases have become more frequent on cereals in Hungary. In the breeding nursery of the Martonvásár Institute, which contains stocks with very diverse genetic backgrounds, wheat suffered major attacks by viruses in 1972, 1976, 1980, 1981, 1982, 1986, 1990, 1996 and 1998. The winter barley plots incurred great damage in 1989 and 1990, while a large proportion of the durum wheat was destroyed in 1996. In 1982 barley yellow dwarf virus caused an epidemic in Fejér County and on many farms the damage was so great that the fields had to be ploughed up. The following nine viruses, which impose a threat to cereals, have been identified in Hungary to date: 1966: barley yellow dwarf luteovirus (BYDV), 1984: barley stripe mosaic hordeivirus (BSMV), 1985: wheat streak mosaic tritimovirus (WSMV), 1986: brome mosaic bromovirus (BMV), cocksfoot mottle sobemovirus (CfMV), 1988: wheat dwarf mastrevirus (WDV), 1989: barley yellow mosaic bymovirus (BYMV), 1990: agropyron mosaic rymovirus (AgMV) and ryegrass mosaic rymovirus (RyMV). The most frequent and widespread of these are BYDV and WDV, which are thus able to cause the greatest quantitative and qualitative damage. On the basis of six years’ data (1994–2000), neither BYDV nor WDV could be isolated from 35.7% of 1163 samples exhibiting leaf yellowing and dwarfness. This indicates that other viruses pathogenic to cereals can induce similar symptoms. Among the plants showing symptoms of virus infection, 47.3% were attacked by WDV alone, in proportions ranging from 28.8% in barley to 69.7% in triticale. The degree of infection changed from year to year: WDV was isolated from 0.0% of symptom-exhibiting plants in 1999, from 48.5% in 1997 and from 94.0% in 2000. Barley yellow dwarf virus was only isolated alone from 9.5% of the samples, while it was isolated together with wheat dwarf virus from 7.5% of the samples. Considerable differences were observed between the cereal species: only 5.6% of the durum wheat samples were infected with BYDV, while this figure was 28.1% for oats. There was also a significant year effect. In 1996 triticale was not infected, while in 2000 5.0% of the plants exhibited symptoms and in 1994 45.5% of the plants were hosts to the BYD virus. Under Hungarian conditions all five known serotypes can be found, though in different proportions depending on the cereal species and the year. The most frequent is RPV (27.4%), followed by PAV (26.9%), SGV (15.6%), MAV (15.3%) and RMV (14.8%). In samples collected from oats only the PAV serotype was found. The MAV serotype has never been isolated from triticale. The dominant serotype was RPV (60.7%) in wheat samples, SGV (36.0%) in durum wheat and RMV (29.1%) in barley.
38
Achon, M. A., L. Serrano, C. Ratti und C. Rubies-Autonell. „First Detection of Wheat dwarf virus in Barley in Spain Associated with an Outbreak of Barley Yellow Dwarf“. Plant Disease 90, Nr. 7 (Juli 2006): 970. http://dx.doi.org/10.1094/pd-90-0970a.
Der volle Inhalt der QuelleAnnotation:
Severe dwarfing, yellowing, and crop failure were observed on barley in northeastern Spain during March and April of 2003. Leaves from 106 plants collected from 15 barley fields were analyzed using enzyme-linked immunosorbent assay (ELISA) with commercial antisera (Loewe Biochemica, Munich) specific for Barley mild mosaic virus (BaMMV), Barley yellow mosaic virus (BaYMV), the PAV and MAV serotypes of Barley yellow dwarf virus (BYDV), Barley yellow striate mosaic virus (BYSMV), Barley stripe mosaic virus (BSMV), Brome mosaic virus (BMV), Brome streak mosaic virus, (BStMV), Cereal yellow dwarf virus (CYDV), Wheat streak mosaic virus (WSMV), Wheat spindle streak mosaic virus (WSSMV), Soilborne cereal mosaic virus (SBCMV), and Wheat dwarf virus (WDV). In 70 samples, BYDV-PAV was the sole virus detected; in 20 other samples, this virus was detected in association with WDV, WSMV, BaMMV, and/or BaYMV. Mixed infections were further analyzed using reverse transcriptase-polymerase chain reaction (RT-PCR) or PCR with specific primers that amplify 445 bp of BaMMV (3), 433 bp of BaYMV (1), 600 bp of WSMV (primer 1: 5′CGAAACGCAGCG TTATTTC3′, primer 2: 5′CATCTGAAG GGCTTGACG3′), and 1,200 bp of WDV (4). Eight samples gave the expected amplicons for WDV, two samples gave the expected amplicon for BaMMV, and one sample gave the BaMMV and BaYMV amplicons. No samples gave the amplicon for WSMV. In addition, 10 samples that were positive with ELISA for BYDV, either as a single or as multiple infections with other viruses, were analyzed with specific primers that amplify 600 bp of the BYDV genome (2) and all gave the expected RT-PCR product. ELISA and RT-PCR results agreed completely for WDV and BYDV samples, but agreed poorly for BaMMV and BaYMV (three of seven ELISA-positive samples). PCR products of WDV were subsequently cloned and sequenced. Sequence analysis confirmed the presence of WDV in these barley samples. This report shows the high occurrence of BYDV in barley fields and its association with BaMMV, BaYMV, and WDV infections that induces barley crop failure. To our knowledge, this is the first detection of WDV in Spain. References: (1) M. A. Achon et al. Plant Dis.87:1004, 2003. (2). E. S. G. Canning et al. J. Virol. Methods 56:191, 1996. (3) D. Hariri et al. Eur. J. Plant Pathol. 106:365, 2000. (4) A. Kvarnheden et al. Arch Virol. 147:206, 2002.
39
Kaddachi, Imène, Yosra Souiden, Dhouha Achouri und Foued Chéour. „Barley Yellow Dwarf Virus (BYDV): Characteristics, Hosts, Vectors, Disease Symptoms and Diagnosis“. International Journal of Phytopathology 3, Nr. 3 (31.12.2014): 155–60. http://dx.doi.org/10.33687/phytopath.003.03.0804.
Der volle Inhalt der QuelleAnnotation:
Barley Yellow Dwarf (BYD) is a serious Luteovirus disease that affects small grain production worldwide. The aphid-transmitted virus (BYDV) infects practically all members of the Graminae (Poaceae) and is responsible for serious losses in cultivated species such as barley, wheat and oats. The study of BYD is complex, as it involves interactions among a vector, a plant and a virus. Hence, symptom expression is highly dependent on environmental conditions, serotypes plant genetic background and physiological stage of inoculation. Consequently, tolerance to BYDV is also difficult to study and understand. This review explores the basic biology of BYD, its symptoms, its viruses and yield losses it can cause.
40
Moriones, Enrique, Félix Ortego, Manuel Ruiz-Tapiador, Carmen Gutiérrez, Pedro Castañera und Fernando García-Arenal. „Epidemiology of RPV- and PAV-like barley yellow dwarf viruses on winter barley in central Spain“. Crop Protection 12, Nr. 3 (Mai 1993): 224–28. http://dx.doi.org/10.1016/0261-2194(93)90113-w.
Der volle Inhalt der Quelle
41
Walls, Joseph, Edwin Rajotte und Cristina Rosa. „The Past, Present, and Future of Barley Yellow Dwarf Management“. Agriculture 9, Nr. 1 (18.01.2019): 23. http://dx.doi.org/10.3390/agriculture9010023.
Der volle Inhalt der QuelleAnnotation:
Barley yellow dwarf (BYD) has been described as the most devastating cereal grain disease worldwide causing between 11% and 33% yield loss in wheat fields. There has been little focus on management of the disease in the literature over the past twenty years, although much of the United States still suffers disease outbreaks. With this review, we provide the most up-to-date information on BYD management used currently in the USA. After a brief summary of the ecology of BYD viruses, vectors, and plant hosts with respect to their impact on disease management, we discuss historical management techniques that include insecticide seed treatment, planting date alteration, and foliar insecticide sprays. We then report interviews with grain disease specialists who indicated that these techniques are still used today and have varying impacts. Interestingly, it was also found that many places around the world that used to be highly impacted by the disease; i.e. the United Kingdom, Italy, and Australia, no longer consider the disease a problem due to the wide adoption of the aforementioned management techniques. Finally, we discuss the potential of using BYD and aphid population models in the literature, in combination with web-based decision-support systems, to correctly time management techniques.
42
Stufkens, M. W., und J. A. Farrell. „Control of barley yellow dwarf virus (BYDV) disease of barley in mid-Canterbury“. Proceedings of the New Zealand Weed and Pest Control Conference 40 (08.01.1987): 167–71. http://dx.doi.org/10.30843/nzpp.1987.40.9928.
Der volle Inhalt der Quelle
43
D’Arcy, Cleora J. „Reliable Detection of Barley Yellow Dwarf Viruses in Field Samples by Monoclonal Antibodies“. Plant Disease 76, Nr. 3 (1992): 273. http://dx.doi.org/10.1094/pd-76-0273.
Der volle Inhalt der Quelle
44
Power, Alison G., Elizabeth T. Borer, Parviez Hosseini, Charles E. Mitchell und Eric W. Seabloom. „The community ecology of barley/cereal yellow dwarf viruses in Western US grasslands“. Virus Research 159, Nr. 2 (August 2011): 95–100. http://dx.doi.org/10.1016/j.virusres.2011.05.016.
Der volle Inhalt der Quelle
45
Farquhar, M. B., C. S. Winefield und C. C. Eady. „Dry matter yield and the prevalence of barley yellow dwarf and ryegrass mosaic viruses in old and young perennial ryegrass“. Journal of New Zealand Grasslands 79 (01.01.2017): 165–71. http://dx.doi.org/10.33584/jnzg.2017.79.571.
Der volle Inhalt der QuelleAnnotation:
Abstract Modern pasture management of perennial ryegrass results in reduced reseeding and increased reliance on asexual tiller multiplication. This may exacerbate viral impact by providing longer-living hosts to exploit, thus the effect of ryegrass age on sward performance and viral load was investigated. Genetically similar 10 year old field plants and 10 year old seed were used to produce 'mini-swards' of 'old' (tiller derived) and 'young' (seed derived) ryegrass lines. Dry matter yield and viral load (ryegrass mosaic, and barley yellow dwarf) were assessed over 10 months. For all lines the old mini-swards produced less biomass (4-29%) and viral load was significantly greater at most time points. Cause and effect between viral load and yield were not proven as other factors such as genetic drift, epigenetics, or other latent pests or diseases could not be ruled out. Keywords: Lolium perenne, barley yellow dwarf virus, ryegrass mosaic virus
46
Rastgou, M., B. Khatabi, A. Kvarnheden und K. Izadpanah. „Relationships of Barley yellow dwarf virus-PAV and Cereal yellow dwarf virus-RPV from Iran with viruses of the family Luteoviridae“. European Journal of Plant Pathology 113, Nr. 3 (November 2005): 321–26. http://dx.doi.org/10.1007/s10658-005-1231-y.
Der volle Inhalt der Quelle
47
Balaji, Boovaraghan, Dennis B. Bucholtz und Joseph M. Anderson. „Barley yellow dwarf virus and Cereal yellow dwarf virus Quantification by Real-Time Polymerase Chain Reaction in Resistant and Susceptible Plants“. Phytopathology® 93, Nr. 11 (November 2003): 1386–92. http://dx.doi.org/10.1094/phyto.2003.93.11.1386.
Der volle Inhalt der QuelleAnnotation:
Reliable detection and quantification of barley and cereal yellow dwarf viruses (YDVs) is a critical component in managing yellow dwarf diseases in small grain cereal crops. The method currently used is enzyme-linked immunosorbent assay (ELISA), using antisera against the coat proteins that are specific for each of the various YDVs. Recently, quantitative real-time reverse-transcription polymerase chain reaction (Q-RT-PCR) has been used to detect bacterial and viral pathogens and to study gene expression. We applied this technique to detect and quantify YDVs using primers specific for Barley yellow dwarf virus-PAV (BYDV-PAV) and Cereal yellow dwarf virus-RPV (CYDV-RPV) coat protein genes because of the higher sensitivity of RT-PCR and the advantage of using a real-time PCR instrument. This Q-RT-PCR was used to detect BYDV and CYDV, and to examine disease development in a resistant wheatgrass, a resistant wheat line, a susceptible wheat line, and a susceptible oat line. BYDV-PAV and CYDV-RPV were detected as early as 2 and 6 h, respectively, in susceptible oat compared with detection by ELISA at 4 and 10 days postinoculation. BYDV-PAV RNA accumulated more rapidly and to a higher level than CYDV-RPV RNA in both oat and wheat, which may account for PAV being more prevalent and causing more severe viral disease than CYDV. Q-RT-PCR is reproducible, sensitive, and has the potential to be used for examining yellow dwarf disease and as a rapid diagnostic tool for YDVs.
48
Francki, M. G., M. G. Francki, H. W. Ohm, H. W. Ohm, J. M. Anderson und J. M. Anderson. „Novel germplasm providing resistance to barley yellow dwarf virus in wheat“. Australian Journal of Agricultural Research 52, Nr. 12 (2001): 1375. http://dx.doi.org/10.1071/ar01020.
Der volle Inhalt der QuelleAnnotation:
The lack of suitable genes in existing wheat germplasm collections makes breeding for specific traits a difficult task. Although tolerance to barley yellow dwarf viruses (BYDV) has been reported in wheat accessions, there are no suitable levels of resistance to BYDV, so genes are sought from wild relatives. The ability for Thinopyrum species to inhibit replication of BYDV makes them attractive sources of resistance for germplasm development. Breeding programs are exploiting Thinopyrum species to develop wheat germplasm resistant to BYDV. The transfer of genes from Thinopyrum into wheat by wide crossing and selecting progeny using molecular markers identified suitable material to some strains of BYDV. The implementation of molecular marker technology has been useful for rapid selection of wheat lines with resistance to some strains of BYDV in a breeding program. However, it is now clear that Thinopyrum species contain a number of resistance genes on different genomes and homoeologous chromosomes. In order to achieve broad-spectrum resistance to the various serotypes of the BYDV complex it will be best to combine a number of these genes. Research efforts are now focussed on introgressing other genes from Thinopyrum into wheat that provide resistance to several additional strains of BYDV. Molecular markers will play an important role during selection in pyramiding genes to develop wheat germplasm with broadspectrum BYDV resistance.
49
Bukvayová, N., M. Henselová, V. Vajcíková und T. Kormanová. „Occurrence of dwarf virus of winter wheat and barley in several regions of Slovakiaduring the growing seasons 2001–2004“. Plant, Soil and Environment 52, No. 9 (17.11.2011): 392–401. http://dx.doi.org/10.17221/3457-pse.
Der volle Inhalt der QuelleAnnotation:
The aim of the study was to monitor the incidence and to detect the presence of viruses of yellow dwarfness in barley (BYDV-PAV, BYDV-RMV), of yellow dwarfness in cereals (CYDV-RPV) and dwarfness in wheat (WDV) in stands of winter wheat and winter barley in Slovakia. During the period 2001–2004 a total of 292 samples coming from 150 localities were analyzed. This involved 190 samples of winter wheat (39 varieties and 13 breeding lines) and 102 samples of winter barley (17 varieties and 7 breeding lines). The detection of viruses was carried out with the aid of the method DAS and TAS ELISA. During the years surveyed, the occurrence of the various viruses differed. In 2001, the most represented virus proved to be the WDV (68%); in 2002, it was the strain PAV of the virus BYDV (93%); in 2003, the most numerous were the virus WDV (71%) and the strain PAV of virus BYDV (67%). Similarly, in 2004, two viruses were represented about evenly, WDV and BYDV-PAV (75%). The more frequent of the two species was the virus BYDV, with the strain BYDV-PAV predominating. The intensity of viral infection of stand cereals differed during the experimental years, being highest in 2002 when the blight occurred both locally and also on a large-scale. The highest frequency of the disease was in Western and Eastern Slovakia.
50
Ilbaği, H., A. Çitir, A. Kara, M. Uysal und F. Azzouz Olden. „First report of Barley Yellow Dwarf Viruses (BYDVs) on dicotyledonous weed hosts in Turkey“. Cereal Research Communications 47, Nr. 2 (Juni 2019): 292–303. http://dx.doi.org/10.1556/0806.47.2019.15.
Der volle Inhalt der Quelle