Zeitschriftenartikel zum Thema „Archers – Japon“

Screening the Japanese Gothic Actress M stands on a platform placed on the desks in a large auditorium, surrounded by students who stare despondently at her. She turns, seeking the camera over her shoulder; she pushes her white dress down as a fan makes it swell and rise above her knees. Dwarfed by the auditorium's heavy pointed arches, Actress M's pale, overexposed figure flickers like a photographic ghost. She has become Marilyn Monroe.

Resumen Dada la popularidad que el libro Zen en el arte del tiro con arco del alemán Eugen Herrigel (1884-1955) tuvo en la segunda mitad del siglo XX en Europa y América, esta investigación pretende entender por qué, haciendo un análisis profundo, también desde las críticas recibidas. Estudiar el contexto histórico y cultural en el que se gestó ha resultado fundamental. Descubrir la enculturación llevada a cabo por Herrigel, y releer la obra desde la traducción cultural y la narrativa empática son algunos de los aspectos investigados. A la luz de los resultados nos preguntamos si la obra seguirá teniendo validez y encontrando ávidos lectores. La metodología empleada ha tenido en consideración tanto la interpretación cultural del punto de partida, Japón, como del contexto de llegada, los lectores europeos y americanos. Abstract Given the popularity of the book Zen in the Art of Archery by the German Eugen Herrigel (1884-1955) in the second half of the 20th century in Europe and America, this research aims to understand why, by making an in-depth analysis of it, including the criticisms it received. It was essential to study the specific historical and cultural context in which it was created. Discovering the enculturation carried out by Herrigel, and rereading the work from the perspective of cultural translation and empathetic narrative are some of the aspects investigated. In the light of the results, we wonder whether they will prevent this book from continuing to be valid and find avid readers. In my approach the methodology of my work has always been based on taking into consideration both the cultural interpretation of the point of departure, Japan, and the context of arrival, the European and American readers. Keywords Kyūdō, Kyūjutsu, Shadō, Cultural interpretation, Interculturalism.

Abstract The Yōshi kangoshō (Notes on Chinese Words by Master Yako, ca. 720) is a bilingual Sinitic-Japanese dictionary, now lost and surviving only in indirect transmission thanks to quotations in the Wamyōruijushō (Categorized Notes on Japanese Nouns, ca. 934) by Minamoto no Shitagō (911–983). The lexical domains covered by the Yōshi kangoshō deal with technical knowledge, such as terminology for anatomy and medicine, archery, constructions, shipping and shipbuilding, the textile sector (clothes, belts, shoes, sewing, weaving, sericulture, dyeing, etc.), hippology and stock-breeding, agriculture, cooking, carpentry, sea and earth products, kinship. In this paper, I propose a reconstruction of the Yōshi kangoshō, furnishing the complete list of its quotations. I would therefore like to propose that the Yōshi kangoshō should be reconsidered as an educational tool for learning terminologies, and that it was particularly useful for the technical education of clerks.

Egglestonichthys fulmensp. nov. (Teleostei: Gobiidae) is described on the basis of a single specimen (21.7 mm in standard length) collected from 250 m depth off Okinawa Island, Ryukyu Islands, Japan. The new species is characterized by the following combination of characters: anal-fin rays I, 9; pectoral-fin rays 17, lower rays not free from membrane; longitudinal scale series 25; transverse scales 8; pre-dorsal-fin scale rows 8; cheek and opercle naked; pelvic frenum absent; caudal fin lanceolate, its length 32.2% of SL; interorbital width very narrow, 1.2% of HL (much narrower than pupil diameter); no spicules or odontoid processes on outer surface of gill arches; and body whitish, upper half with broken zigzag pattern of bright yellow patches and associated scattered black melanophores in fresh specimens (melanophores retained in preserved specimens). Several characters, including pectoral-fin ray count, interorbital width, and coloration uniquely distinguish the new species from congeners.

A new species of sardine, Sardinella electra, is described on the basis of 18 specimens collected from the Ryukyu Islands, Japan. The new species closely resembles Sardinella hualiensis (Chu & Tsai 1958) in that both species have a caudal fin with black tips, a black spot on the dorsal-fin origin, and both have lateral scales with centrally continuous or overlapping longitudinal striae. However, the new species is distinguished from S. hualiensis by its higher total gill-raker counts on the first, second, third and fourth gill arches, and on the posterior face of the third gill arch (105–121, 107–120, 88–104, 65–82, and 25–31, respectively, vs. 87–107, 83–105, 67–90, 53–69, and 13–27), and in having scales with few perforations and lacking pores posteriorly (vs. scales with numerous perforations and pores on their posterior margins).

The information reflected in mid-oceanic sedimentary deposits provides critical constraints for reconstructing past global environmental changes. Available data from extant oceans, however, are limited to the Early Jurassic and younger ages, because older oceanic plates have been subducted. This article explains methods for obtaining information on pre-Jurassic mid-oceanic conditions by conducting fieldwork on older orogenic belts exposed on land. The key point is the identification of ancient accretionary complexes (AC), not along currently active margins but within older orogenic belts in continental domains, particularly by recognizing ocean plate stratigraphy (OPS) that contains mid-oceanic strata, as demonstrated by studies of on-land exposed ancient AC in Japan and elsewhere. In this paper, six examples of retrieved mid-oceanic sedimentary data are introduced, in which significant records on the following unique events in the pre-Jurassic world are archived: 1) the extinction-related Paleozoic–Mesozoic boundary superanoxia (based on data from the Jurassic AC in SW Japan); 2) the Permian Kamura cooling event in the mid-Panthalassa (ditto); 3) the Neoproterozoic snowball Earth evidence from the mid-Iapetus Ocean (based on data from the Neoproterozoic–Cambrian AC in Wales, UK); 4) the discovery of enigmatic Ediacaran (Neoproterozoic) microfossils from a mid-oceanic atoll complex (based on data from the Cambrian AC in southern Siberia, Russia); and 5) and 6) Early Archean (3.8 and 3.5 Ga) biogenic signatures in mid-oceanic deep-sea environments (based on data from the Eoarchean AC at Isua in Greenland, and the Paleoarchean one in Pilbara, Western Australia). These results demonstrate the great utility of OPS analysis for understanding pre-Jurassic lost oceans, including the early biological and environmental evolution of the globe. SOMMAIRELes informations enregistrées dans les dépôts sédimentaires médio-océaniques constituent des contraintes logiques qui permettent de reconstituer les changements environnementaux globaux. Cela dit, l’information sur de grands pans de fonds océaniques est limitée aux fonds océaniques Jurassiques précoces et plus jeunes, parce que les fonds océaniques plus anciens ont été subduits. Le présent article explique des méthodes permettant d’obtenir de l’information sur les milieux médio-océaniques pré-jurassiques par des levés de terrain sur des ceintures orogéniques affleurant sur terre. L’idée centrale consiste à circonscrire d’anciens complexes d’accrétion (AC), hors des marges actives actuelles, soit dans les ceintures orogéniques plus anciennes au sein des domaines continentaux, en y repérant des contextes stratigraphiques de plaques océaniques (OPS) qui renferment des strates médio-océaniques, comme ça a été fait lors études d’AC affleurant au Japon et ailleurs. Le présent document décrit six exemples de contextes stratigraphiques de plaques océaniques où on trouve des indices importants des événements pré-jurassiques uniques suivants : 1) l’extinction liée à la super-anoxie de la limite Paléozoïque-Mésozoïque (à partir des données d’un AC jurassique dans le sud-ouest du Japon); 2) l’épisode de refroidissement permien de Kamura du Panthalassa moyen; 3) l’épisode néoprotérozoïque de « Terre boule de neige » conservé par l’océan mi-japétien (selon les données de l’AC néoprotérozoïque-cambrien dans les Wales au Royaume-Uni); 4) la découverte de microfossiles édiacariens (Néoprotérozoïque) d’un complexe d’atolls médio-océaniques (selon les données d’un AC cambrien du sud-est sibérien, Russie); et 5 et 6) des signatures biogéniques de milieux médio-océaniques profonds de l’Archéen précoce (3,8 et 3,5 Ga) (selon les données d’un AC éoarchéen à Isua au Groenland, et d’un AC paléoarchéen à Pilbara, Australie). Ces résultats montrent la grande utilité de l'analyse de la stratigraphie des plaques océaniques pour comprendre les océans pré-Jurassique, de même que l'évolution des débuts de la vie et des milieux de vie sur Terre.

Kudoa (Myxosporea: Multivalvulida) parasites are critical pathogens in marine and freshwater fish associated with significant economic losses and reduced market prices caused by post-mortem myoliquefaction or numerous cysts on muscles. In the present study, large yellow croakers infected by Kudoa were found during fish disease surveillance in China in November 2020 and used for morphological observation and characterization using light DIC microscopy and electron microscopy. Numerous creamy-white oval plasmodia were observed in muscles and on the surface of brain cartilage, gill arches, and serosal surfaces. The spores were considerably longer and thicker than previously reported Kudoa, with protruding polar filaments (PFs) in the mature spores, fingertip-shaped apical projections (APs), and polar capsules. Phylogenetic analyses with SSU rDNA, LSU rDNA, and mitochondrial DNA showed that the Kudoa-infected sample (LcK-2020) had the highest similarity to Kudoa iwatai reported in Japan. Based on the morphological characterization and phylogenetic analysis, it could be concluded that the sample LcK-2020 was infected by Kudoa iwatai, which would be the first report of Kudoa iwatai infection in large yellow croaker in China.

The new sardine Sardinella alcyone n. sp. is described on the basis of 19 specimens collected from the Ryukyu Islands, Japan and southwestern Taiwan. The new species closely resembles Sardinella pacifica Hata & Motomura 2019, both species having lateral scales with centrally discontinuous striae, a dark spot on the dorsal-fin origin, the pelvic fin with 8 rays, deciduous body scales, and very similar numbers of prepelvic and postpelvic scutes, scale rows in the longitudinal series, and pseudobranchial filaments. However, the new species is distinguished from S. pacifica by having lower total gill-raker counts on the first, second, third and fourth gill arches, and on the posterior face of the third gill arch (99–112, 97–115, 79–98, 62–77, and 25–31, respectively, vs. 112–137, 112–148, 95–127, 78–106, and 30–43), and greater pectoral fin (20.7–23.4% SL vs. 18.2–20.8%), pelvic fin (11.9–13.1% SL vs. 10.3–11.9%), maxilla (10.8–12.4% SL vs. 9.3–10.9%), lower jaw (11.8–13.4% SL vs. 10.4–11.6%), and pre-anal-fin length (77.4–82.3% SL vs. 72.9–79.3%) proportions.

ABSTRACT Objective: To investigate the maxillary and mandibular anterior crown width/height ratio and its relation to various arch perimeters, arch length, and arch width (intercanine, interpremolar, and intermolar) groups. Materials and Methods: The calculated sample size was 128 subjects. The crown width/height, arch length, arch perimeter, and arch width of the maxilla and mandible were obtained via digital calliper (Mitutoyo, Japan). A total of 4325 variables were measured. The sex differences in the crown width and height were evaluated. Analysis of variance was applied to evaluate the differences between arch length, arch perimeter, and arch width groups. Results: Males had significantly larger mean values for crown width and height than females (P ≤ 0.05) for maxillary and mandibular arches, both. There were no significant differences observed for the crown width/height ratio in various arch length, arch perimeter, and arch width (intercanine, interpremolar, and intermolar) groups (P ≤ 0.05) in maxilla and mandible, both. Conclusions: Our results indicate sexual disparities in the crown width and height. Crown width and height has no significant relation to various arch length, arch perimeter, and arch width groups of maxilla and mandible. Thus, it may be helpful for orthodontic and prosthodontic case investigations and comprehensive management.

The pre-Cretaceous history of Borneo remains relatively poorly studied. Limited exposures of Palaeozoic and lower Mesozoic rocks are located in NW Kalimantan and in West Sarawak, an area interpreted as the West Borneo basement. Lower Mesozoic sedimentary rocks in West Sarawak were analysed to study their depositional environments and implications for the tectonic evolution. Upper Triassic turbidites in West Sarawak, exposed in the northern part of Kuching city, informally named the Kuching Formation, are the deep marine equivalent to the more widespread, shallow marine Sadong Formation. The Kuching Formation comprises thinly-bedded stacked turbidites, consisting of incomplete Bouma sequences, with multiple, erosive channel sandstone bodies deposited under upper flow regime waning flows. Thin debrites with abundant coaly-material are interbedded with the channel sandstones. The Kuching and Sadong formations both contain volcaniclastic detritus that was derived from the westward-subducting Palaeo-Pacific plate, forming a Triassic Andean-type arc which extended from West Borneo in the south to southern China, Taiwan and Japan in the north. Palaeoproterozoic to Archean detrital zircons in the Kuching and Sadong formations reveal a Cathaysian basement source, providing insights into the nature of the West Borneo basement. Quartz-mica schists (Kerait Schist, Tuang Formation) in fault-contact with the two sedimentary successions may have formed during accretion.

In the 19th Century, white American women of the middle and upper classes began to travel abroad in significant numbers for the first time in history. Prior to the 19th Century, and with the exception of such women as Abigail Adams and Martha Bayard, who accompanied their parents or husbands on diplomatic missions, American women as a rule traveled only about the countryside or to frontier settlements. Beginning in the 1820s, however, and escalating after the Civil War, the prototypes of Henry James's Isabel Archer and Edith Wharton's Undine Spragg set out by the hundreds to see the world, from Europe to the Middle East and from Africa to Japan and China. The greatest number of them visited the British Isles and continental Europe. As early as 1835, according to Paul R. Baker, some fifty American women visited Rome during Holy Week. Many women were among the fifty thousand Americans who, in 1866 alone, traveled to Europe. According to Mrs. John Sherwood in 1890, there were “more than eleven thousand virgins who semi-yearly migrate[d] from America to the shores of England and France.” Women found their way to virtually all parts of the world, as the book-length travel accounts of women (far fewer than the numbers of women who traveled) show. Women published accounts of twenty journeys to China, seventeen to Palestine, eleven to India, twenty-two to Egypt, two to the East Indies, twenty to Greece, three to Arabia, six to Algeria, and four to Africa, as well as travel in Central and South America, Cuba, the Yucatan, and Jamaica.

Purpose ARCHER 1050, a randomized, open-label, phase III study of dacomitinib versus gefitinib in treatment-naïve patients with advanced non–small-cell lung cancer (NSCLC) and activating mutations in EGFR, reported significant improvement in progression-free survival with dacomitinib. The mature overall survival (OS) analysis for the intention-to-treat population is presented here. Patients and Methods In this multinational, multicenter study, patients age 18 years or older (≥ 20 years in Japan and Korea) who had an Eastern Cooperative Oncology Group performance status of 0 or 1 and newly diagnosed NSCLC with activating mutations in EGFR (exon 19 deletion or exon 21 L858R) were enrolled and randomly assigned in a 1:1 manner to dacomitinib (n = 227) or gefitinib (n = 225). Random assignment was stratified by race (Japanese, Chinese, other East Asian, or non-Asian) and EGFR mutation type. The final OS analysis was conducted with a data cutoff date of February 17, 2017; at that time 220 deaths (48.7%) were observed. Results During a median follow-up time of 31.3 months, 103 (45.4%) and 117 (52.0%) deaths occurred in the dacomitinib and gefitinib arms, respectively. The estimated hazard ratio for OS was 0.760 (95% CI, 0.582 to 0.993; two-sided P = .044). The median OS was 34.1 months with dacomitinib versus 26.8 months with gefitinib. The OS probabilities at 30 months were 56.2% and 46.3% with dacomitinib and gefitinib, respectively. Preliminary subgroup analyses for OS that are based on baseline characteristics were consistent with the primary OS analysis. Conclusion In patients with advanced NSCLC and EGFR activating mutations, dacomitinib is the first second-generation epidermal growth factor receptor tyrosine kinase inhibitor (TKI) to show significant improvement in OS in a phase III randomized study compared with a standard-of-care TKI. Dacomitinib should be considered one of the standard treatment options for these patients.

Background and Study Aim. National types of martial arts have been created and are functioning in Ukraine, which are gaining more and more popularity in the world. Modern sports science investigates the history of the creation of national types of martial arts. The purpose of the article is to investigate the historical origins of the emergence and development of Ukrainian and Eastern national martial arts. Material and Methods. 217 sources of information on the history of traditional Ukrainian martial culture were analyzed. Bibliometric methods of processing the received information were used. After the initial analysis, 34 sources were selected, which fully correspond to the purpose of the study. Results. The stages of the formation of the Ukrainian nation are quite fully covered in scientific historical sources. The mutual connection between the development of society and its martial culture is shown. It is reliably known about the presence of military training in the era of the Trypil culture (approx. 5400 - 2750 BC). It is shown that the complication of social relations and the development of material production created conditions for the separation of the caste of professional warriors. Professional soldiers conducted specialized training for weapons and physical fitness. In combat units, young men were trained for combat operations. The military training of professional soldiers reached its maximum development during the period of existence of Kyivan Rus (IX-XIII centuries of the new era). Literary sources provide information that the national physical culture developed at the same time as the complex of military-applied youth training. The training included fencing with various types of weapons, archery and types of unarmed combat. On the banks of the Dnieper, on the island of Khortytsia, the Cossacks formed the military society of Zaporizhzhya Sich (16th - 18th centuries of the new era) and on a systematic basis conducted preparations for conducting military operations. Varieties of fencing, wrestling and fist fighting were developed at a high level. Data given in scientific sources indicate that the Cossack martial arts became the basis of modern Ukrainian national types of martial arts. In Japan, in the process of the foundation of the country (1603-1868 years of the new era), a national martial culture was formed based on the training of samurai warriors. Conclusions. The bibliometric analysis of publications on the history of Ukraine determined the correlation between the stages of the formation of the Ukrainian nation and the development of the military culture of Ukraine. The significant influence of religion on the consciousness of Ukrainians makes it possible to divide martial arts into pre-Christian (Trypylian and Indo-European cultures) and Christian (Kyiv Rus, Zaporizhzhya Sich). A comparison of the emergence and development of traditional national martial arts of Ukraine and Japan makes it possible to highlight the general patterns of formation of modern national types of martial arts.

Abstract Hydrothermal iron-oxyhydroxide chimney mounds (iron mounds) have been discovered in a fishing port in Nagahama Bay, located on the southwest coast of Satsuma Iwo-Jima Island, south of Kyushu Island, Japan. In the fishing port, uncovered ∼1.0-m-high iron mounds in shallow waters formed under relatively calm conditions. Typically, the fishing port has orange-colored turbid waters that mix with outer ocean waters during high tide. Colloidal iron-oxyhydroxides form due to the oxidation of ferrous iron in hydrothermal waters (pH = 5.5; temperature = 55 °C) as they mix with seawater. The mounds are made of two types of material: hard, dark brown–orange, high-density material; and soft, brownish orange–yellow, low-density material. Computed tomography scans of the harder iron mound material revealed a cabbage-like structure consisting of micropipe structures with diameters of 2–5 mm. These micropipes have relatively hard walls made of iron oxyhydroxides (FeOH) and are identified as discharge pipes. Nucleic acid staining genetic sequencing and scanning electron microscope observations suggest that the mounds formed mainly from bacterial stalks with high concentrations of FeOH colloidal matter. In the harder parts of the mounds, these “fat stalks,” which contain oxyhydroxide colloidal aggregates, are entwined and concentrated. The softer material contains twisted stalk-like structures, which are coated with FeOH colloidal particles. Deoxyribonucleic acid (DNA) examination of the iron mounds revealed the presence of iron-oxidizing bacteria, especially at the mound surface. We estimate that the iron mounds accumulated at a rate of ∼1700 tons/1000 m2/yr. This is an order of magnitude higher than the rate of FeOH sedimentation via chemical precipitation of FeOH colloids within the fishing port. This suggests that biogenic activity, resulting in the production of entwined FeOH stalks, leads to the rapid accumulation of FeOH beds and that biogenic activity within the water mass rich in FeOH colloids is an efficient means of generating thick iron-rich sedimentary sequences. As such, we propose that some ancient iron formations may have also formed through the biogenic production of FeOH stalks rather than solely through chemical sedimentation in a water mass rich in FeOH colloids. It appears that these rapidly forming biogenic FeOH iron mounds, distributed over a wide area of ocean floor, are also relatively protected from erosion and diagenetic alteration (reduction). Previous studies have reported that ancient iron formations were commonly deposited in deeper environments via direct iron oxidation from the water column in a ferruginous ocean. However, there are several hydrothermal vent inflows preserved with FeOH that would have formed appropriate redox boundary conditions in an otherwise anoxic ocean. Under these conditions, iron mound mat-type sedimentary deposits might have formed and been well preserved and affected by early diagenesis where higher heat flow occurred in the Archean ocean. The FeOH mounds in Nagahama Bay provide an example of the iron formation sedimentary environment and important information for estimating the past depositional state of iron formations.

The lack of the ability to determine the individual standard angle characteristics of the position of the teeth and the technical provision of their control often does not lead to the expected result and in each case requires individualization, the vision of which is based, as a rule, on the experience and intuition of the doctor. In order to solve such a situation, in addition to improving the positioning protocols of the non-removable equipment, the physician should be able to clearly identify the individual angular characteristics of the tooth-jaw system. The purpose of the study – by studying computer tomography and cephalometric indices and conducting direct stepwise regression analysis to develop in Ukrainian adolescents with orthognathic bite mathematical models of individual angular positions of teeth. Using the Veraviewepocs 3D device, Morita (Japan) at 38 young men (aged from 17 to 21) and 55 young women (aged from 16 to 20 years) with normal occlusion close to orthognathic bite received and analyzed dental tomograms and lateral teleroentgenograms. Cephalometric points and measurements were performed according to recommendations of A. M. Schwarz, J. McNamara, W. B. Downs, R. A. Holdway, G. P. F. Schmuth, C. C. Steiner and C. H. Tweed. Anatomical points were determined taking into account the recommendations of A. E. Athanasiou and S. I. Doroshenko and Y. A. Kulginsky. The simulation of CT indexes describing the position of individual teeth relative to each other, to the bone cranial structures and the profile of adolescents with orthognathic bite, depending on the metric characteristics of the skull, which are usually unchanged during surgical and orthodontic treatment, as well as the width, lengths, angles and positions of the upper and lower jaws that may be altered by orthodontic surgery done. The statistical processing of the obtained results was carried out in the license package “Statistica 6.0” using a direct stepwise regression analysis. It was found that in young men of 40 possible models, 23 were constructed with a determination coefficient R2 of 0.557 to 0.832, while in young women, only 8 models with a determination coefficient R2 of 0.581 to 0.832. Moreover, in the young men – of 10 possible 9 models of vestibular-tongue inclination of corresponding teeth (R2 from 0.557 to 0.832) were constructed; out of 10 possible 5 models of mesio-distal inclination of corresponding teeth (R2 from 0.558 to 0.769) constructed; of the possible 14 constructed 6 models of rotation of the corresponding teeth (R2 from 0.579 to 0.737); and in young women - there are only 5 models of vestibular-tongue inclination of the corresponding teeth (R2 from 0.603 to 0.665). In addition, in both young men and young women, models of the size of the inter-incision angle (R2 0.748 in young men and 0.581 in young women) were constructed, the magnitude of the angle of inclination of the lower canine in the jet plane (R2 respectively 0.729 and 0.793), and the magnitude of the inclination of the closure planes relative to the palatal plane (R2 respectively 0.808 and 0.832). In the analysis it was found that in young men, most frequently models included - indicator WITS (7.0%); angle GL_SNPOG (5.4%); distance S_E, angle ММ, angle NSBA (by 4.7%); angle AB_NPOG, angle N_POG_, distance N_SE, coefficient N_SP_SP, angle P_OR_N (by 3.9%). In young women, most frequently models included – angle N_POG_ (14.3%); angle AB_NPOG (10.2%); indicator WITS (8.2%); angle ММ, angle ANB, length of the branch of the mandible R_ASC (by 6.1%). Thus, in the work with the help of the method of step-by-step regression with inclusion, among Ukrainian adolescence, on the basis of peculiarities of computer-tomographic and teleroentgenography indices, reliable models of computer-tomographic individual linear angular characteristics of the position of teeth necessary for constructing the correct three-dimensional geometry of dental arches are developed and analyzed.

In 2022, the Swiss branch of the international publishing house Springer published a book, a collection of papers entitled Military Geoscience: A Multifaceted Approach to the Study of Warfare. It consists of selected contributions by international researchers in the field of military geoscience, presented at the 13th International Conference on Military Geosciences, held in Padua in June 2019. The first paper is by the editors, Aldin Bondesan and Judy Ehlen, and provides a brief overview of understanding the concept of military geoscience as an application of geology and geography to the military domain, and the historical development of the discipline. It should also be pointed out that the International Conferences on Military Geosciences (ICMG), which organises this biennial international conference, has over the past two decades also covered other aspects, such as conflict archaeology. The publication is further divided into three parts. The first part comprises three contributions covering military geoscience up to the 20th century. The first paper, by Chris Fuhriman and Jason Ridgeway, provides an insights into the Battle of Marathon through topography visualisation. The geography of the Marathon field, the valley between Mt. Cotroni and Mt. Agrieliki, allowed the Greek defenders to nullify the advantage of the Persian cavalry and archers, who were unable to develop their full potential. This is followed by a paper by Judy Ehlen, who explores the geological background of the Anglo-British coastal fortification system along the English Channel, focusing on the Portsmouth area of Hampshire. The author thus points out that changes in artillery technology and naval tactics between the 16th and 19th centuries necessitated changes in the construction of coastal fortifications, both in terms of the form of the fortifications and the method of construction, including the choice of basic building materials, as well as the siting of the fortifications in space. The next article is then dedicated to the Monte Baldo Fortress in north-eastern Italy, between Lake Garda and the Adige River. In his article, Francesco Premi analyses the presence of the fortress in the transition area between the Germanic world and the Mediterranean, and the importance of this part of Italy (at the southernmost part of the pre-Alpine mountains) in military history, as reflected in the large number of important military and war relics and monuments. The second part of the book, which is the most comprehensive, focuses on the two World Wars and consists of nine papers. The first paper in this part provides an analysis of the operation of trench warfare training camps in the Aube region of France. The group of authors, Jérôme Brenot, Yves Desfossés, Robin Perarnau, Marc Lozano and Alain Devos, initially note that static warfare training camps have not received much attention so far. Using aerial photography of the region dating from 1948 and surviving World War II photographic material, they identified some 20 sites where soldiers of the Entente forces were trained for front-line service in trenches. Combined archaeological and sociological fieldwork followed, confirming the presence of these camps, both through preserved remains and the collective memory. The second paper in this volume also concerns the survey on trenches, located in northern Italy in the Venezia Tridentina Veneto area in northern Italy. The authors Luigi Magnini, Giulia Rovera, Armando De Guio and Giovanni Azzalin thus use digital classification methods and archaeology to determine how Italian and Austro-Hungarian First World War trenches have been preserved or, in case they have disappeared, why this was the case, both from the point of view of the natural features as well as from the anthropological point of view of the restoration of the pre-war settings. The next paper, by Paolo Macini and Paolo Sammuri, analyses the activities of the miners and pioneers of the Italian Corps of Engineers during the First World War, in particular with regard to innovative approaches to underground mine warfare. In the Dolomites, the Italian engineers, using various listening devices, drilling machinery and geophysical methods, developed a system for drilling underground mine chambers, which they intended to use and actually used to destroy parts of Austro-Hungarian positions. The paper by Elena Dai Prà, Nicola Gabellieri and Matteo Boschian Bailo concerns the Italian Army's operations during the First World War. It focuses on the use of tactical maps with emphasis on typological classification, the use of symbols, and digital cartography. The authors thus analysed the tactical maps of the Italian Third Army, which were being constantly updated by plotting the changes in positions and tactical movements of both sides. These changes were examined both in terms of the use of new symbols and the analysis of the movements. This is followed by a geographical presentation of the Italian Army's activities during the First World War. The authors Paolo Plini, Sabina Di Franco and Rosamaria Salvatori have thus collected 21,856 toponyms by analysing documents and maps. The locations were also geolocated to give an overview of the places where the Italian Army operated during the First World War. The analysis initially revealed the complexity of the events on the battlefields, but also that the sources had misidentified the places of operation, as toponyms were misidentified, especially in the case of homonyms. Consequently, the area of operation was misidentified as well. In this respect, the case of Vipava was highlighted, which can refer to both a river and a settlement. The following paper is the first on the Second World War. It is the article by H. A. P. Smith on Italian prisoners of war in South Africa. The author outlines the circumstances in which Italian soldiers arrived to and lived in the southern African continent, and the contribution they made to the local environment and the society, and the remnants of their presence preserved to the present day. In their article, William W. Doe III and Michael R. Czaja analyse the history, geography and significance of Camp Hale in the state of Colorado. In doing so, they focus on the analysis of the military organization and its impact on the local community. Camp Hale was thus the first military installation of the U.S. Army, designated to test and train U.S. soldiers in mountain and alpine warfare. It was here that the U.S. 10th Mountain Division was formed, which concluded its war path on Slovenian soil. The Division's presence in this former camp, which was in military use also after the war until 1965, and in the surrounding area is still visible through numerous monuments. This is followed by a paper by Hermann Häusler, who deals with German military geography and geology on the Eastern Front of the Second World War. A good year before the German attack on the Soviet Union, German and Austrian military geologists began an analysis of the topography, population and infrastructure of the European part of the Soviet Union, which led to a series of publications, including maps showing the suitability of the terrain for military operations. During the war, military geological teams then followed the frontline units and carried out geotechnical tasks such as water supply, construction of fortifications, supply of building materials for transport infrastructure, and analysis of the suitability of the terrain for all-terrain driving of tracked and other vehicles. The same author also authored a paper in the next chapter, this time focusing on the activities of German military geologists in the Adriatic area. Similarly to his first contribution, the author presents the work of military geologists in northern Italy and north-western Slovenia. He also focuses on the construction of fortification systems in northern Italy and presents the work of karst hunters in the Operational Zone of the Adriatic Littoral. Part 3 covers the 21st century with five different papers (chapters). The first paper by Alexander K. Stewart deals with the operations of the U.S. Army specialised teams in Afghanistan. These Agribusiness Development Teams (ADTs) carried out a specialised form of counter-guerrilla warfare in which they sought to improve the conditions for the development of local communities through agricultural assistance to the local population. In this way, they were also counteracting support for the Taliban. The author notes that, in the decade after the programme's launch, the project had only a 19% success rate. However, he stresses that such forms of civil-military cooperation should be present in future operations. The next chapter, by Francis A. Galgan, analyses the activities of modern pirates through military-geographical or geological methods. Pirates, who pose a major international security threat, are present in four regions of the world: South and South-East Asia, East Africa and the Gulf of Guinea. Building on the data on pirate attacks between 1997 and 2017, the author shows the temporal and spatial patterns of pirate activities, as well as the influence of the geography of coastal areas on their activities. This is followed by another chapter with a maritime topic. Mark Stephen Blaine discusses the geography of territorial disputes in the South China Sea. Through a presentation of international law, the strategic importance of the sea (sea lanes, natural resources) and the overlapping territorial claims of China, Taiwan, Malaysia, Vietnam and Indonesia, the author shows the increasing level of conflict in the area and calls for the utmost efforts to be made to prevent the outbreak of hostilities or war. M. H. Bulmer's paper analyses the Turkish Armed Forces' activities in Syria from the perspective of military geology. The author focuses on the Kurdish forces' defence projects, which mainly involved the construction of gun trenches, observation towers or points, tunnels and underground facilities, as well as on the Turkish armed forces' actions against this military infrastructure. This involved both mountain and underground warfare activities. While these defensive infrastructures proved to be successful during the guerrilla warfare period, direct Turkish attacks on these installations demonstrated their vulnerability. The last chapter deals with the current operational needs and limitations of military geosciences from the perspective of the Austrian Armed Forces. Friedrich Teichmann points out that the global operational interest of states determines the need for accurate geo-data as well as geo-support in case of rapidly evolving requirements. In this context, geoscience must respond to new forms of threats, both asymmetric and cyber, at a time when resources for geospatial services are limited, which also requires greater synergy and an innovative approach to finding solutions among multiple stakeholders. This also includes increased digitisation, including the use of satellite and other space technologies. The number of chapters in the publication illustrates the breadth and depth of military geoscience, as well as the relevance of geoscience to past, present and future conflicts or military operations and missions. The current military operations in Ukraine demonstrate the need to take into account the geo-geological realities of the environment and that terrain remains one of the decisive factors for success on the battlefield, irrespective of the technological developments in military engineering and technology. This can also be an incentive for Slovenian researchers and the Slovenian Armed Forces to increase research activities in the field of military geosciences, especially in view of the rich military and war history in the geographically and geologically diverse territory of Slovenia.

Books reviewed: China Richard Madsen, China's Catholics: tragedy and Hope in an Emerging Civil SocietyWang Zheng, Women in the Chinese Enlightenment: oral and Textual HistoriesYuezhi Zhaom, Media, Market, and Democracy in China: between the Party Line and the Bottom LineAlan Knight and Yoshiko Nakano (eds), Reporting Hong Kong: foreign Media and the Handover Japan, Korea Joel R. Cohn, Studies in the Comic Spirit in Modern Japanese FictionJeong‐Hyun Shin, The Trap of History: understanding Korean Short StoriesSidney Hayden Lesbirel, NIMBY Politics in Japan: energy Siting and the Management of Environmental ConflictG. Cameron Hurst III. Armed Martial Arts of Japan: swordsmanship and Archery South Asia G. V. Tagare, Śaivism. Some GlimpsesLata Mani, Contentious Traditions: the Debate on Sati in Colonial IndiaVincanne Adams, Doctors for Democracy: health Professionals in the Nepal RevolutionT. Scarlett Epstein, A. P. Suryanarayana and T. Thimmegowda, Village Voices. Forty Years of Rural Transformation in South India Southeast Asia M. Ngaosyvathn and P. Ngaosyvathn, Paths to Conflagration: fifty Years of Diplomacy and Warfare in Laos, Thailand, and Vietnam, 1778‐1828.Patrick Vinton Kirch, The Lapita Peoples: ancestors of the Oceanic WorldHelen Creese (ed and trans), Pãrthãyana, The Journeying of Pãrtha: an Eighteenth‐century Balinese Kakawin General Asia Frank B. Tipton, The Rise of Asia: economics, Society and Politics in Contemporary Asia

Abstract Zen may be most commonly associated with Japan, but the ‘art of Zen’ was made in Germany. This article reconstructs the reception of Zen Buddhism in Nazi Germany as an extension of the regime’s project to transform Christianity. Although Japanese reformers emphasized Zen’s universal qualities, in Nazi Germany it became associated instead with a combination of völkisch nationalism and spiritual mysticism mirroring Nazi aspirations for a ‘positive’ German form of Christianity. That project may have been discredited after 1945, but the image of Zen cultivated by Nazi ideologues transitioned more or less seamlessly into the post-war New Age movement. This phenomenon thus merits attention not only for what it reveals about the extent to which Germany remained engaged in global intellectual and cultural currents during the Nazi era but also in complicating our historical understanding of how Zen came to be part of the contemporary global vernacular.

Abstract Background Anthropogenic gadolinium (Gd), originating from Gd-based contrast agents (GBCAs) used in magnetic resonance imaging (MRI), is widely identified in the aquatic environment with concerns about toxicity and accumulation. We aimed to present new data on anthropogenic Gd in the Tone River, which has the largest drainage area in Japan, and then to compare the current data with those obtained in 1996. Methods The water samples were collected on August 9−10, 2020, at 15 different locations of the Tone River in Japan. The concentrations of the rare earth elements (REEs) were measured by inductively coupled plasma-mass spectrometry and normalized to Post-Archean Australian Shale to construct shale-normalized REE patterns. The degree of Gd-anomaly was defined as the percentage of anthropogenic Gd to the geogenic background and used to compare the water samples from different locations. Pearson’s correlation coefficients were calculated. Results All the samples displayed positive Gd anomalies. The Gd-anomaly ranged from 121 to 6,545% and displayed a repeating decrease-and-increase trend. The Gd-anomaly showed strong positive correlations to the number of hospitals (r = 0.88; p < 0.001) and their MRI units (r = 0.89; p < 0.001). Conclusions Our study revealed notable anomalies of Gd concentrations in river water in Japan, with strong positive correlations to the number of major hospitals and their MRI units. Compared with the previous report in 2000, the Gd-anomaly in Tone River increased from 851% (sampled in 1996) to 6,545%, i.e., 7.7 times, reflecting the increased use of GBCAs in hospitals. Relevance statement Notable Gd concentration anomalies in river water in Japan were observed. This result underlines the importance of more extensive research on anthropogenic gadolinium, and investigations of risks to human health as well as the development of effective removal technologies may be necessary. Key points • All water samples from Tone River displayed positive Gd anomalies. • The Gd anomalies increased to 7.7 times higher over the past 24 years. • Correlations between Gd values and the number of hospitals and MRI units were observed. Graphical Abstract

AbstractAccess to better health care anticipates that more medical devices can be found alongside skeletal remains. Those employed in oral rehabilitation, with available brands or batch/series, can prove useful in the identification process. A previous study in the Colecção de Esqueletos Identificados Século XXI described macroscopically the dental prostheses. An unusual case of a dental device with chromatic alterations demonstrated to require a more detailed analysis. The individual, a 53-year-old male, exhibited, at both arches, a fixed tooth-supported rehabilitation, with gold colouring classified initially as a gold-palladium alloy. Simultaneously, a green pigmentation deposit was observable in bone and prosthesis. This investigation aimed to verify the elemental composition of the dental prosthesis alloy. Elemental analysis was performed by X-ray fluorescence in two regions (labial surface of the prosthetic crown and the root surface of the lower right lateral incisor). Both the spectra and the qualitative results found higher levels of copper and aluminium, followed by nickel, iron, zinc, and manganese. No gold or palladium was detected. The most probable assumption is that a copper-aluminium alloy was used, as its elemental concentration corresponds to those measured in similar devices. Dental prostheses of copper-aluminium alloys have been made popular since the 1980s, particularly in the USA, Japan, and Eastern Europe. Apart from the biographical information, it was also known that the individual’s place of birth was an Eastern European country, which highlighted the usefulness of this type of information when dealing with missing people cases.

Abstract Most tonalite–trondhjemite–granodiorite (TTG) suites are Archean–Palaeoproterozoic in age, but those of Neoproterozoic–Phanerozoic age are scarce. A rare Ediacaran high-Al TTG suite has been identified at the Fannani Igneous Complex (FIC) in the northern Arabian–Nubian Shield, which is essentially composed of amalgamated Neoproterozoic island-arc Pan-African composite terranes that contain several ophiolitic sutures. The FIC exhibits a wide range of SiO2, Al2O3, Sr and Zr, shows moderate rare earth element (REE) enrichment, and K, Ti, Nb, Y and heavy REE depletion. It is a subsolvus suite with clear orogenic affinities and strong arc-geochemical signatures. The precise U–Pb zircon thermal ionization mass spectrometry age obtained (607.4 ± 1.95 Ma) indicates oceanic subduction extended to late stages of the East African Orogeny. The FIC exhibits 87Sr/86Sr compositions of 0.70346–0.71091 (Sr(i) ratio, 0.70284), and 143Nd/144Nd of 0.51254–0.51270 (ϵNd(t) = +5.12 to +7.16), typical of modern oceanic-arc rocks (as Japan-arc basalts), and suggestive of mantle sources and island-arc settings. The FIC possesses low values of Yb (1.55 ppm), Nb (14 ppm) and Y (24 ppm), and high ratios of Sr/Y (27), Zr/Sm (46) and Nb/Ta (11.8), typical of magmas produced by anatexis of a basaltic slab. Partial melting models show that the FIC magma was generated by melting (F = 0.25–0.50) of a subducted oceanic crust transformed into eclogite, leaving 10–25% garnet in the residue. The FIC and similar complexes produced via slab melting during the closure of the Mozambique Ocean formed large juvenile belts along the East African Orogen that sutured East and West Gondwana together into a united supercontinent.

Bupleurum chinensis is an important traditional medicine with anti-inflammatory and immunomodulatory effects in China (Navarro et al. 2001). So far, the diseases reported on B. chinensis were caused by fungi (rust and root rot) and virus (Cucumber mosaic virus and Broad bean wilt virus 2) (Zhang et al. 2009). However, no diseases caused by nematodes were reported previously. Root-knot nematodes (Meloidogyne spp.) are one of the most destructive plant-parasitic nematodes with strong adaptability and diversity, infecting more than 5,500 plant species (Azevedo de Oliveira et al. 2018). In October 2020, symptoms of dwarf, leaf yellowing and roots with numerous knots on B. chinensis in several fields were observed in Dingxi City, Gansu Province, Northwest China (N 35°19′42″; E 104°2′24″). Subsequently, hundreds of eggs, mature males and females were exuded from dissection of washed root-knots. Morphological characteristics of females, males and J2s were examined under the optical microscope. The perineal patterns of females (n=15) were oval-shaped with a slightly dorsal arches, and the lateral lines and punctations on anus were observed in some specimens. Measurements (mean ± SD, range) of females(n=20): L (body length) = (525.23 ± 59.88 μm, 439.72 to 659.93 μm), W (maximum body width) = (403.92 ± 57.17 μm, 311.01 to 513.34 μm), St (stylet length) = (11.28 ± 1.05 μm, 9.82 to 12.91 μm), MBW (width of the median bulb) = (31.13 ± 3.32 μm, 23.66 to 35.55 μm), MB (distance from anterior end to center of median oesophageal bulb valve) = (64.45 ± 3.44 μm, 58,62 to 71.92 μm), and DGO (dorsal gland orifice to stylet) = (3.79 ± 0.60 μm, 2.72 to 5.00 μm). Male (n=20): L= (1038.25 ± 90.34 μm, 877.28 to 1206.12 μm), St= (18.13 ± 1.48 μm, 15.10 to 20.12 μm), a (body length divided by greatest body width) = (31.77 ± 4.03 μm, 23.29 to 41.16μm), MBW= (10.97 ± 0.78 μm, 9.05 to 12.31 μm), MB= (64.81 ± 3.45 μm, 59.59 to 71.38 μm), DGO= (4.05 ± 0.47 μm, 3.11 to 5.08 μm), and Spic (spicule length) = (22.57 ± 1.91 μm, 19.26 to 26.43 μm). J2 (n=25): L= (381.73 ± 25.85μm, 336.96 to 419.98 μm), St= (10.52 ± 1.03 μm, 9.15 to 12.14 μm), a= (24.35 ± 2.10 μm, 20.45 to 28.29 μm), DGO= (3.02 ± 0.42 μm, 2.42 to 3.79 μm), c (body length divided by tail length) = (8.90 ± 0.86 μm, 7.71 to 10.48 μm), and c' (tail length divided by body width at anus) = (4.18 ± 0.50 μm, 3.47 to 5.04 μm). According to morphological characteristics, root-knot nematode infecting B. chinensis was preliminarily identified as Meloidogyne hapla Chitwood, 1949 (Whitehead 1968). To further verify this result, DNA was extracted from ten individual females, the ITS region and the D2-D3 region of 28S rDNA were amplified using the primer TW81/AB28(GTTTCCGTAGGTGAACCTGC/ ATATGCTTAAGTTCAGCGGGT) (Subbotin et al. 2000) D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/ TCGGAAGGAACCAGCTACTA) (De Ley et al. 1999), respectively. PCR products were purified and sequenced. The sizes of ITS region and D2-D3 region of 28S rDNA were 557 bp and 762 bp, respectively. The sequence of ITS region (GenBank accession number: OK030559) was 99.46%-99.82% identical to the M. hapla from China (MT490918), New Zealand (JX465560), Australia (AF516722) and Japan (LC030357). The sequence of D2-D3 region of 28S rDNA (GenBank accession number: OK030558) was 99.58%-100.00% identical to the M. hapla from Canada (MW182329), Ethiopia (KJ645432), USA (KP901086) and China (MN446015). Furthermore, fragments obtained using the specific primers of M. hapla (Mh-F/Mh-R) were 462 bp, which also was consistent with that of M. hapla (Feng et al. 2008). Through morpho-molecular characterization, the root-knot nematodes on B. chinensis in China were identified as M. hapla. Six seedlings of B. chinensis were planted in 16 cm diameter, 20 cm deep plastic pots with sterilized soil in the greenhouse at 20-25℃ for pathogenicity test. After planted 21 days, 2000 J2s/pot were inoculated, six seedling uninoculated were used as control. After 90 days, all inoculated plants showed similar symptoms observed in the field, and nematode reproduction factor (final population density/initial population density) was 1.47. Meanwhile, no symptoms were observed on control plants. These results proved that the nematode infecting B. chinensis is M. hapla. To our knowledge, this is the first report of B. chinensis as a new host of M. hapla in China. Bupleurum chinensis is widely planted in Gansu Province, the plant species cultivated across an area of about 19.1 million hectares, accounting for 40% of the China's total output (Wang et al. 2017). The root system of B. chinensis infected M. hapla is stunned and short, seriously affect the quality of medicinal materials, and restrict the development of the local Chinese herbal medicine industry.

Diaspora This article looks at diaspora through the transformations of an established public service broadcaster, the BBC World Service, by considering some of the findings of the AHRC-funded Tuning In: Contact Zones at the BBC World Service, which is part of the Diasporas, Migration and Identities program. Tuning In has six themes, each of which focuses upon the role of the BBC WS: The Politics of Translation, Diasporic Nationhood, Religious Transnationalism, Sport across Diasporas, Migrating Music and Drama for Development. The World Service, which was until 2011 funded by the Foreign Office, was set up to cater for the British diaspora and had the specific remit of transmitting ideas about Britishness to its audiences overseas. Tuning In demonstrates interrelationships between the global and the local in the diasporic contact zone of the BBC World Service, which has provided a mediated home for the worldwide British diaspora since its inception in 1932. The local and the global have merged, elided, and separated at different times and in different spaces in the changing story of the BBC (Briggs). The BBC WS is both local and global with activities that present Britishness both at home and abroad. The service has, however, come a long way since its early days as the Empire Service. Audiences for the World Service’s 31 foreign language services, radio, television, and Internet facilities include substantive non-British/English-speaking constituencies, rendering it a contact zone for the exploration of ideas and political opportunities on a truly transnational scale. This heterogeneous body of exilic, refugee intellectuals, writers, and artists now operates alongside an ongoing expression of Britishness in all its diverse reconfiguration. This includes the residual voice of empire and its patriarchal paternalism, the embrace of more recent expressions of neoliberalism as well as traditional values of impartiality and objectivism and, in the case of the arts, elements of bohemianism and creative innovation. The World Service might have begun as a communication system for the British ex-pat diaspora, but its role has changed along with the changing relationship between Britain and its colonial past. In the terrain of sport, for example, cricket, the “game of empire,” has shifted from Britain to the Indian subcontinent (Guha) with the rise of “Twenty 20” and the Indian Premier League (IPL); summed up in Ashis Nandy’s claim that “cricket is an Indian game accidentally discovered by the English” (Nandy viii). English county cricket dominated the airways of the World Service well into the latter half of the twentieth century, but the audiences of the service have demanded a response to social and cultural change and the service has responded. Sport can thus be seen to have offered a democratic space in which new diasporic relations can be forged as well as one in which colonial and patriarchal values are maintained. The BBC WS today is part of a network through which non-British diasporic peoples can reconnect with their home countries via the service, as well as an online forum for debate across the globe. In many regions of the world, it continues to be the single most trusted source of information at times of crisis and disaster because of its traditions of impartiality and objectivity, even though (as noted in the article on Al-Jazeera in this special issue) this view is hotly contested. The principles of objectivity and impartiality are central to the BBC WS, which may seem paradoxical since it is funded by the Commonwealth and Foreign office, and its origins lie in empire and colonial discourse. Archive material researched by our project demonstrates the specifically ideological role of what was first called the Empire Service. The language of empire was deployed in this early programming, and there is an explicit expression of an ideological purpose (Hill). For example, at the Imperial Conference in 1930, the service was supported in terms of its political powers of “strengthening ties” between parts of the empire. This view comes from a speech by John Reith, the BBC’s first Director General, which was broadcast when the service opened. In this speech, broadcasting is identified as having come to involve a “connecting and co-ordinating link between the scattered parts of the British Empire” (Reith). Local British values are transmitted across the globe. Through the service, empire and nation are reinstated through the routine broadcasting of cyclical events, the importance of which Scannell and Cardiff describe as follows: Nothing so well illustrates the noiseless manner in which the BBC became perhaps the central agent of national culture as its cyclical role; the cyclical production year in year out, of an orderly, regular progression of festivities, rituals and celebrations—major and minor, civic and sacred—that mark the unfolding of the broadcast year. (278; italics in the original) State occasions and big moments, including those directly concerned with governance and affairs of state, and those which focused upon sport and religion, were a big part in these “noiseless” cycles, and became key elements in the making of Britishness across the globe. The BBC is “noiseless” because the timetable is assumed and taken for granted as not only what is but what should be. However, the BBC WS has been and has had to be responsive to major shifts in global and local—and, indeed, glocal—power geometries that have led to spatial transformations, notably in the reconfiguration of the service in the era of postcolonialism. Some of these massive changes have involved the large-scale movement of people and a concomitant rethinking of diaspora as a concept. Empire, like nation, operates as an “imagined community,” too big to be grasped by individuals (Anderson), as well as a material actuality. The dynamics of identification are rarely linear and there are inconsistencies and disruptions: even when the voice is officially that of empire, the practice of the World Service is much more diverse, nuanced, and dialogical. The BBC WS challenges boundaries through the connectivities of communication and through different ways of belonging and, similarly, through a problematisation of concepts like attachment and detachment; this is most notable in the way in which programming has adapted to new diasporic audiences and in the reworkings of spatiality in the shift from empire to diversity via multiculturalism. There are tensions between diaspora and multiculturalism that are apparent in a discussion of broadcasting and communication networks. Diaspora has been distinguished by mobility and hybridity (Clifford, Hall, Bhaba, Gilroy) and it has been argued that the adjectival use of diasporic offers more opportunity for fluidity and transformation (Clifford). The concept of diaspora, as it has been used to explain the fluidity and mobility of diasporic identifications, can challenge more stabilised, “classic” understandings of diaspora (Chivallon). A hybrid version of diaspora might sit uneasily with a strong sense of belonging and with the idea that the broadcast media offer a multicultural space in which each voice can be heard and a wide range of cultures are present. Tuning In engaged with ways of rethinking the BBC’s relationship to diaspora in the twenty-first century in a number of ways: for example, in the intersection of discursive regimes of representation; in the status of public service broadcasting; vis-à-vis the consequences of diverse diasporic audiences; through the role of cultural intermediaries such as journalists and writers; and via global economic and political materialities (Gillespie, Webb and Baumann). Tuning In thus provided a multi-themed and methodologically diverse exploration of how the BBC WS is itself a series of spaces which are constitutive of the transformation of diasporic identifications. Exploring the part played by the BBC WS in changing and continuing social flows and networks involves, first, reconfiguring what is understood by transnationalism, diaspora, and postcolonial relationalities: in particular, attending to how these transform as well as sometimes reinstate colonial and patriarchal discourses and practices, thus bringing together different dimensions of the local and the global. Tuning In ranges across different fields, embracing cultural, social, and political areas of experience as represented in broadcasting coverage. These fields illustrate the educative role of the BBC and the World Service that is also linked to its particular version of impartiality; just as The Archers was set up to provide information and guidance through a narrative of everyday life to rural communities and farmers after the Second World War, so the Afghan version plays an “edutainment” role (Skuse) where entertainment also serves an educational, public service information role. Indeed, the use of soap opera genre such as The Archers as a vehicle for humanitarian and health information has been very successful over the past decade, with the “edutainment” genre becoming a feature of the World Service’s broadcasting in places such as Rwanda, Somalia, Nigeria, India, Nepal, Burma, Afghanistan, and Cambodia. In a genre that has been promoted by the World Service Trust, the charitable arm of the BBC WS uses drama formats to build transnational production relationships with media professionals and to strengthen creative capacities to undertake behaviour change through communication work. Such programming, which is in the tradition of the BBC WS, draws upon the service’s expertise and exhibits both an ideological commitment to progressive social intervention and a paternalist approach drawing upon colonialist legacies. Nowadays, however, the BBC WS can be considered a diasporic contact zone, providing sites of transnational intra-diasporic contact as well as cross-cultural encounters, spaces for cross-diasporic creativity and representation, and a forum for cross-cultural dialogue and potentially cosmopolitan translations (Pratt, Clifford). These activities are, however, still marked by historically forged asymmetric power relations, notably of colonialism, imperialism, and globalisation, as well as still being dominated by hegemonic masculinity in many parts of the service, which thus represent sites of contestation, conflict, and transgression. Conversely, diasporic identities are themselves co-shaped by media representations (Sreberny). The diasporic contact zone is a relational space in which diasporic identities are made and remade and contested. Tuning In employed a diverse range of methods to analyse the part played by the BBC WS in changing and continuing social and cultural flows, networks, and reconfigurations of transnationalisms and diaspora, as well as reinstating colonial, patriarchal practices. The research deconstructed some assumptions and conditions of class-based elitism, colonialism, and patriarchy through a range of strategies. Texts are, of course, central to this work, with the BBC Archives at Caversham (near Reading) representing the starting point for many researchers. The archive is a rich source of material for researchers which carries a vast range of data including fragile memos written on scraps of paper: a very local source of global communications. Other textual material occupies the less locatable cyberspace, for example in the case of Have Your Say exchanges on the Web. People also featured in the project, through the media, in cyberspace, and physical encounters, all of which demonstrate the diverse modes of connection that have been established. Researchers worked with the BBC WS in a variety of ways, not only through interviews and ethnographic approaches, such as participant observation and witness seminars, but also through exchanges between the service, its practitioners, and the researchers (for example, through broadcasts where the project provided the content and the ideas and researchers have been part of programs that have gone out on the BBC WS (Goldblatt, Webb), bringing together people who work for the BBC and Tuning In researchers). On this point, it should be remembered that Bush House is, itself, a diasporic space which, from its geographical location in the Strand in London, has brought together diasporic people from around the globe to establish international communication networks, and has thus become the focus and locus of some of our research. What we have understood by the term “diasporic space” in this context includes both the materialities of architecture and cyberspace which is the site of digital diasporas (Anderssen) and, indeed, the virtual exchanges featured on “Have Your Say,” the online feedback site (Tuning In). Living the Glocal The BBC WS offers a mode of communication and a series of networks that are spatially located both in the UK, through the material presence of Bush House, and abroad, through the diasporic communities constituting contemporary audiences. The service may have been set up to provide news and entertainment for the British diaspora abroad, but the transformation of the UK into a multi-ethnic society “at home,” alongside its commitment to, and the servicing of, no less than 32 countries abroad, demonstrates a new mission and a new balance of power. Different diasporic communities, such as multi-ethnic Londoners, and local and British Muslims in the north of England, demonstrate the dynamics and ambivalences of what is meant by “diaspora” today. For example, the BBC and the WS play an ambiguous role in the lives of UK Muslim communities with Pakistani connections, where consumers of the international news can feel that the BBC is complicit in the conflation of Muslims with terrorists. Engaging Diaspora Audiences demonstrated the diversity of audience reception in a climate of marginalisation, often bordering on moral panic, and showed how diasporic audiences often use Al-Jazeera or Pakistani and Urdu channels, which are seen to take up more sympathetic political positions. It seems, however, that more egalitarian conversations are becoming possible through the channels of the WS. The participation of local people in the BBC WS global project is seen, for example, as in the popular “Witness Seminars” that have both a current focus and one that is projected into the future, as in the case of the “2012 Generation” (that is, the young people who come of age in 2012, the year of the London Olympics). The Witness Seminars demonstrate the recuperation of past political and social events such as “Bangladesh in 1971” (Tuning In), “The Cold War seminar” (Tuning In) and “Diasporic Nationhood” (the cultural movements reiterated and recovered in the “Literary Lives” project (Gillespie, Baumann and Zinik). Indeed, the WS’s current focus on the “2012 Generation,” including an event in which 27 young people (each of whom speaks one of the WS languages) were invited to an open day at Bush House in 2009, vividly illustrates how things have changed. Whereas in 1948 (the last occasion when the Olympic Games were held in London), the world came to London, it is arguable that, in 2012, in contemporary multi-ethnic Britain, the world is already here (Webb). This enterprise has the advantage of giving voice to the present rather than filtering the present through the legacies of colonialism that remain a problem for the Witness Seminars more generally. The democratising possibilities of sport, as well as the restrictions of its globalising elements, are well represented by Tuning In (Woodward). Sport has, of course become more globalised, especially through the development of Internet and satellite technologies (Giulianotti) but it retains powerful local affiliations and identifications. At all levels and in diverse places, there are strong attachments to local and national teams that are constitutive of communities, including diasporic and multi-ethnic communities. Sport is both typical and distinctive of the BBC World Service; something that is part of a wider picture but also an area of experience with a life of its own. Our “Sport across Diasporas” project has thus explored some of the routes the World Service has travelled in its engagement with sport in order to provide some understanding of the legacy of empire and patriarchy, as well as engaging with the multiplicities of change in the reconstruction of Britishness. Here, it is important to recognise that what began as “BBC Sport” evolved into “World Service Sport.” Coverage of the world’s biggest sporting events was established through the 1930s to the 1960s in the development of the BBC WS. However, it is not only the global dimensions of sporting events that have been assumed; so too are national identifications. There is no question that the superiority of British/English sport is naturalised through its dominance of the BBC WS airways, but the possibilities of reinterpretation and re-accommodation have also been made possible. There has, indeed, been a changing place of sport in the BBC WS, which can only be understood with reference to wider changes in the relationship between broadcasting and sport, and demonstrates the powerful synchronies between social, political, technological, economic, and cultural factors, notably those that make up the media–sport–commerce nexus that drives so much of the trajectory of contemporary sport. Diasporic audiences shape the schedule as much as what is broadcast. There is no single voice of the BBC in sport. The BBC archive demonstrates a variety of narratives through the development and transformation of the World Service’s sports broadcasting. There are, however, silences: notably those involving women. Sport is still a patriarchal field. However, the imperial genealogies of sport are inextricably entwined with the social, political, and cultural changes taking place in the wider world. There is no detectable linear narrative but rather a series of tensions and contradictions that are reflected and reconfigured in the texts in which deliberations are made. In sport broadcasting, the relationship of the BBC WS with its listeners is, in many instances, genuinely dialogic: for example, through “Have Your Say” websites and internet forums, and some of the actors in these dialogic exchanges are the broadcasters themselves. The history of the BBC and the World Service is one which manifests a degree of autonomy and some spontaneity on the part of journalists and broadcasters. For example, in the case of the BBC WS African sports program, Fast Track (2009), many of the broadcasters interviewed report being able to cover material not technically within their brief; news journalists are able to engage with sporting events and sports journalists have covered social and political news (Woodward). Sometimes this is a matter of taking the initiative or simply of being in the right place at the right time, although this affords an agency to journalists which is increasingly unlikely in the twenty-first century. The Politics of Translation: Words and Music The World Service has played a key role as a cultural broker in the political arena through what could be construed as “educational broadcasting” via the wider terrain of the arts: for example, literature, drama, poetry, and music. Over the years, Bush House has been a home-from-home for poets: internationalists, translators from classical and modern languages, and bohemians; a constituency that, for all its cosmopolitanism, was predominantly white and male in the early days. For example, in the 1930s and 1940s, Louis MacNeice was commissioning editor and surrounded by a friendship network of salaried poets, such as W. H. Auden, Dylan Thomas, C. Day Lewis, and Stephen Spender, who wrote and performed their work for the WS. The foreign language departments of the BBC WS, meanwhile, hired émigrés and exiles from their countries’ educated elites to do similar work. The biannual, book-format journal Modern Poetry in Translation (MPT), which was founded in 1965 by Daniel Weissbort and Ted Hughes, included a dedication in Weissbort’s final issue (MPT 22, 2003) to “Poets at Bush House.” This volume amounts to a celebration of the BBC WS and its creative culture, which extended beyond the confines of broadcasting spaces. The reminiscences in “Poets at Bush House” suggest an institutional culture of informal connections and a fluidity of local exchanges that is resonant of the fluidity of the flows and networks of diaspora (Cheesman). Music, too, has distinctive characteristics that mark out this terrain on the broadcast schedule and in the culture of the BBC WS. Music is differentiated from language-centred genres, making it a particularly powerful medium of cross-cultural exchange. Music is portable and yet is marked by a cultural rootedness that may impede translation and interpretation. Music also carries ambiguities as a marker of status across borders, and it combines aesthetic intensity and diffuseness. The Migrating Music project demonstrated BBC WS mediation of music and identity flows (Toynbee). In the production and scheduling notes, issues of migration and diaspora are often addressed directly in the programming of music, while the movement of peoples is a leitmotif in all programs in which music is played and discussed. Music genres are mobile, diasporic, and can be constitutive of Paul Gilroy’s “Black Atlantic” (Gilroy), which foregrounds the itinerary of West African music to the Caribbean via the Middle Passage, cross-fertilising with European traditions in the Americas to produce blues and other hybrid forms, and the journey of these forms to Europe. The Migrating Music project focused upon the role of the BBC WS as narrator of the Black Atlantic story and of South Asian cross-over music, from bhangra to filmi, which can be situated among the South Asian diaspora in east and south Africa as well as the Caribbean where they now interact with reggae, calypso, Rapso, and Popso. The transversal flows of music and lyrics encompasses the lived experience of the different diasporas that are accommodated in the BBC WS schedules: for example, they keep alive the connection between the Irish “at home” and in the diaspora through programs featuring traditional music, further demonstrating the interconnections between local and global attachments as well as points of disconnection and contradiction. Textual analysis—including discourse analysis of presenters’ speech, program trailers and dialogue and the BBC’s own construction of “world music”—has revealed that the BBC WS itself performs a constitutive role in keeping alive these traditions. Music, too, has a range of emotional affects which are manifest in the semiotic analyses that have been conducted of recordings and performances. Further, the creative personnel who are involved in music programming, including musicians, play their own role in this ongoing process of musical migration. Once again, the networks of people involved as practitioners become central to the processes and systems through which diasporic audiences are re-produced and engaged. Conclusion The BBC WS can claim to be a global and local cultural intermediary not only because the service was set up to engage with the British diaspora in an international context but because the service, today, is demonstrably a voice that is continually negotiating multi-ethnic audiences both in the UK and across the world. At best, the World Service is a dynamic facilitator of conversations within and across diasporas: ideas are relocated, translated, and travel in different directions. The “local” of a British broadcasting service, established to promote British values across the globe, has been transformed, both through its engagements with an increasingly diverse set of diasporic audiences and through the transformations in how diasporas themselves self-define and operate. On the BBC WS, demographic, social, and cultural changes mean that the global is now to be found in the local of the UK and any simplistic separation of local and global is no longer tenable. The educative role once adopted by the BBC, and then the World Service, nevertheless still persists in other contexts (“from Ambridge to Afghanistan”), and clearly the WS still treads a dangerous path between the paternalism and patriarchy of its colonial past and its responsiveness to change. In spite of competition from television, satellite, and Internet technologies which challenge the BBC’s former hegemony, the BBC World Service continues to be a dynamic space for (re)creating and (re)instating diasporic audiences: audiences, texts, and broadcasters intersect with social, economic, political, and cultural forces. The monologic “voice of empire” has been countered and translated into the language of diversity and while, at times, the relationship between continuity and change may be seen to exist in awkward tension, it is clear that the Corporation is adapting to the needs of its twenty-first century audience. ReferencesAnderson, Benedict. Imagined Communities, Reflections of the Origin and Spread of Nationalism. London: Verso, 1983. Anderssen, Matilda. “Digital Diasporas.” 2010. 30 Nov. 2010 ‹http://www8.open.ac.uk/researchprojects/diasporas/cross-research/digital-diasporas›. Bhabha, Homi. The Location of Culture. London: Routledge, 1994. Briggs, Asa. A History of Broadcasting in the United Kingdom, Volume II: The Golden Age of Wireless. Oxford: Oxford UP, 1995. Cheesman, Tom. “Poetries On and Off Air.” 2010. 30 Nov. 2010 ‹http://www8.open.ac.uk/researchprojects/diasporas/cross-research/bush-house-cultures›. Chivallon, Christine. “Beyond Gilroy’s Black Atlantic: The Experience of the African Diaspora.” Diaspora 11.3 (2002): 359–82. Clifford, James. Routes: Travel and Translation in the Late Twentieth Century. Cambridge: Cambridge UP, 1997. Fast Track. BBC, 2009. 30 Nov. 2010 ‹http://www.bbc.co.uk/worldservice/sport/2009/03/000000_fast_track.shtml›. Gillespie, Marie, Alban Webb, and Gerd Baumann (eds.). “The BBC World Service 1932–2007: Broadcasting Britishness Abroad.” Special Issue. The Historical Journal of Film, Radio and Television 28.4 (Oct. 2008). Gillespie, Marie, Gerd Baumann, and Zinovy Zinik. “Poets at Bush House.” 2010. 30 Nov. 2010 ‹http://www8.open.ac.uk/researchprojects/diasporas/about›. Gilroy, Paul. Black Atlantic. MA: Harvard UP, 1993. Giulianotti, Richard. Sport: A Critical Sociology. Cambridge: Polity, 2005. Goldblatt, David. “The Cricket Revolution.” 2009. 30 Nov. 2010 ‹http://www.bbc.co.uk/programmes/p0036ww9›. Guha, Ramachandra. A Corner of a Foreign Field: The Indian History of an English Game. London: Picador, 2002. Hall, Stuart. “Cultural Identity and Diaspora.” Identity: Community, Culture, Difference. Ed. Jonathan Rutherford. London: Lawrence and Wishart, 1990, 223–37. Hill, Andrew. “The BBC Empire Service: The Voice, the Discourse of the Master and Ventriloquism.” South Asian Diaspora 2.1 (2010): 25–38. Hollis, Robert, Norma Rinsler, and Daniel Weissbort. “Poets at Bush House: The BBC World Service.” Modern Poetry in Translation 22 (2003). Nandy, Ashis. The Tao of Cricket: On Games of Destiny and the Destiny of Games. New Delhi: Oxford UP, 1989. Pratt, Mary Louise. Imperial Eyes: Travel Writing and Transculturation. London: Routledge, 1992. Reith, John. “Opening of the Empire Service.” In “Empire Service Policy 1932-1933”, E4/6: 19 Dec. 1932. 30 Nov. 2010 ‹http://www.open.ac.uk/socialsciences/diasporas/research.htm›. Scannell, Paddy, and David Cardiff. A Social History of British Broadcasting, 1922-1938. Oxford: Basil Blackwell, 1991. Skuse, Andrew. “Drama for Development.” 2010. 30 Nov. 2010 ‹http://www8.open.ac.uk/researchprojects/diasporas/core-research/drama-for-development›. Sreberny, Annabelle. “The BBC World Service and the Greater Middle East: Comparisons, Contrasts, Conflicts.” Guest ed. Annabelle Sreberny, Marie Gillespie, Gerd Baumann. Middle East Journal of Culture and Communication 3.2 (2010). Toynbee, Jason. “Migrating Music.” 2010. 30 Nov. 2010 ‹http://www8.open.ac.uk/researchprojects/diasporas/core-research/migrating-music›. Tuning In. 30 Nov. 2010 ‹http://www.open.ac.uk/socialsciences/diasporas/index.htm›. Webb, Alban. “Cold War Diplomacy.” 2010. 30 Nov. 2010 ‹http://www8.open.ac.uk/researchprojects/diasporas/projects/cold-war-politics-and-bbc-world-service›. Woodward, Kath. Embodied Sporting Practices. Regulating and Regulatory Bodies. Basingstoke, Palgrave Macmillan, 2009.

Introduction Where children’s television once ruled supreme as a vehicle for sales of kids’ brands, the marketing of children’s toys now often hinges on having the right social media influencer, many of them children themselves (Verdon). As Forbes reported in 2021, the pandemic saw an increase in children spending more time online, many following their favourite influencers on YouTube, TikTok, and Instagram. The importance of tapping into partnering with the right influencer grew, as did sales in toys for children isolated at home. We detail, through a case study approach and visual narrative analysis of two Australian influencer siblings’ Instagram accounts, the nature of toy marketing to children in 2023. Findings point to the continued gendered nature of toys and the concurrent promotion of aspirational adult ‘toys’ (for example, cars, high-end cosmetics) and leisure pursuits that blur the line between what we considered to be children’s playthings and adult objects of desire. To Market, to Market Toys are a huge business worldwide. In 2021, the global toys market was projected to grow from $141.08 billion to $230.64 billion by 2028. During COVID-19, toy sales increased (Fortune Business Insights). The rise of the Internet alongside media and digital technologies has given toy marketers new opportunities to reach children directly, as well as producing new forms of digitally enabled play, with marketers potentially having access to children 24/7, way beyond the previous limits of children’s programming on television (Hains and Jennings). Children’s digital content has also extended to digital games alongside digital devices and Internet-connected toys. Children’s personal tablet ownership rose from less than 1 per cent in 2011 to 42 per cent in 2017 (Rideout), and continues to grow. Children’s value for brands and marketers has increased over time (Cunningham). The nexus between physical toys and the entertainment industry has grown stronger, first with the Disney company and then with the stand-out success of the Star Wars franchise (now owned by Disney) from the late 1970s (Hains and Jennings). The concept of transmedia storytelling and selling, with toys as the vehicle for children to play out the stories they saw on television, in comics, books, movies, and online, proved to be a lucrative one for the entertainment company franchises and the toy manufacturers (Bainbridge). All major toy brands now recognise the power of linking toy brands and entertaining transmedia children’s texts, including online content, with Disney, LEGO and Barbie being obvious examples. Gender and Toys: Boys and Girls Come Out to Play Alongside the growth of the children’s market, the gendering of children’s toys has also continued and increased, with concerns that traditional gender roles are still strongly promoted via children’s toys (Fine and Rush). Research shows that girls’ toys are socialising them for caring roles, shopping, and concern with beauty, while toys aimed at boys (including transportation and construction toys, action figures, and weapons) may promote physicality, aggression, construction, and action (Fine and Rush). As Blakemore and Center (632) suggested, then, if children learn from toy-play “by playing with strongly stereotyped toys, girls can be expected to learn that appearance and attractiveness are central to their worth, and that nurturance and domestic skills are important to be developed. Boys can be expected to learn that aggression, violence, and competition are fun, and that their toys are exciting and risky”. Recently there has been some pushback by consumers, and some toy brands have responded, with LEGO committing to less gendered toy marketing (Russell). YouTube: The World’s Most Popular Babysitter? One business executive has described YouTube as the most popular babysitter in the world (Capitalism.com). The use of children as influencers on YouTube to market toys through toy review videos is now a common practice (Feller and Burroughs; De Veirman et al.). These ‘reviews’ are not critical in the traditional sense of reviews in an institutional or legacy media context. Instead, the genre is a mash-up, which blurs the lines between three major genres: review, branded content, and entertainment (Jaakkola). Concerns have been raised about advertising disguised as entertainment for children, and calls have been made for nuanced regulatory approaches (Craig and Cunningham). The most popular toy review channels have millions of subscribers, and their hosts constitute some of YouTube’s top earners (Hunting). Toy review videos have become an important force in children’s media – in terms of economics, culture, and for brands (Hunting). Concurrently, surprise toys have risen as a popular type of toy, thanks in part to the popularity of the unboxing toy review genre (Nicoll and Nansen). Ryan’s World is probably the best-known in this genre, with conservative estimates putting 10-year-old Ryan Kanji’s family earnings at $25 million annually (Kang). Ryan’s World, formerly Ryan’s Toy Review, now has 10 YouTube channels and the star has his own show on Nic Junior as well as across other media, including books and video games (Capitalism.com). Marsh, through her case study of one child, showed the way children interact with online content, including unboxing videos, as ‘cyberflaneurs’. YouTube is the medium of choice for most children (now more so than television; Auxier et al.). However, Instagram is also a site where a significant number of children and teens spend time. Australian data from the e-Safety Commission in 2018 showed that while YouTube was the most popular platform, with 80 per cent of children 8-12 and 86 per cent of teens using the site, 24 per cent of children used Instagram, and 70 per cent of teens 13-17 (e-Safety Commissioner). Given the rise in social media, phone, and tablet use in the last five years, including among younger children, these statistics are now likely to be higher. A report from US-based Business Insider in 2021 stated that 40 per cent of children under 13 already use Instagram (Canales). This is despite the platform ostensibly only being for people aged 13 and over. Ofcom (the UK’s regulator for communications services) has discussed the rise of ‘Tik-Tots’ – young children defying age restrictions to be on social media – and the increase of young people consuming rather than sharing on social media (Ofcom). Insta-Kidfluencers on the Rise Marketers are now tapping into the selling power of children as social media influencers (or kidfluencers) to promote children’s toys, and in some cases, parents are happy to act as their children’s agents and managers for these pint-size prosumers. Abidin ("Micromicrocelebrity") was the first to discuss what she termed ‘micro-microcelebrities’, children of social media influencers (usually mothers) who have become, through their parents’ mediation, paid social media influencers themselves, often through Instagram. As Abidin noted: “their digital presence is deliberately commercial, framed and staged by Influencer mothers in order to maximize their advertorial potential, and are often postured to market even non-baby/parenting products such as fast food and vehicles”. Since that time, and with children now a growing audience on Instagram, some micro-microcelebrities have begun to promote toys alongside other brands which appeal to both children and adults. While initially these human ‘brand extensions’ of their mothers (Archer) appealed to adults, their sponsored content has evolved as they have aged, and their audience has grown and broadened to include children. Given the rise of Instagram as a site for the marketing of toys to children, through children themselves as social media influencers, and the lack of academic research on this phenomenon, our research looks at a case study of prominent child social media influencers on Instagram in Australia, who are managed by their mother, and who regularly promote toys. Within the case study, visual narrative analysis is used, to analyse the Instagram accounts of two high-profile child social media influencers, eleven-year-old Australian Pixie Curtis and her eight-year-old brother, Hunter Curtis, both of whom are managed by their entrepreneur and ‘PR queen’ mother, Roxy Jacenko. We analysed the posts from each child from March to July 2022 inclusive. Posts were recorded in a spreadsheet, with the content described, hashtags or handles recorded, and any brand or toy mentions noted. We used related media reports to supplement the analysis. We have considered ethical implications of our research and have made the decision to identify both children, as their accounts are public, with large follower numbers, promote commercial interests, and have the blue Instagram ‘tick’ that identifies their accounts as verified and ‘celebrity’ or brand accounts, and the children are regularly featured in mainstream media. The children’s mother, Jacenko, often discusses the children on television and has discussed using Pixie’s parties as events to gain publicity for the toy business. We have followed the lead of Abidin and Leaver, considered experts in the field, who have identified children and families in ethnographic research when the children or families have large numbers of followers (see Abidin, "#Familygoals"; Leaver and Abidin). We do acknowledge that other researchers have chosen not to identify influencer children (e.g., Ågren) with smaller numbers of followers. The research questions are as follows: RQ1: What are the toys featured on the two social media influencer children’s sites? RQ2: Are the toys traditionally gendered and if so, what are the main gender-based toys? RQ3: Do the children promote products that are traditionally aimed at adults? If so, how are these ‘toys’ presented, and what are they? Analysis The two child influencers and toy promoters, sister and brother Pixie (11) and Hunter (8) Curtis, are the children of celebrity, entrepreneur and public relations ‘maven’, Roxy Jacenko. Jacenko’s first business was a public relations firm, Sweaty Betty, one she ran successfully but has recently closed to focus on her influencer talent agency business, the Ministry of Talent, and the two businesses related to her children, Pixie’s Pix (an online toy store named after her daughter) and Pixie’s Bows, a line of fashion bows aimed at girls (Madigan). Pixie Curtis grew up with her own Instagram account, with her first Instagram post on 18 June 2013, before turning two, and featuring a promotion of an online subscription service for toys, with the hashtag #babblebox. At time of writing, Pixie has 120,000 Instagram followers; her ‘bio’ describes her account as ‘shopping and retail’ and as managed by Jacenko. Pixie is also described as the ‘founder of Pixie’s Pix Toy Store’. Her brother Hunter’s account began on 6 May 2015, with the first post to celebrate his first birthday. Hunter’s page has 20,000 followers with his profile stating that it is managed by his mother and her talent and influencer agency. RQ1: What are the toys featured on the two children’s Instagram sites? The two children feature toy promotions regularly, mostly from Pixie’s online toy shop, with the site tagged @pixiespixonline. These toys are often demonstrated by Pixie and Hunter in short video format, following the now-established genre of the toy unboxing or toy review. Toys that are shown on Pixie’s site (tagged to her toy store) include air-clay (clay designed to be used to create clay sculptures); a Scruff-a-Luv soft toy that mimics a rescue pet that needs to be bathed in water, dried, and groomed to become a ‘lovable’ soft toy pet; toy slime; kinetic sand; Hatchimals (flying fairy/pixie dolls that come out of plastic eggs); LOL OMG dolls and Mermaze (both with accentuated female/made up features). LOL OMG (short for Outrageous Millennial Girls) are described as “fierce, fashionable, fabulous” and their name taps into common language used to communicate while texting. Mermaze are also fashion and hair styling dolls, with a mermaid’s tail that changes colour in water. While predominantly promoting toys on Pixie’s Pix, Pixie posts promotions of other items on her Website aimed at children. This includes practical items such as lunch boxes, but also beauty products including a skin care headband and scented body scrubs. Toys shown on Hunter’s Instagram site are often promotions of his sister’s toy store offerings, but generally fall into the traditional ‘boys’ toys’ categories. The posts that tag the Pixie’s Pix store feature photos or video demonstrations by Hunter of toys, including trucks, slime, ‘Splat balls’ (squish balls), Pokémon cards, Zuru toys’ ‘Smashers’ (dinosaur eggs that are smashed to reveal a dinosaur toy), a Bubblegum simulator for Roblox (a social media platform and game), Needoh Stickums, water bombs, and Hot Wheels. RQ2: Are the toys traditionally gendered and if so, what are the main gender-based toys? Although both children promote gender-neutral sensory toys such as slime and splat balls, they do promote strongly gendered toys from Pixie’s Pix. Hunter also promotes gendered toys that are not tagged to Pixie’s Pix, including Jurassic World dinosaur toys (tying into the film release). One post by Hunter features a (paid) cross-promotion of PlayStation 5 themed Donut King donuts (with a competition to win a PlayStation 5 by buying the donuts). In contrast, Pixie posts a paid promotion of a high-tea event to promote My Little Ponies. Hunter’s posts of toys and leisure items that do not tag Pixie’s toyshop include him on a go-kart, buying rugby gear, and with an ‘airtasker’ (paid assistant) helping him sort his Nerf gun collection. There are posts of both children playing and doing ‘regular’ children’s activities, including sport (Pixie plays netball, Hunter rugby), with their dog, ice-skating, and swimming (albeit often at expensive resorts), while Hunter and Pixie both wear, unbox, and tag some high-end children’s clothes brands such as Balmain and promote department store Myer. RQ3: Do the children promote products that are traditionally aimed at adults? If so, how are these ‘toys’ presented, and what are they? The Cambridge dictionary provides the following two definitions of toys, with one showing that ‘toys’ may also be considered as objects of pleasure for adults. A toy is “an object for children to play with” while it can also be “an object that is used by an adult for pleasure rather than for serious use”. The very meaning of the word toys shows the crossover between the adult and children’s world. The more ‘adult’ products promoted by Pixie are highly gendered, with expensive bags, clothes, make-up, and skin care regularly featured on her account. These are arguably toys but also teen or adult objects of aspiration, with Pixie’s collection of handbags featured and the brand tagged. The bag collection includes brightly coloured bags by Australian designer Poppy Lissiman. Other female-focussed brands include a hairdryer brand, with photos and videos posted of Pixie ‘playing’ at dressing up and ‘getting ready’, using skincare, make-up, and hair products. These toys cater to age demographics older than Pixie. Hunter is pictured in posts on a jet-ski, and in others with a mobile and tablet, or washing a Tesla car and with a helicopter. The gendered tropes of girls being concerned with their appearance, and boys interested in vehicles, action, and competitive (video) games appear to be borne out in the posts from the two children. Discussion and Conclusion As an entrepreneur, Jacenko has capitalised on her daughter’s and son’s personal brands that she has co-created by launching and promoting a toyshop named after her daughter, following the success of her children’s promotion of toys for other companies and Pixie’s successful hairbow line. The toy shop arose out of Pixie promoting sales of fidget spinners during the pandemic lockdowns where toy sales rose sharply across the world. The children are also now on TikTok, and while they have a toy review channel on YouTube it has not been posted on for three years. Therefore, it is safe to assume that Instagram is one of the main channels for the children to promote the toyshop. In an online newspaper article describing the success of Pixie’s toyshop and the purchase of an expensive Mercedes car, Jacenko said that the children work hard, and the car was their “reward” (Scanlan). “The help both her brother and her [Pixie] give me on the buying (every night we work on new style selections and argue over it), the packing, the restocking, goes well beyond their years”, Jacenko is quoted as saying. “We’ve made a pact, we must keep going, work harder. Next, it’s a Rolls Royce.” Analysis of the children’s Instagram pages shows highly gendered promotion of toys. The children also promote a variety of high-end, aspirational tween, teen, and adult ‘toys’, including clothes, make-up, and skincare (Pixie) and expensive cars (Hunter and Pixie). Gender stereotyping has been found in adult influencer content (see, for example, Jorge et al.) and researchers have also pointed to sexualisation of young girl influencers on Instagram (Llovet et al.). Our research potentially echoes these findings. Posts from the children regularly include aspirational commodities that blur the lines between adult and child items of desire. Concerns have been raised in other academic articles (and in government reports) regarding the possible exploitation of children’s labour by parents and marketers to promote brands, including toys, on social media (see, for example, Ågren; De Veirman et al.; House of Commons; Masterson). The French government is believed to be the only government to have moved to regulate regarding the labour of children as social media influencers, and the same government at time of writing was debating laws to enshrine children’s right to privacy on social media, to stop the practice of ‘sharenting’ or parents sharing their children’s images and other content on social media without their children’s consent (Rieffel). Mainstream media including Teen Vogue (Fortesa), and some influencers themselves, have also started to raise issues relevant to ‘kidfluencers’. In the state of Utah, USA, the government has introduced laws to stop children under 18 having access to social media without parents’ consent, although some view this as potentially having some negative impacts (Singer). The ethics and impact of toy advertorials on children by social media influencers, with little or no disclosure of the posts being advertisements, have also been discussed elsewhere (see, for example, House of Commons; Jaakkola), with Rahali and Livingstone offering suggestions aimed key stakeholders. It has been found that beyond the marketing of toys and adult ‘luxuries’ to kids, other products that potentially harm children (for example, junk food and e-cigarettes) are also commonly seen in sponsored content on Instagram and YouTube aimed at children (Fleming‐Milici, Phaneuf, and Harris; Smith et al.). Indeed, it could be argued that e-cigarettes have been positioned as playthings and are appealing to children. While we may bemoan the loss of innocence of children, with the children in this analysis posed by their entrepreneurial mother as purveyors of material goods including toys, it is useful to remember that perhaps it has always been a conundrum, given the purpose of toy marketing is to make commercial sales. Children’s toys have always reflected and shaped society’s culture, often with surprisingly sinister and adult overtones, including the origins of Barbie as a male ‘sex’ toy (Bainbridge) and the blatant promotion of guns and other weapons to boys (for example the famous Mattel ‘burp’ gun of the 50s and 60s), through advertising and sponsorship of television (Hains and Jennings). Recently, fashion house Balenciaga promoted its range of adult bags using children as models via Instagram – the bags are teddy bears dressed in bondage outfits and the marketing stunt caused considerable backlash, with the sexually dressed bears and use of children raising outrage (Deguara). Were these teddy bags framed as children’s toys for adults or adult toys for children? The line was blurred. This research has limitations as it is focussed on a case study in one country (but with global reach through Instagram). However, the current analysis is believed to be one of the first to focus on children’s promotion of toys through Instagram, by two children’s influencers, a relatively new marketing approach aimed at children. As the article was being finalised, the children’s mother announced that as Pixie was transitioning into high school and wanted to focus on her studies rather than running a business, the toy business would conclude but Pixie’s Bows would continue (Madigan). In the UK, recent research by Livingstone et al. for the Digital Futures Commission potentially offers a way forward related to this phenomenon, when viewed alongside the analysis of our case study. Their final report (following research with children) suggests a Playful by Design Tool that would be useful for designers and brands, but also children, parents, regulators, and other stakeholders. Principles such as adopting ethical commercial models, being age-appropriate and ensuring safety, make sense when applied to kidfluencers and those that stand to benefit from their playbour. It appears that governments, society, some academics, and the media are starting to question the current generally unrestricted frameworks related to social media in general (see, for example, the ACCC’s ongoing enquiry) and toy and other marketing by kids to kids on social media specifically (House of Commons). We argue that more frameworks, and potentially laws, are required in this mostly unregulated space. Through our case study we have highlighted key areas of concern on one of the world’s most popular platforms for children and teens, including privacy issues, commodification, and gendered and ‘stealth’ marketing of toys through ‘advertorials’. We also acknowledge that children do gain playful and social benefits and entertainment from seeing influencers online. Given that it has been shown that gendered marketing of toys (and increased focus on appearance for girls through Instagram) could be potentially harmful to children’s self-esteem, and with related concerns on the continued commodification of childhood, further research is also needed to discover the responses and views of children to these advertorials masquerading as cute content. References Abidin, Crystal. "Micromicrocelebrity: Branding Babies on the Internet." M/C Journal 18.5 (2015). <https://doi.org/10.5204/mcj.1022>. ———. "#Familygoals: Family Influencers, Calibrated Amateurism, and Justifying Young Digital Labor." Social Media + Society 3.2 (2017). ACCC. "Digital Platform Services Inquiry Interim Report Number 5 – Regulatory Reform." Australian Competition and Consumer Commission 2022. <https://www.accc.gov.au/system/files/Digital%20platform%20services%20inquiry%20-%20September%202022%20interim%20report.pdf>. Ågren, Ylva. "Branded Childhood: Infants as Digital Capital on Instagram." Childhood (2022). Archer, Catherine. "Pre-Schooler as Brand Extension: A Tale of Pixie’s Bows and Birthdays." Digitising Early Childhood. Eds. Lelia Green et al. Newcastle, UK: Cambridge Scholars, 2019. 58-73. Auxier, Brooke, et al. "Parental Views about YouTube." Pew Research Centre, 28 July 2020. <https://www.pewresearch.org/internet/2020/07/28/parental-views-about-youtube/>. Bainbridge, Jason. "Fully Articulated: The Rise of the Action Figure and the Changing Face of ‘Children's’ Entertainment." Entertainment Industries. Routledge, 2014. 31-44. Blakemore, Judith E. Owen, and Renee E. Centers. "Characteristics of Boys' and Girls' Toys." Sex Roles 53 (2005): 619-33. Canales, Kate. "40% of Kids under 13 Already Use Instagram and Some Are Experiencing Abuse and Sexual Solicitation, a Report Finds, as the Tech Giant Considers Building an Instagram App for Kids." Business Insider 2021. <https://www.businessinsider.com/kids-under-13-use-facebook-instagram-2021-5>. Capitalism.com. "Ryan Kaji: Charismatic Kid Youtuber Played His Way to a Multi-Million Dollar Fortune." 26 Sep. 2022. <https://www.capitalism.com/ryan-kaji/>. Craig, et al. "Toy Unboxing: Living in an (Unregulated) Material World." Media International Australia 163.1 (2017): 77-86. Cunningham, Hugh. Children and Childhood in Western Society since 1500. Routledge, 2020. Deguara, Brittney. "Everything You Need to Know about Balenciaga's 'Disturbing' Ad Campaign." Kidspot 29 Nov. 2022. <https://www.kidspot.com.au/news/everything-you-need-to-know-about-balenciagas-disturbing-ad-campaign/news-story/cf89133794a3cc7fc20a70fdd68911f6>. De Veirman, Marijke, Liselot Hudders, and Michelle R. Nelson. "What Is Influencer Marketing and How Does It Target Children? A Review and Direction for Future Research." Frontiers in Psychology 10 (2019): 2685. E-Safety Commissioner. "Young People and Social Media Usage." 2018. <https://www.esafety.gov.au/research/youth-digital-dangers/social-media-usage>. Feller, Gavin, and Benjamin Burroughs. "Branding Kidfluencers: Regulating Content and Advertising on YouTube." Television & New Media 23.6 2022: 575-92. Fine, Cordelia, and Emma Rush. "'Why Does All the Girls Have to Buy Pink Stuff?' The Ethics and Science of the Gendered Toy Marketing Debate." Journal of Business Ethics 149 (2018): 769-84. Fleming‐Milici, Frances et al. "Prevalence of Food and Beverage Brands in 'Made‐for‐Kids' Child‐Influencer YouTube Videos: 2019–2020." Pediatric Obesity 2023: e13008. Fortune Business Insights. “Toys Market Size, Share & COVID-19 Impact Analysis, by Product Type (Dolls, Outdoor and Sports Toys, Building and Construction Set, Infant and Preschool Toys, Games & Puzzles, and Others), by Age Group (0-3 Years, 3-5 Years, 5-12 Years, 12-18 Years, and 18+ Years), by Distribution Channel (Online and Offline), and Regional Forecast, 2021-2028.” 2021. <https://www.fortunebusinessinsights.com/toys-market-104699>. Hains, Rebecca C., and Nancy A. Jennings. "Critiquing Children's Consumer Culture: An Introduction to the Marketing of Children's Toys." The Marketing of Children's Toys: Critical Perspectives on Children's Consumer Culture. Eds. Rebecca C. Hains and Nancy A. Jennings. Cham, Switzerland: Palgrave Macmillan, 2021. 1-20. House of Commons Digital, Culture, Media and Sport Committee UK. "Influencer Culture: Lights, Camera, Inaction?" 2022. <https://committees.parliament.uk/publications/28742/documents/173531/default/>. Hunting, Kyra. "Unwrapping Toy TV: Ryan’s World and the Toy Review Genre’s Impact on Children’s Culture." The Marketing of Children’s Toys: Critical Perspectives on Children’s Consumer Culture. Eds. Rebecca C. Hains and Nancy A. Jennings. Cham: Springer International, 2021. 105-24. Jaakkola, Maarit. "From Vernacularized Commercialism to Kidbait: Toy Review Videos on Youtube and the Problematics of the Mash-Up Genre." Journal of Children and Media 14.2 (2020): 237-54. Jorge, Ana, et al. "Parenting on Celebrities’ and Influencers’ Social Media: Revamping Traditional Gender Portrayals." Journalism and Media 4.1 (2023): 105-17. Kang, Jay Caspian. "The Boy King of YouTube." The New York Times Magazine 2022. <https://www.nytimes.com/2022/01/05/magazine/ryan-kaji-youtube.html>. Latifi, Fortesa. "Influencer Parents and the Kids Who Had Their Childhood Made into Content." Teen Vogue, 10 Mar. 2023. <https://www.teenvogue.com/story/influencer-parents-children-social-media-impact>. Leaver, Tama, and Crystal Abidin. "From YouTube to TV, and Back Again: Viral Video Child Stars and Media Flows in the Era of Social Media." Selected Papers of Internet Research (2018). Livingstone, Sonia, et al. "Digital Futures Commission – Final Report." 2023. <https://digitalfuturescommission.org.uk/wp-content/uploads/2023/03/DFC_report-online.pdf>. Llovet, Carmen, et al. "Are Girls Sexualized on Social Networking Sites? An Analysis of Comments on Instagram of Kristina Pimenova." Beyond the Stereotypes? Images of Boys and Girls, and Their Consequences. Eds. Dafna Lemish and Maya Götz. Göteborg: Nordicom, 2017. Madigan, Mary. “B&T Exclusive: Roxy Jacenko to Close Sweaty Betty by Month's End.” B&T 4 Nov. 2022. <https://www.bandt.com.au/bt-exclusive-roxy-jacenko-to-close-sweaty-betty-at-months-end/>. ———. "Roxy Jacenko’s Daughter Pixie Curtis Has Announced a Huge Life Change before Her 12th Birthday." News.com.au 21 Feb. 2023. <https://www.news.com.au/lifestyle/parenting/kids/roxy-jacenkos-daughter-pixie-curtis-has-announced-a-huge-life-change-before-her-12th-birthday/news-story/ff6fda8895d4a682eb0f1b9fd6c3311c>. Marsh, Jackie. "‘Unboxing’ Videos: Co-Construction of the Child as Cyberflâneur." Discourse: Studies in the Cultural Politics of Education 37.3 (2016): 369-80. Masterson, Marina A. "When Play Becomes Work: Child Labor Laws in the Era of ‘Kidfluencers’." University of Pa. Law Review 169 (2020): 577. Nicoll, Benjamin, and Bjorn Nansen. "Mimetic Production in Youtube Toy Unboxing Videos." Social Media + Society 4.3 (2018). Ofcom. "Living Our Lives Online – Top Trends from Ofcom’s Latest Research." 2022. <https://www.ofcom.org.uk/news-centre/2022/living-our-lives-online>. Rahali, Miriam, and Sonia Livingstone. "#SponsoredAds: Monitoring Influencer Marketing to Young Audiences." Media Policy Brief 23. London: Department of Media and Communications, London School of Economics and Political Sciences, 2022. <https://eprints.lse.ac.uk/113644/7/Sponsoredads_policy_brief.pdf>. Rieffel, Ysé. "French MPs Examine Bill on Children's Right to Privacy on Social Media." Le Monde 5 Mar. 2023. <https://www.lemonde.fr/en/france/article/2023/03/05/french-mp-proposes-bill-to-protect-children-s-privacy-on-social-media_6018268_7.html> Rideout, Victoria. "The Commonsense Census: Media Use by Kids Zero to Eight." 2017. <https://www.commonsensemedia.org/sites/default/files/research/report/csm_zerotoeight_fullreport_release_2.pdf>. Russell, Helen. "Lego to Remove Gender Bias from Its Toys after Findings of Child Survey." The Guardian 11 Oct. 2021. <https://www.theguardian.com/lifeandstyle/2021/oct/11/lego-to-remove-gender-bias-after-survey-shows-impact-on-children-stereotypes>. Scanlan, Rebekah. "Roxy Jacenko Buys Daughter, 9, $270,000 Car as Toy Business Booms." News.com.au 3 Aug. 2021. <https://www.news.com.au/lifestyle/real-life/news-life/roxy-jacenko-buys-daughter-9-270000-car-as-toy-business-booms/news-story/14bd181e6a24235f85276f16596d359a>. Singer, Natasha. "A Sweeping Plan to Protect Kids from Social Media." New York Times The Daily Podcast. Ed. Michael Barbaro. 2023. <https://www.nytimes.com/2023/03/27/podcasts/the-daily/social-media-instagram-tiktok-utah-ban.html>. Smith, Marissa J., et al. "User-Generated Content and Influencer Marketing Involving E-Cigarettes on Social Media: A Scoping Review and Content Analysis of YouTube and Instagram." BMC Public Health 23.1 (2023): 530. Verdon, Joan. "Santa’s Top Toy Sellers This Year Are Influencers." Forbes 14 Nov. 2021. <https://www.forbes.com/sites/joanverdon/2021/11/14/santas-top-toy-sellers-this-year-are-influencers/?sh=67621a7b1235>.