Um die anderen Arten von Veröffentlichungen zu diesem Thema anzuzeigen, folgen Sie diesem Link: Alfalfa Diseases and pests South Australia.
Zeitschriftenartikel zum Thema „Alfalfa Diseases and pests South Australia“
Geben Sie eine Quelle nach APA, MLA, Chicago, Harvard und anderen Zitierweisen an
Machen Sie sich mit Top-17 Zeitschriftenartikel für die Forschung zum Thema "Alfalfa Diseases and pests South Australia" bekannt.
Neben jedem Werk im Literaturverzeichnis ist die Option "Zur Bibliographie hinzufügen" verfügbar. Nutzen Sie sie, wird Ihre bibliographische Angabe des gewählten Werkes nach der nötigen Zitierweise (APA, MLA, Harvard, Chicago, Vancouver usw.) automatisch gestaltet.
Sie können auch den vollen Text der wissenschaftlichen Publikation im PDF-Format herunterladen und eine Online-Annotation der Arbeit lesen, wenn die relevanten Parameter in den Metadaten verfügbar sind.
Sehen Sie die Zeitschriftenartikel für verschiedene Spezialgebieten durch und erstellen Sie Ihre Bibliographie auf korrekte Weise.
1
Dillard, HR, TJ Wicks und B. Philp. „A grower survey of diseases, invertebrate pests, and pesticide use on potatoes grown in South Australia“. Australian Journal of Experimental Agriculture 33, Nr. 5 (1993): 653. http://dx.doi.org/10.1071/ea9930653.
Der volle Inhalt der QuelleAnnotation:
In 1991, a survey was distributed to 251 potato growers in South Australia to determine major diseases, insect and other invertebrate pests, and chemicals used to control them. The overall response rate was 48%, but of these, 24 individuals were no longer growing potatoes. The results were summarised for the State and by district (Adelaide Hills, Adelaide Plains, Murray Lands, South East). The most prevalent diseases encountered by respondents in all districts were target spot caused by Alternaria solani, and rhizoctonia canker caused by Rhizoctonia solani. Other diseases of concern to growers included late blight caused by Phytophthora infestans, seed piece decay caused by various pathogenic and saprophytic microorganisms, common scab caused by Streptomyces scabies, and leaf roll caused by potato leaf roll virus. The most commonly used fungicides for disease control were chlorothalonil (33-42% of respondents), mancozeb (30%), and cupric hydroxide (11-13%). The most commonly used seed treatments for control of seed piece decay were mancozeb (51 % of respondents), tolclofos methyl (24%), and lime (20%). Green peach aphid (Myzus persicae), potato aphid (Macrosiphum euphorbiae), potato moth (Phthorimaea operculella), and jassids and leafhoppers (Jassidae, Cicadellidae) were the pests of greatest concern to the growers. Others included Rutherglen bug (Nysius vinitor), redlegged earth mite (Halotydeus destructor), and thrips (Thripidae). The most commonly used insecticides were ethamidophos (40% of respondents), monocrotophos (22-28%), and dimethoate (7-13%).
2
Jones, Roger A. C. „Virus diseases of perennial pasture legumes in Australia: incidences, losses, epidemiology, and management“. Crop and Pasture Science 64, Nr. 3 (2013): 199. http://dx.doi.org/10.1071/cp13108.
Der volle Inhalt der QuelleAnnotation:
This article reviews current knowledge for Australia over the occurrence, losses caused, epidemiology, and management of virus diseases of perennial pasture legumes. Currently, 24 viruses have been found infecting perennial pasture legumes, and one or more viruses have been detected in 21 of these species. These viruses are transmitted by insect vectors, non-persistently or persistently, by contact or via seed. Their modes of transmission are critical factors determining their incidences within pastures in different climatic zones. Large-scale national or state surveys of lucerne (alfalfa) (Medicago sativa) and white clover (Trifolium repens) pastures revealed that some viruses reach high incidences. Infection with Alfalfa mosaic virus (AMV) was very widespread in lucerne stands, and with AMV and White clover mosaic virus (WClMV) in white clover pastures. Several other viruses are potentially important in pastures in these and other perennial temperate/Mediterranean pasture species. Data demonstrating herbage yield losses, diminished pasture persistence, and impaired nitrogen fixation/nodule function are available for AMV in lucerne, and AMV, WClMV, and Clover yellow vein virus in white clover. Integrated Disease Management approaches involving phytosanitary, cultural, chemical, and host resistance control measures are available to minimise virus infection in lucerne and white clover. Research on virus diseases of perennial tropical–subtropical pasture legumes has focussed almost entirely on virus identification, and information on their incidences in pastures, the losses they cause, and how to control them is lacking. Overall, viruses of perennial pasture legumes are least studied in South Australia and the Northern Territory. These and other critical research and development gaps that need addressing are identified.
3
Nichols, P. G. H., R. A. C. Jones, T. J. Ridsdill-Smith und M. J. Barbetti. „Genetic improvement of subterranean clover (Trifolium subterraneum L.). 2. Breeding for disease and pest resistance“. Crop and Pasture Science 65, Nr. 11 (2014): 1207. http://dx.doi.org/10.1071/cp14031.
Der volle Inhalt der QuelleAnnotation:
Subterranean clover (Trifolium subterraneum L.) is the most widely sown pasture legume in southern Australia and resistance to important diseases and pests has been a major plant-breeding objective. Kabatiella caulivora, the cause of clover scorch, is the most important foliar fungal pathogen, and several cultivars have been developed with resistance to both known races. Screening of advanced breeding lines has been conducted to prevent release of cultivars with high susceptibility to other important fungal foliar disease pathogens, including rust (Uromyces trifolii-repentis), powdery mildew (Oidium sp.), cercospora (Cercospora zebrina) and common leaf spot (Pseudopeziza trifolii). Several oomycete and fungal species cause root rots of subterranean clover, including Phytophthora clandestina, Pythium irregulare, Aphanomyces trifolii, Fusarium avenaceum and Rhizoctonia solani. Most breeding efforts have been devoted to resistance to P. clandestina, but the existence of different races has confounded selection. The most economically important virus diseases in subterranean clover pastures are Subterranean clover mottle virus and Bean yellow mosaic virus, while Subterranean clover stunt virus, Subterranean clover red leaf virus (local synonym for Soybean dwarf virus), Cucumber mosaic virus, Alfalfa mosaic virus, Clover yellow vein virus, Beet western yellows virus and Bean leaf roll virus also cause losses. Genotypic differences for resistance have been found to several of these fungal, oomycete and viral pathogens, highlighting the potential to develop cultivars with improved resistance. The most important pests of subterranean clover are redlegged earth mite (RLEM) (Halotydeus destructor), blue oat mite (Penthaleus major), blue-green aphid (Acyrthosiphon kondoi) and lucerne flea (Sminthurus viridis). New cultivars have been bred with increased RLEM cotyledon resistance, but limited selection has been conducted for resistance to other pests. Screening for disease and pest resistance has largely ceased, but recent molecular biology advances in subterranean clover provide a new platform for development of future cultivars with multiple resistances to important diseases and pests. However, this can only be realised if skills in pasture plant pathology, entomology, pre-breeding and plant breeding are maintained and adequately resourced. In particular, supporting phenotypic disease and pest resistance studies and understanding their significance is critical to enable molecular technology investments achieve practical outcomes and deliver subterranean clover cultivars with sufficient pathogen and pest resistance to ensure productive pastures across southern Australia.
4
Henzell, Robert P., Brian D. Cooke und Gregory J. Mutze. „The future biological control of pest populations of European rabbits, Oryctolagus cuniculus“. Wildlife Research 35, Nr. 7 (2008): 633. http://dx.doi.org/10.1071/wr06164.
Der volle Inhalt der QuelleAnnotation:
European rabbits are exotic pests in Australia, New Zealand, parts of South America and Europe, and on many islands. Their abundance, and the damage they cause, might be reduced by the release of naturally occurring or genetically modified organisms (GMOs) that act as biological control agents (BCAs). Some promising pathogens and parasites of European rabbits and other lagomorphs are discussed, with special reference to those absent from Australia as an example of the range of necessary considerations in any given case. The possibility of introducing these already-known BCAs into areas where rabbits are pests warrants further investigation. The most cost-effective method for finding potentially useful but as-yet undiscovered BCAs would be to maintain a global watch on new diseases and pathologies in domestic rabbits. The absence of wild European rabbits from climatically suitable parts of North and South America and southern Africa may indicate the presence there of useful BCAs, although other explanations for their absence are possible. Until the non-target risks of deploying disseminating GMOs to control rabbits have been satisfactorily minimised, efforts to introduce BCAs into exotic rabbit populations should focus on naturally occurring organisms. The development of safe disseminating GMOs remains an important long-term goal, with the possible use of homing endonuclease genes warranting further investigation.
5
Wicks, TJ, und AR Granger. „Effects of low rates of pesticides on the control of pests and diseases of apples“. Australian Journal of Experimental Agriculture 29, Nr. 3 (1989): 439. http://dx.doi.org/10.1071/ea9890439.
Der volle Inhalt der QuelleAnnotation:
Fungicides and insecticides used at the recommended rate, and reduced recommended rates were applied at low volume (100 L ha-1) to apple trees in field experiments in South Australia from 1985 to 1988. At harvest the incidence of fruit damaged by fungi and insects was assessed on Golden Delicious, Red Delicious, Jonathan and Granny Smith cultivars. Mixtures of penconazole and mancozeb applied at the recommended rates of 800 mL and 4.5 kg ha-1 respectively as well as 25% and 10% of the recommended rates controlled apple scab completely in 1986, but were less effective in 1987. Azinphos-methyl applied at the recommended rate of 2.7 kg and 25% of the recommended rate reduced codling moth infestation to commercially acceptable levels of <2 % on Red Delicious only in 1987. Considerable cost savings are possible by using low rates of pesticides. Our results suggest that the use of low rates is more applicable to low valued cultivars such as Jonathans and orchards with low levels of pest and disease.
6
Carnegie, Angus J., und Geoff S. Pegg. „Lessons from the Incursion of Myrtle Rust in Australia“. Annual Review of Phytopathology 56, Nr. 1 (25.08.2018): 457–78. http://dx.doi.org/10.1146/annurev-phyto-080516-035256.
Der volle Inhalt der QuelleAnnotation:
Austropuccinia psidii (myrtle rust) is a globally invasive neotropical rust of the Myrtaceae that came into international prominence following extensive damage to exotic Eucalyptus plantations in Brazil in the 1970s and 1980s. In 2005, myrtle rust established in Hawaii (USA), and over the past 12 years has spread from the Americas into Asia, the Pacific, and South Africa. Myrtle rust was detected in Australia in 2010, and the response and ultimately unsuccessful eradication attempt was a lesson to those concerned about the threat of exotic pests and diseases to Australia's environment. Seven years following establishment, we are already observing the decline of many myrtaceous species and severe impacts to native plant communities. However, the recently developed Myrtle rust in Australia draft action plan identified that there is no nationally coordinated response strategy for the environmental dimensions of this threat. Recent reviews have identified a greater need for involvement from environmental agencies in biosecurity preparedness, response, and resourcing, and we believe this approach needs to extend to the management of invasive environmental pathogens once they establish.
7
Lakew, Biniam T., Adrian H. Nicholas und Stephen W. Walkden-Brown. „Spatial and temporal distribution of Culicoides species in the New England region of New South Wales, Australia between 1990 and 2018“. PLOS ONE 16, Nr. 4 (05.04.2021): e0249468. http://dx.doi.org/10.1371/journal.pone.0249468.
Der volle Inhalt der QuelleAnnotation:
Culicoides are one of the smallest hematophagous flies measuring 1–5 mm in size with only females seeking blood for egg development. The present study investigated spatio-temporal distribution of Culicoides species trapped between 1990 and 2018 at 13 sites in the New England region of NSW, Australia using automated light traps. Trapping locations were divided into three subregions (tablelands, slopes and plains). Nineteen Culicoides species were identified. Culicoides marksi and C. austropalpalis were the most abundant and widespread species. Culicoides brevitarsis, the principal vector of livestock diseases in New South Wales comprised 2.9% of the total catch and was detected in 12 of the 13 locations in the study. Abundance as determined by Log10 Culicoides count per trapping event for the eight most abundant species did not vary significantly with season but trended towards higher counts in summer for C. marksi (P = 0.09) and C. austropalpalis (P = 0.05). Significant geographic variation in abundance was observed for C. marksi, C. austropalpalis and C. dycei with counts decreasing with increasing altitude from the plains to the slopes and tablelands. Culicoides victoriae exhibited the reverse trend in abundance (P = 0.08). Greater abundance during the warmer seasons and at lower altitudes for C. marksi and C. austropalpalis was indicative of temperature and rainfall dependence in this region with moderate summer dominance in rainfall. The Shannon-Wiener diversity index of species was higher on the tablelands (H = 1.59) than the slopes (H = 1.33) and plains (H = 1.08) with evenness indices of 0.62, 0.46 and 0.39 respectively. Culicoides species on the tablelands were more diverse than on the slopes and plains where C. marksi and C. austropalpalis dominated. The temporal and spatial variation in abundance, diversity and evenness of species reported in this diverse region of Australia provides additional insight into Culicoides as pests and disease vectors and may contribute to future modelling studies.
8
Waller, R. A., und P. W. G. Sale. „Persistence and productivity of perennial ryegrass in sheep pastures in south-western Victoria: a review“. Australian Journal of Experimental Agriculture 41, Nr. 1 (2001): 117. http://dx.doi.org/10.1071/ea00049.
Der volle Inhalt der QuelleAnnotation:
Loss of perennial ryegrass (Lolium perenne L.) from the pasture within several years of sowing is a common problem in the higher rainfall (550–750 mm annual rainfall), summer-dry regions of south-eastern Australia. This pasture grass came to Australia from northern Europe, where it mostly grows from spring to autumn under mild climatic conditions. In contrast, the summers are generally much drier and hotter in this region of south-eastern Australia. This ‘mismatch’ between genotype and environment may be the fundamental reason for the poor persistence. There is hope that the recently released cultivars, Fitzroy and Avalon, selected and developed from naturalised ryegrass pastures in south-eastern Australia for improved winter growth and persistence will improve the performance of perennial ryegrass in the region. Soon-to-be released cultivars, developed from Mediterranean germplasm, may also bridge the climatic gap between where perennial ryegrass originated and where it is grown in south-eastern Australia. Other factors that influence perennial ryegrass persistence and productivity can be managed to some extent by the landholder. Nutrient status of the soil is important since perennial ryegrass performance improves relative to many other pasture species with increasing nitrogen and phosphorus supply. It appears that high soil exchangeable aluminium levels are also reducing ryegrass performance in parts of the region. The use of lime may resolve problems with high aluminium levels. Weeds that compete with perennial ryegrass become prevalent where bare patches occur in the pasture; they have the opportunity to invade pastures at the opening rains each year. Maintaining some herbage cover over summer and autumn should reduce weed establishment. Diseases of ryegrass are best managed by using resistant cultivars. Insect pests may be best managed by understanding and monitoring their biology to ensure timely application of pesticides and by manipulating herbage mass to alter feed sources and habitat. Grazing management has potential to improve perennial ryegrass performance as frequency and intensity of defoliation affect dry matter production and have been linked to ryegrass persistence, particularly under moisture deficit and high temperature stress. There is some disagreement as to the merit of rotational stocking with sheep, since the results of grazing experiments vary markedly depending on the rotational strategy used, climate, timing of the opening rains, stock class and supplementary feeding policy. We conclude that flexibility of grazing management strategies is important. These strategies should be able to be varied during the year depending on climatic conditions, herbage mass, and plant physiology and stock requirements. Two grazing strategies that show potential are a short rest from grazing the pasture at the opening rains until the pasture has gained some leaf area, in years when the opening rains are late. The second strategy is to allow ryegrass to flower late in the season, preventing new vegetative growth, and perhaps allowing for tiller buds to be preserved in a dormant state over the summer. An extension of this strategy would be to delay grazing until after the ryegrass seed heads have matured and seed has shed from the inflorescences. This has the potential to increase ryegrass density in the following growing season from seedling recruitment. A number of research opportunities have been identified from this review for improving ryegrass persistence. One area would be to investigate the potential for using grazing management to allow late development of ryegrass seed heads to preserve tiller buds in a dormant state over the summer. Another option is to investigate the potential, and subsequently develop grazing procedures, to allow seed maturation and recruitment of ryegrass seedlings after the autumn rains.
9
Li, Y. P., M. P. You, T. N. Khan, P. M. Finnegan und M. J. Barbetti. „First Report of Phoma herbarum on Field Pea (Pisum sativum) in Australia“. Plant Disease 95, Nr. 12 (Dezember 2011): 1590. http://dx.doi.org/10.1094/pdis-07-11-0594.
Der volle Inhalt der QuelleAnnotation:
Black spot disease on field pea (Pisum sativum) in Australia is generally caused by one or more of the four fungi: Mycosphaerella pinodes (anamorph Ascochyta pinodes), Phoma medicaginis var. pinodella (synonym Phoma pinodella), Ascochyta pisi, and Phoma koolunga (1,2,4). However, in 2010 from a field pea blackspot disease screening nursery at Medina, Western Australia, approximately 25% of isolates were a Phoma sp. that was morphologically different to Phoma spp. previously reported on field pea in Western Australia, while the remaining 75% of isolates were either M. pinodes or P. medicaginis var. pinodella. Single-spore isolations of 23 isolates of this Phoma sp. were made onto potato dextrose agar. A PCR-based assay with the TW81 and AB28 primers was used to amplify from the 3′ end of 16S rDNA, across ITS1, 5.8S rDNA, and ITS2 to the 5′ end of the 28S rDNA. The DNA products were sequenced and BLAST analyses were used to compare sequences with those in GenBank. In each case, the sequence had ≥99% nucleotide identity with the corresponding sequence in GenBank for P. herbarum. Isolates also showed morphological similarities to P. herbarum as described in other reports (e.g., 3). The relevant information for a representative isolate has been lodged in GenBank (Accession No. JN247437). The same primers were used by Davidson et al. (2) to identify P. koolunga, but none of our 23 isolates were P. koolunga. A conidial suspension of 107 conidia ml–1 from a single-spore culture was spray inoculated onto foliage of 10-day-old Pisum sativum cv. Dundale plants maintained under >90% relative humidity conditions for 72 h postinoculation. Symptoms evident by 11 days postinoculation consisted of pale brown lesions that were mostly 1.5 to 2 mm long and 1 to 1.5 mm wide. Approximately 50% of lesions showed a distinct chlorotic halo extending 1 to 2 mm outside the boundary of the lesion. P. herbarum was readily reisolated from infected foliage. A culture of this representative isolate has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13499). Outside of Australia, P. herbarum, while generally considered a soilborne opportunistic pathogen, has been reported on a wide range of species, including field pea (3). Molecular analysis of historical isolates collected from field pea in Western Australia, mostly in the late 1980s, did not show any incidence of P. herbarum, despite this fungus being reported on alfalfa (Medicago sativa) and soybean (Glycine max) in Western Australia in 1985 (Australian Plant Pest Database). In Western Australia, this fungus has also been recorded on a Protea sp. in 1991 and on Arabian pea (Bituminaria bituminosa) in 2010 (Australian Plant Pest Database). To our knowledge, this is the first report of P. herbarum as a pathogen on field pea in Australia. These previous reports of P. herbarum on other hosts in Western Australia and the wide host range of P. herbarum together suggest the potential for this fungus to be a pathogen on a wider range of genera/species than field pea. References: (1) T. W. Bretag and M. Ramsey. Page 24 in: Compendium of Pea Diseases and Pests. 2nd ed. The American Phytopathologic Society, St Paul, MN, 2001. (2) J. A. Davidson et al. Mycologica 101:120, 2009. (3) G. L. Kinsey. Phoma herbarum. No 1501. IMI Descriptions of Fungi and Bacteria, 2002. (4) T. L. Peever et al. Mycologia 99:59, 2007.
10
Lodge, GM. „Management practices and other factors contributing to the decline in persistence of grazed lucerne in temperate Australia: a review“. Australian Journal of Experimental Agriculture 31, Nr. 5 (1991): 713. http://dx.doi.org/10.1071/ea9910713.
Der volle Inhalt der QuelleAnnotation:
The literature relevant to the grazing management of lucerne in temperate Australia is reviewed with emphasis on the factors likely to affect its persistence. Knowledge of lucerne physiology is used to question the validity of the traditional methods of managing grazed stands, which rely mainly on using 10% flowering as a guide to root carbohydrate levels. From these data several alternative management guidelines are proposed that may lead to increased persistence; however, for long-term persistence, there is little doubt that lucerne needs to be grazed leniently and at a late stage of maturity. Several grazing experiments indicate that grazing periods of 16-20 days should have no effect on persistence, provided that the rest period between successive grazings is 35 days or longer. Data from other countries and Australian data from a limited number of experiments also indicate that grazing in either autumn or winter may substantially reduce production and could affect persistence. Three grazing studies in New South Wales were used to highlight critical differences in experimental design which make comparisons among experiments difficult. Standardised sowing rates and grazing management, and statistical procedures which account for the genotype x management x environment interaction, are suggested to improve the extrapolation of results from experiments to other environments. Persistence of different lucerne types under grazing, particularly those recently imported from the U.S.A. or bred in Australia, is considered. While it has been proposed that grazing effects may be related to crown structure, interactions with other factors which affect persistence may also occur. If grazing can be considered to be stressful to a lucerne plant then it could interact with other stresses, caused by moisture deficit, excessive moisture, insect pests and disease, to reduce persistence. Additionally, considerable variation in varietal resistance to some pests and diseases has been recorded in haycut stands, and so there may also be cultivar x grazing effects. All of these factors could combine to affect the persistence of a particular cultivar under grazing. Patterns of lucerne decline were either continuous or step-like. Continuous decline was associated with prolonged grazing, grazing and moisture stress, grazing under waterlogged conditions, or grazing in situations where the incidence of disease was likely to be high. To understand the reasons why plants fail to persist, measurements need to be made frequently and a1 regular intervals, and the moisture and disease status of the site needs to be accurately monitored. The adequacy of different methods of measuring stand persistence is also questioned. The implications for graziers, researchers and lucerne breeders are discussed.
11
Nordblom, T. L., T. R. Hutchings, R. C. Hayes, G. D. Li und J. D. Finlayson. „Does establishing lucerne under a cover crop increase farm financial risk?“ Crop and Pasture Science 68, Nr. 12 (2017): 1149. http://dx.doi.org/10.1071/cp16379.
Der volle Inhalt der QuelleAnnotation:
Rainfed farms in south-eastern Australia often combine annual cropping and perennial pasture phases with grazing sheep enterprises. Such diversity serves in managing diseases, pests and plant nutrition while stabilising income in the face of wide, uncorrelated variations in international commodity prices and local weather over time. We use an actuarial accounting approach to capture the above contexts to render financial risk profiles in the form of distributions of decadal cash balances for a representative 1000-ha farm at Coolamon (34°50ʹS, 147°12ʹE) in New South Wales, Australia. For the soil and weather conditions at this location we pose the question of which approach is better when establishing the perennial pasture lucerne (Medicago sativa L.): sowing with the final crop of the cropping phase, or sowing alone following the final crop? It is less expensive to sow lucerne with the final crop, which can provide useful income from the sale of grain, but this practice can reduce pasture quantity and quality in poorer years. Although many years of field research have confirmed that sowing lucerne alone is the most reliable way to establish a pasture in this area, and years of extension messages to this effect have gone out to farmers, they often persist in sowing lucerne with their final cereal crops. For this region, counting all costs, we show that sowing lucerne alone can reduce farm financial risk (i.e. probability of negative decadal cash balances) at stocking rates >10 dry sheep equivalents (DSE)/ha, compared with the practice of sowing lucerne with a cover crop. Establishing lucerne alone allows the farmer the option to profitably run higher stocking rates for higher median decadal cash margins without additional financial risk. At low stocking rates (i.e. 5 DSE/ha), there appears to be no financial advantage of either establishment approach. We consider the level of equity, background farm debt and overhead costs to demonstrate how these also affect risk-profile positions of the two sowing options. For a farm that is deeply in debt, we cannot suggest either approach to establishing lucerne will lead to substantially better financial outcomes.
12
Kishlyan, N. V., V. D. Bemova, T. V. Matveeva und V. A. Gavrilova. „Biological peculiarities and cultivation of groundnut (a review)“. Proceedings on applied botany, genetics and breeding 181, Nr. 1 (12.04.2020): 119–27. http://dx.doi.org/10.30901/2227-8834-2020-1-119-127.
Der volle Inhalt der QuelleAnnotation:
Peanut is one of the most important crops in the Fabaceae Lindl. (Leguminosae L.) family. South America is considered to be the homeland of peanut, but now this crop is cultivated in America, Africa, Australia, Europe and Asia. The modern phylogenetic system of the genus Arachis L. includes 79 wild species and one cultivated species of common peanut (A. hypogaea L.). Diploid species contain 2n = 20 chromosomes of the A, B or D genome, tetraploids have A and B genomes. The А and В genomes are sequenced. Special biological features of all peanut varieties are the presence of chasmogamous and cleistogamous flowers and the development of pods only underground (geocarpy). Along with high requirements for improving the quality of oil and food products, much attention is paid to their safety: resistance to aflatoxin contamination and mitigation of allergenicity. Peanut cultivars vary in plant habit, shape and color of pods and seeds. Their growing season in Africa, Latin America and Asia is from 160 to 200 days, so early-ripening forms need to be selected for the south of the Russian Federation. Breeders from the Pustovoit Institute of Oil Crops (VNIIMK) have developed peanut cultivars with a yield of 2.0–3.3 t/ha and growing season duration of 115–120 days, adaptable to the environments of Krasnodar Territory. At present, there is no large-scale peanut production in Russia, nor any breeding efforts are underway. As for the world, along with conventional breeding practices (individual selection, intra- and interspecies crosses, etc.), peanut is widely involved in genomic studies. A number of cultivars highly resistant to pests, diseases and drought have been released. Over 15,000 peanut accessions are preserved in the world’s gene banks, including 1823 accessions in the collection of the Vavilov Institute (VIR). Utilization of the worldwide genetic resources of peanut and use of modern research technologies will contribute to the revival of peanut cultivation in Russia.
13
Chen, W., F. M. Dugan und R. McGee. „First Report of Dodder (Cuscuta pentagona) on Chickpea (Cicer arietinum) in the United States“. Plant Disease 98, Nr. 1 (Januar 2014): 165. http://dx.doi.org/10.1094/pdis-03-13-0334-pdn.
Der volle Inhalt der QuelleAnnotation:
Chickpea (Cicer arietinum L.) is an important rotational and an emerging specialty crop in the Pacific Northwest of the United States, in California, and in the Northern Great Plains of the United States and Canada. Dodders (Cuscuta spp.) are widespread parasitic weeds on many crops worldwide. Several Cuscuta species (primarily C. campestris Yuncker) have been reported to parasitize chickpea, and dodder is important on chickpea in the Indian subcontinent, the Middle East, and recently in Australia (4), but has previously not been reported from North America. On 28 July 2012, a chickpea field near Walla Walla, WA, was found parasitized by dodder. The chickpea was at late flowering and early pod filling stages and there were no other visible green weedy plants as observed from the canopy. There were about 15 dodder colonies varying in size from 2 to 15 meters in diameter in the field of about 500 acres. Chickpea plants in the center of the dodder colonies were wilting or dead. The colonies consisted of orange leafless twining stems wrapped around chickpea stems and spreading between chickpea plants. Haustoria of the dodder penetrating chickpea stems were clearly visible to the naked eye. Flowers, formed abundantly in dense clusters, were white and five-angled, with capitate stigmas, and lobes on developing calyxes were clearly overlapping. The dodder keyed to C. pentagona Engelm. in Hitchcock and Cronquest (3) and in Costea (1; and www.wlu.ca/page.php?grp_id=2147&p=8968 ). Specimens of dodder plants wrapping around chickpea stems with visible penetrating haustoria were collected on 28 July 2013 and vouchers (WS386115, WS386116, and WS386117) were deposited at the Washington State University Ownbey Herbarium. All dodder colonies in the field were eradicated before seed formation to prevent establishment of dodder. Total genomic DNA was isolated from dodder stems, and PCR primers ITS1 (5′TCCGTAGGTGAACCTGCGG) and ITS4 (5′TCCTCCGCTTATTGATATGC) were used to amplify the internal transcribed spacer (ITS) region of the nuclear rDNA. The ITS region was sequenced. BLAST search of the NCBI nucleotide database using the ITS sequence as query found that the most similar sequence was from C. pentagona (GenBank Accession No. DQ211589.1), and our ITS sequence was deposited in GenBank (KC832885). Dodder (C. approximata Bab.) has been historically a regional problem on alfalfa (Washington State Noxious Weed Control Board 2011). Another species stated to be “mainly” associated with legumes is C. epithymum Murr., and C. pentagona is “especially” associated with legumes (3). The latter species has sometimes been considered a variety (var. calycina) of C. campestris Yuncker (1,3). Although chickpea has been cultivated in the Walla Walla region for over 20 years, to our knowledge, this is the first time dodder has been observed on chickpea in North America. The likely source is from nearby alfalfa or other crop fields, with transmission by farm machinery or wild animals. Some chickpea germplasm exhibits partial resistance to C. campestris (2). References: (1) M. Costea et al. SIDA 22:151, 2006. (2) Y. Goldwasser et al. Weed Res. 52:122, 2012. (3) C. L. Hitchcock and A. Cronquist. Flora of the Pacific Northwest: An Illustrated Manual. University of Washington Press, Seattle, 1973. (4) D. Rubiales et al. Dodder. Page 98 in: Compendium of Chickpea and Lentil Diseases and Pests. W. Chen et al., eds. APS Press, St. Paul, Minnesota, 2011.
14
Li, J., V. L. Gaskins, H. J. Yan, Y. G. Luo und W. M. Jurick II. „First Report of Mucor Rot on Stored ‘Gala’ Apple Fruit Caused by Mucor piriformis in Pennsylvania“. Plant Disease 98, Nr. 8 (August 2014): 1157. http://dx.doi.org/10.1094/pdis-02-14-0149-pdn.
Der volle Inhalt der QuelleAnnotation:
Mucor piriformis E. Fischer causes Mucor rot of pome and stone fruits during storage and has been reported in Australia, Canada, Germany, Northern Ireland, South Africa, and portions of the United States (1,2). Currently, there is no fungicide in the United States labeled to control this wound pathogen on apple. Cultural practices of orchard sanitation, placing dry fruit in storage, and chlorine treatment of dump tanks and flumes are critical for decay management (3,4). Cultivars like ‘Gala’ that are prone to cracking are particularly vulnerable as the openings provide ingress for the fungus. Mucor rot was observed in February 2013 at a commercial packing facility in Pennsylvania. Decay incidence was ~15% on ‘Gala’ apples from bins removed directly from controlled atmosphere storage. Rot was evident mainly at the stem end and was light brown, watery, soft, and covered with fuzzy mycelia. Salt-and-pepper colored sporangiophores bearing terminal sporangiospores protruded through the skin. Five infected apple fruit were collected, placed in an 80-count apple box on trays, and temporarily stored at 4°C. Isolates were obtained aseptically from decayed tissue, placed on potato dextrose agar (PDA) petri plates, and incubated at 25°C with natural light. Five single sporangiospore isolates were identified as Mucor piriformis based on cultural characteristics according to Michailides and Spotts (1). The isolates produced columellate sporangia attached terminally on short and tall, branched and unbranched sporangiophores. Sporangiospores were ellipsoidal, subspherical, and smooth. Chlamydospore-like resting structures (gemmae), isogametangia, and zygospores were not evident in culture. Mycelial growth was examined on PDA, apple agar (AA), and V8 agar (V8) at 25°C with natural light. Isolates grew best on PDA at rates that ranged from 38.4 ± 5.3 to 34.5 ± 2.41 mm/day, followed by AA from 30.5 ± 1.22 to 28.5 ± 2.51 mm/day, and V8 from 29.2 ± 3.0 to 26.7 ± 2.17 mm/day. Species-level identification was conducted by isolating genomic DNA, amplifying a portion of the 28S rDNA gene, and directly sequencing the products. MegaBLAST analysis of the 2X consensus sequences revealed that all five isolates were 99% identical to M. piriformis (GenBank Accession No. JN2064761) with E values of 0.0, which confirms the morphological identification. Koch's postulates were conducted using organic ‘Gala’ apples that were surface sanitized with soap and water, then sprayed with 70% ethanol and allowed to air dry. Wounds 3 mm deep were created using the point of a finishing nail and then inoculated with 50 μl of a sporangiospore suspension (1 × 105 sporangiospores/ml) for each isolate. Ten fruit were inoculated with each isolate, and the experiment was repeated. The fruit were stored at 25°C in 80-count boxes on paper trays for 14 days. Decay observed on inoculated ‘Gala’ fruit was similar to symptoms originally observed on ‘Gala’ apples from storage and the pathogen was re-isolated from inoculated fruit. This is the first report of M. piriformis causing postharvest decay on stored apples in Pennsylvania and reinforces the need for the development of additional tools to manage this economically important pathogen. References: (1) T. J. Michailides, and R. A. Spotts. Plant Dis. 74:537, 1990. (2) P. L. Sholberg and T. J. Michailides. Plant Dis. 81:550, 1997. (3) W. L. Smith et al. Phytopathology 69:865, 1979. (4) R. A. Spotts. Compendium of Apple and Pear Diseases and Pests: Second Edition. APS Press, St. Paul, MN, 2014.
15
Healey, Adam L., Mervyn Shepherd, Graham J. King, Jakob B. Butler, Jules S. Freeman, David J. Lee, Brad M. Potts et al. „Pests, diseases, and aridity have shaped the genome of Corymbia citriodora“. Communications Biology 4, Nr. 1 (10.05.2021). http://dx.doi.org/10.1038/s42003-021-02009-0.
Der volle Inhalt der QuelleAnnotation:
AbstractCorymbia citriodora is a member of the predominantly Southern Hemisphere Myrtaceae family, which includes the eucalypts (Eucalyptus, Corymbia and Angophora; ~800 species). Corymbia is grown for timber, pulp and paper, and essential oils in Australia, South Africa, Asia, and Brazil, maintaining a high-growth rate under marginal conditions due to drought, poor-quality soil, and biotic stresses. To dissect the genetic basis of these desirable traits, we sequenced and assembled the 408 Mb genome of Corymbia citriodora, anchored into eleven chromosomes. Comparative analysis with Eucalyptus grandis reveals high synteny, although the two diverged approximately 60 million years ago and have different genome sizes (408 vs 641 Mb), with few large intra-chromosomal rearrangements. C. citriodora shares an ancient whole-genome duplication event with E. grandis but has undergone tandem gene family expansions related to terpene biosynthesis, innate pathogen resistance, and leaf wax formation, enabling their successful adaptation to biotic/abiotic stresses and arid conditions of the Australian continent.
16
Ларькина, Н. И. „GENUS NICOTIANA – MODEL BIOLOGICAL OBJECT FOR GENETIC RESEARCH FOR DISEASE RESISTANCE“. Естественные и технические науки, Nr. 1(152) (12.03.2021). http://dx.doi.org/10.25633/etn.2021.01.03.
Der volle Inhalt der QuelleAnnotation:
По результатам мониторинговых исследований рода Nicotiana (Никоциана) отмечено, что он принадлежит к семейству Solanasea (Пасленовых). В составе рода обнаружено более 66 видов, распространенных в Центральной и Южной Америке, Австралии и на островах между ними.Ботанические особенности видов, как модельных культур, используются в разных биологических направлениях при генетических исследованиях.Особенно важным признаком, которому уделяется внимание исследователей, является присутствие генов иммунитета и устойчивости к различным болезням и вредителям в генотипе представителей рода. According to the results of monitoring studies of the genus Nicotiana (Nicocyanum), it is noted that it belongs to the family Solanasea (Solanaceae). The genus contains more than 60 species distributed in Central and South America, Australia and the Islands between them. Botanical features of species as model crops are used in different biological directions in genetic research. A particularly important feature that researchers pay attention to is the presence of genes for immunity and resistance to various diseases and pests in the genotype of members of the genus.
17
Canning, Adam D. „Rediscovering wild food to diversify production across Australia's agricultural landscapes“. Frontiers in Sustainable Food Systems 6 (31.10.2022). http://dx.doi.org/10.3389/fsufs.2022.865580.
Der volle Inhalt der QuelleAnnotation:
Conventional agriculture currently relies on the intensive and expansive growth of a small number of monocultures, this is both risky for food security and is causing substantial environmental degradation. Crops are typically grown far from their native origins, enduring climates, pests, and diseases that they have little evolutionary adaptation to. As a result, farming practices involve modifying the environment to suit the crop, often via practices including vegetation clearing, drainage, irrigation, tilling, and the application of fertilizers, pesticides, and herbicides. One avenue for improvement, however, is the diversification of monoculture agricultural systems with traditional foods native to the area. Native foods benefit from evolutionary history, enabling adaptation to local environmental conditions, reducing the need for environmental modifications and external inputs. Traditional use of native foods in Australia has a rich history, yet the commercial production of native foods remains small compared with conventional crops, such as wheat, barley and sugarcane. Identifying what native crops can grow where would be a first step in scoping potential native food industries and supporting farmers seeking to diversify their cropping. In this study, I modeled the potentially suitable distributions of 177 native food and forage species across Australia, given their climate and soil preferences. The coastal areas of Queensland's wet tropics, south-east Queensland, New South Wales, and Victoria were predicted to support the greatest diversity of native food and forage species (as high 80–120 species). These areas also correspond to the nation's most agriculturally intensive areas, including much of the Murray-Darling Basin, suggesting high potential for the diversification of existing intensive monocultures. Native crops with the most expansive potential distribution include Acacia trees, Maloga bean, bush plum, Emu apple, native millet, and bush tomatoes, with these crops largely being tolerant of vast areas of semi-arid conditions. In addition to greater food security, if diverse native cropping results in greater ecosystem service provisioning, through carbon storage, reduced water usage, reduced nutrient runoff, or greater habitat provision, then payment for ecosystem service schemes could also provide supplemental farm income.